The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007507	Salmonella enterica subsp. enterica serovar Enteritidis strain Durban chromosome, complete genome	4678926	934777	942090	4678926	integrase,protease	Dickeya_phage(16.67%)	7	923515:923529	942308:942322
923515:923529	attL	AGCCTGCGAGGAGAC	NA	NA	NA	NA
WP_001201751.1|934777_935896_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125875.1|935892_937839_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|937968_938190_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|938513_938834_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|938864_941141_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|941353_941551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001539594.1|941712_942090_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
942308:942322	attR	GTCTCCTCGCAGGCT	NA	NA	NA	NA
>prophage 2
NZ_CP007507	Salmonella enterica subsp. enterica serovar Enteritidis strain Durban chromosome, complete genome	4678926	1013802	1024596	4678926	tail	Escherichia_phage(37.5%)	9	NA	NA
WP_000274547.1|1013802_1014432_+	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.9	1.6e-75
WP_000729406.1|1014415_1015042_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.6	3.3e-92
WP_000583382.1|1015038_1016748_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	66.0	1.5e-91
WP_000143167.1|1016747_1017329_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001674638.1|1017806_1018775_+	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.4	3.0e-193
WP_000334547.1|1019422_1020049_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001525490.1|1020408_1021095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497441.1|1021365_1021557_-	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_000193790.1|1021983_1024596_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	6.3e-20
>prophage 3
NZ_CP007507	Salmonella enterica subsp. enterica serovar Enteritidis strain Durban chromosome, complete genome	4678926	1226160	1275411	4678926	protease,lysis,integrase,holin,tail	Salmonella_phage(28.57%)	47	1225996:1226025	1245617:1245646
1225996:1226025	attL	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_000087636.1|1226160_1227240_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.0e-101
WP_001575998.1|1227214_1227493_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	37.5	1.4e-10
WP_001237395.1|1227906_1229886_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_000911593.1|1230574_1230823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000940753.1|1230886_1231486_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	4.7e-96
WP_000784710.1|1231482_1231710_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|1231839_1232529_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|1232625_1233150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798708.1|1233523_1233973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001574215.1|1234333_1235020_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
WP_001574216.1|1235295_1235625_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984586.1|1235608_1236061_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001541990.1|1236078_1236558_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000877926.1|1237452_1237986_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|1238075_1238771_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000161704.1|1242825_1243548_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_001536069.1|1244027_1244828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077681935.1|1246685_1247180_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	3.7e-22
1245617:1245646	attR	ACAGGAATCGTATTCGGTCTCTTTTTATTT	NA	NA	NA	NA
WP_001013467.1|1247369_1247600_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|1247653_1248187_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_000789530.1|1248443_1248611_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001576014.1|1248675_1248864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348541.1|1248918_1249410_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.1e-42
WP_001687735.1|1251514_1252015_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	77.4	1.5e-63
WP_012543349.1|1252111_1252312_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000457876.1|1252881_1253007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951652.1|1253507_1253654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|1254141_1254756_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|1254765_1254924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|1255056_1255971_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001576018.1|1259109_1259250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001576019.1|1259415_1259685_-	hypothetical protein	NA	B6SCX2	Bacteriophage	47.9	3.1e-07
WP_001025515.1|1260057_1260477_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000030934.1|1260849_1261326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422882.1|1261655_1262051_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000182071.1|1262735_1263458_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|1263742_1263907_+	membrane protein	NA	NA	NA	NA	NA
WP_000986173.1|1264130_1264781_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	7.2e-58
WP_000457838.1|1264799_1264991_-	YebW family protein	NA	NA	NA	NA	NA
WP_024131108.1|1265101_1265338_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001531515.1|1265455_1266895_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001529852.1|1266972_1269606_-	PqiB family protein	NA	NA	NA	NA	NA
WP_001207294.1|1269574_1270858_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001518229.1|1270986_1271484_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431401.1|1271581_1272268_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001091237.1|1272287_1274336_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000984498.1|1274529_1275411_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 4
NZ_CP007507	Salmonella enterica subsp. enterica serovar Enteritidis strain Durban chromosome, complete genome	4678926	1466698	1480974	4678926	holin,tRNA	Escherichia_phage(66.67%)	19	NA	NA
WP_000123686.1|1466698_1468072_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001156217.1|1468115_1469051_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.3	7.2e-144
WP_001676915.1|1469367_1469985_-	exodeoxyribonuclease	NA	A0A088CD28	Shigella_phage	41.9	2.5e-36
WP_000800272.1|1470012_1470330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000560208.1|1470414_1470636_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	83.6	7.9e-33
