The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004406	Lactobacillus plantarum DOMLa chromosome, complete genome	3198796	15166	53448	3198796	integrase,portal,capsid,head,terminase,tail,transposase	Staphylococcus_phage(28.57%)	32	9645:9659	55006:55020
9645:9659	attL	ATTTCCCGGGAAATA	NA	NA	NA	NA
WP_059374064.1|15166_16846_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	2.1e-93
WP_003641639.1|17162_18386_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	33.6	2.4e-54
WP_003643611.1|18407_19205_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.2	1.0e-45
WP_012778280.1|19223_20462_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.9	6.3e-111
WP_003641642.1|20922_22539_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012778281.1|22869_24774_+	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_003641645.1|24763_25903_+	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_003641646.1|25899_27072_+	glucose-1-phosphate adenylyltransferase subunit GlgD	NA	NA	NA	NA	NA
WP_012778282.1|27064_28504_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_003643612.1|28523_30920_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.9	1.6e-09
WP_012778283.1|30937_32755_+	glycoside hydrolase family 13 protein	NA	NA	NA	NA	NA
WP_003641650.1|33087_33855_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_012778284.1|34006_34678_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_011100855.1|34695_37416_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_003641653.1|37803_38253_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_003643615.1|38451_38652_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.6	2.8e-21
WP_012778285.1|38743_38974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012778286.1|39442_40597_-|integrase	site-specific integrase	integrase	A0A172LN96	Lactococcus_phage	36.5	5.2e-59
WP_012778287.1|40675_41320_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015640734.1|41468_41648_+	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	87.9	4.3e-21
WP_012778290.1|41915_42146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012778291.1|42159_42960_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_012778292.1|42959_44354_+	virulence protein	NA	Q4ZD27	Staphylococcus_phage	35.9	3.2e-71
WP_003645297.1|44497_44917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012778293.1|44941_45124_+	sporulation protein Cse60	NA	NA	NA	NA	NA
WP_012778294.1|45133_45472_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	36.6	1.4e-09
WP_012778295.1|45464_45854_+	HNH endonuclease	NA	A0A1J0MFT4	Staphylococcus_phage	43.5	3.3e-18
WP_012778296.1|46662_47661_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.6	2.4e-52
WP_012778297.1|47805_48279_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_012778300.1|50134_51235_+|portal	phage portal protein	portal	A0A2H4J8V4	uncultured_Caudovirales_phage	34.6	3.0e-48
WP_012778301.1|51231_52773_+|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	25.9	9.1e-43
WP_012778302.1|53181_53448_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
55006:55020	attR	ATTTCCCGGGAAATA	NA	NA	NA	NA
>prophage 2
NZ_CP004406	Lactobacillus plantarum DOMLa chromosome, complete genome	3198796	331553	380045	3198796	protease,bacteriocin	Bacillus_virus(33.33%)	43	NA	NA
WP_003643762.1|331553_332117_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_011100974.1|332310_332979_+	ribose 5-phosphate isomerase A	NA	NA	NA	NA	NA
WP_003641930.1|333128_334634_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_003643763.1|334898_335267_+	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_015825106.1|335379_335889_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011100975.1|335919_337116_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_003641934.1|337225_337696_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641935.1|337714_338170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641936.1|338273_338846_+	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_003646441.1|339011_339932_-	ribonucleoside hydrolase RihC	NA	NA	NA	NA	NA
WP_015825107.1|340068_340968_+	oxidoreductase	NA	NA	NA	NA	NA
WP_015825108.1|341407_343288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646442.1|343459_343906_-	ribonuclease H	NA	NA	NA	NA	NA
WP_003641940.1|344143_345670_+	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_015825109.1|345670_346642_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.7	1.7e-23
WP_015825110.1|346719_348051_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003643773.1|348516_350034_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003643774.1|350048_351878_+	type 1 glycerol-3-phosphate oxidase	NA	NA	NA	NA	NA
WP_015825111.1|351892_352615_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.5	9.2e-30
WP_015825112.1|353201_356885_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_015825113.1|356886_358761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825114.1|358766_359309_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_015825115.1|359323_359587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003641960.1|359698_359974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015379760.1|360356_360974_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003646460.1|360977_362132_-	MFS transporter	NA	NA	NA	NA	NA