WP_000004762.1|1471073_1471595_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_085981757.1|1471702_1471858_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	48.9	2.6e-06
WP_001227859.1|1472242_1472710_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	66.9	1.0e-53
WP_001676916.1|1472982_1473312_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.7	6.5e-23
WP_001033796.1|1473473_1474028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556389.1|1474024_1474957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000882662.1|1475326_1475539_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000734094.1|1475829_1476000_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	61.8	8.5e-11
WP_000940751.1|1476062_1476662_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	5.5e-97
WP_000774470.1|1476661_1476952_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	76.0	5.1e-40
WP_000640113.1|1476948_1477485_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	70.9	1.4e-70
WP_001688615.1|1479972_1480161_+	hypothetical protein	NA	Q8W636	Enterobacteria_phage	57.4	9.4e-11
WP_000445513.1|1480150_1480432_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	49.4	1.3e-16
WP_000802786.1|1480428_1480974_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	83.4	2.3e-89
>prophage 5
NZ_CP007507	Salmonella enterica subsp. enterica serovar Enteritidis strain Durban chromosome, complete genome	4678926	2134611	2145118	4678926		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|2134611_2135925_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565913.1|2135951_2137031_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648783.1|2137035_2137809_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018223.1|2137824_2138799_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|2138804_2139356_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_000857535.1|2139356_2140235_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|2140282_2141182_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|2141181_2142267_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|2142643_2143537_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001144948.1|2143714_2145118_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	4.0e-21
>prophage 6
NZ_CP007507	Salmonella enterica subsp. enterica serovar Enteritidis strain Durban chromosome, complete genome	4678926	2212315	2221486	4678926	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195340.1|2212315_2214349_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703145.1|2214589_2215048_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	6.4e-53
WP_001197951.1|2215219_2215750_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950414.1|2215806_2216274_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	4.3e-73
WP_000598637.1|2216320_2217040_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|2217036_2218722_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240421.1|2218944_2219676_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_001261696.1|2219735_2219843_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2219823_2220555_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569168.1|2220538_2221486_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
>prophage 7
NZ_CP007507	Salmonella enterica subsp. enterica serovar Enteritidis strain Durban chromosome, complete genome	4678926	2457924	2463970	4678926		Salmonella_virus(50.0%)	6	NA	NA
WP_000377779.1|2457924_2458866_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.6e-146
WP_001576268.1|2460108_2460498_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	85.6	1.1e-50
WP_000703599.1|2460466_2460721_+	glycosyltransferase	NA	A8CG95	Salmonella_phage	79.5	3.1e-25
WP_000400616.1|2460738_2462661_+	acyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	77.3	5.6e-300
WP_105789228.1|2463650_2463794_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	82.9	1.7e-12
WP_108629174.1|2463838_2463970_-	hypothetical protein	NA	A0A1R3Y5S2	Salmonella_virus	68.6	4.0e-08
>prophage 8
NZ_CP007507	Salmonella enterica subsp. enterica serovar Enteritidis strain Durban chromosome, complete genome	4678926	2693355	2793303	4678926	capsid,plate,transposase,portal,head,tRNA,lysis,integrase,tail,terminase	Salmonella_phage(75.93%)	90	2711728:2711742	2792208:2792222
WP_000083345.1|2693355_2694093_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219174.1|2694222_2695557_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_001675040.1|2695574_2696474_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000188410.1|2696576_2697164_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627811.1|2697225_2697609_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000179978.1|2697927_2698617_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000997368.1|2698732_2699770_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098733.1|2699973_2700393_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	5.9e-13
WP_000183642.1|2700465_2701146_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082648.1|2701199_2703860_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949286.1|2703974_2705330_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264473.1|2705374_2705698_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807815.1|2705694_2706996_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.8e-44
WP_000985655.1|2707099_2707555_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	49.3	3.9e-34
2711728:2711742	attL	TTTGAGTTCCCGGCC	NA	NA	NA	NA
WP_001235093.1|2713334_2715908_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.0e-127
WP_000992636.1|2716037_2716769_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|2716765_2717746_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197660.1|2717877_2718615_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|2718886_2719225_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010989056.1|2719328_2719376_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200077.1|2719475_2720636_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000210984.1|2720596_2721505_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000225188.1|2721562_2722684_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|2722693_2723764_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212379.1|2724203_2724722_+	YfiR family protein	NA	NA	NA	NA	NA
WP_001030985.1|2724714_2725935_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_000065257.1|2726091_2726439_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|2726479_2727247_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043266.1|2727291_2727840_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|2727858_2728107_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460052.1|2728359_2729721_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001537507.1|2729886_2730678_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127172650.1|2730697_2731984_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287926.1|2732104_2732710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|2732744_2733335_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059151.1|2733458_2734337_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880965.1|2734422_2736084_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203445.1|2736232_2736571_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112990.1|2736736_2737027_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242603.1|2737016_2737493_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|2737642_2738125_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_001237694.1|2738739_2750214_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_000533863.1|2750278_2751688_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_000196151.1|2751684_2753865_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_012543392.1|2753872_2755036_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000980500.1|2755587_2755806_-	ogr/Delta-like zinc finger family protein	NA	E5G6Q4	Salmonella_phage	100.0	2.1e-38
WP_001102269.1|2755874_2756975_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	100.0	2.6e-201
WP_000980411.1|2756971_2757457_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	100.0	6.7e-77
WP_001677191.1|2757453_2760261_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	100.0	0.0e+00
WP_000763316.1|2760253_2760373_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_001280963.1|2760387_2760690_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	100.0	1.5e-45
WP_001207651.1|2760744_2761260_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	100.0	9.3e-93
WP_000046108.1|2761269_2762442_-|tail	phage tail sheath protein	tail	E5G6P7	Salmonella_phage	100.0	8.9e-224
WP_000974843.1|2762544_2762769_-	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	100.0	1.5e-34
WP_000143187.1|2763638_2764214_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	100.0	4.3e-107
WP_001274649.1|2764213_2766067_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	100.0	0.0e+00
WP_001086804.1|2766063_2766669_-|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	100.0	1.3e-117
WP_000268332.1|2766661_2767570_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	100.0	5.4e-160
WP_000189373.1|2767556_2767916_-	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	100.0	1.1e-60
WP_001672413.1|2767912_2768491_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000958562.1|2768568_2769420_+	hypothetical protein	NA	E5G6N5	Salmonella_phage	100.0	2.8e-163
WP_000343949.1|2769421_2769868_-	phage virion morphogenesis protein	NA	E5G6N4	Salmonella_phage	99.3	2.3e-71
WP_001039958.1|2769860_2770292_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	100.0	1.7e-76
WP_000196199.1|2770387_2770816_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	100.0	2.3e-68
WP_001069923.1|2770812_2771328_-	lysozyme	NA	E5G6N1	Salmonella_phage	100.0	5.3e-96
WP_000171565.1|2771308_2771524_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_000868184.1|2771527_2771731_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000673537.1|2771730_2772195_-|head	head completion/stabilization protein	head	E5G6M8	Salmonella_phage	100.0	9.9e-86
WP_000059173.1|2772288_2772939_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	100.0	4.9e-115
WP_000730759.1|2772942_2774004_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	100.0	2.1e-195
WP_000216276.1|2774020_2774854_-|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_001098395.1|2774996_2776763_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	97.1	0.0e+00
WP_001542203.1|2776762_2777803_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	100.0	5.5e-201
WP_001284991.1|2777906_2779571_-	AIPR family protein	NA	E5G6M2	Salmonella_phage	100.0	0.0e+00
WP_001673609.1|2779884_2780562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|2780675_2780909_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154433.1|2780919_2781108_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	100.0	1.4e-27
WP_000017507.1|2781260_2783675_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	100.0	0.0e+00
WP_000104187.1|2783671_2784529_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	100.0	6.8e-165
WP_000752613.1|2784525_2784753_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244219.1|2784752_2784986_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	100.0	1.7e-33
WP_000963474.1|2785053_2785395_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	100.0	1.2e-56
WP_000956190.1|2785358_2785559_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_000460848.1|2785566_2786076_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	100.0	1.5e-87
WP_000932273.1|2786472_2787105_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000218402.1|2787107_2788124_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	100.0	5.0e-199
WP_000360326.1|2788676_2789339_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	100.0	3.4e-124
WP_001142974.1|2789600_2790194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000445376.1|2790592_2791396_+	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	44.7	1.2e-62
WP_089113803.1|2792191_2793303_-|transposase	IS3-like element IS1351 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	25.6	7.6e-07
2792208:2792222	attR	TTTGAGTTCCCGGCC	NA	NA	NA	NA
>prophage 1
NZ_CP007508	Salmonella enterica subsp. enterica serovar Enteritidis strain Durban plasmid unnamed, complete sequence	59372	43916	50824	59372	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_000925628.1|43916_44339_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	2.0e-29
WP_000457542.1|44338_45613_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	3.9e-156
WP_000064277.1|45694_46669_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	53.5	5.1e-84
WP_000427676.1|46668_47874_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_000728919.1|48288_49230_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.7	4.7e-74
WP_000176303.1|49226_49832_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001527010.1|49888_50224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001541564.1|50407_50824_-	hypothetical protein	NA	O64348	Escherichia_phage	42.9	8.2e-07