WP_015825116.1|362135_362927_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_015379762.1|362997_363870_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_015825117.1|364029_364845_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_011100994.1|365370_366747_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_015825118.1|366791_367976_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_015825119.1|368363_368567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825120.1|368938_369607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154766382.1|370164_370338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825121.1|370350_371691_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_015825122.1|371691_372435_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_015825123.1|372728_373502_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015825124.1|373600_373759_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnF	bacteriocin	NA	NA	NA	NA
WP_003641985.1|373783_373954_-|bacteriocin	two-peptide bacteriocin plantaricin EF subunit PlnE	bacteriocin	NA	NA	NA	NA
WP_015825125.1|374220_376371_+	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.9	6.1e-45
WP_015825126.1|376386_377763_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_015825127.1|377852_378542_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_015825129.1|379364_380045_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP004406	Lactobacillus plantarum DOMLa chromosome, complete genome	3198796	482644	540117	3198796	protease,integrase,portal,capsid,terminase,tail,transposase	Lactobacillus_phage(87.23%)	67	499514:499533	532379:532398
WP_015825156.1|482644_484315_+|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	41.5	4.7e-93
WP_003643855.1|490791_492264_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	34.3	2.1e-68
WP_003640888.1|492318_493161_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015825157.1|493722_494181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825158.1|494360_494885_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003640891.1|494915_495251_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011101053.1|495285_496128_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_015825159.1|496286_497393_-	anion permease	NA	NA	NA	NA	NA
WP_015825160.1|497585_498407_-	nicotinamide mononucleotide transporter	NA	A0A2K9VCL6	Lactobacillus_phage	42.2	2.6e-52
WP_003640895.1|498767_499559_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	36.1	3.5e-30
499514:499533	attL	GAAGGGAATTGATGCAACGA	NA	NA	NA	NA
WP_003644997.1|499637_500774_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_003640897.1|500797_501499_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003643865.1|501668_502406_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_003640899.1|502562_504041_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.1	2.5e-106
WP_003640900.1|504040_504868_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.0	6.5e-72
WP_015825161.1|505323_507978_+	cation-translocating P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	29.1	1.8e-70
WP_015825162.1|508032_508467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825163.1|508760_510932_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_015825164.1|510931_511378_+	SprT family protein	NA	NA	NA	NA	NA
WP_015825165.1|511443_512730_+	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_003644991.1|512738_513614_+	homoserine kinase	NA	NA	NA	NA	NA
WP_003643870.1|513904_515062_-|integrase	site-specific integrase	integrase	A0A2P0ZL94	Lactobacillus_phage	97.7	1.0e-216
WP_003643871.1|515231_515900_-	GIY-YIG nuclease family protein	NA	A0A2P0ZL92	Lactobacillus_phage	99.1	2.0e-124
WP_003643872.1|516012_516444_-	universal stress protein	NA	A0A2P0ZL98	Lactobacillus_phage	98.6	1.2e-74
WP_003643873.1|516543_516801_-	hypothetical protein	NA	A0A2P0ZL96	Lactobacillus_phage	95.3	1.7e-39
WP_003643874.1|516924_517101_-	hypothetical protein	NA	A0A2P0ZL93	Lactobacillus_phage	100.0	2.4e-24
WP_003643875.1|517268_517937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643876.1|518028_518460_-	hypothetical protein	NA	A0A2P0ZLA0	Lactobacillus_phage	100.0	7.6e-80
WP_003643877.1|518469_518847_-	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	69.4	5.3e-45
WP_003643878.1|519159_519369_+	hypothetical protein	NA	A0A2P0ZL97	Lactobacillus_phage	100.0	7.0e-31
WP_003643879.1|519372_519588_+	hypothetical protein	NA	A0A2P0ZLA4	Lactobacillus_phage	100.0	6.9e-26
WP_099112459.1|519581_519767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643880.1|519838_520111_+	hypothetical protein	NA	A0A2P0ZLA9	Lactobacillus_phage	98.9	3.6e-43
WP_003643881.1|520249_520699_+	hypothetical protein	NA	A0A2P0ZLA2	Lactobacillus_phage	96.0	6.9e-76
WP_015825166.1|520854_521040_+	hypothetical protein	NA	A0A2P0ZLA3	Lactobacillus_phage	91.8	2.4e-27
WP_021730257.1|521011_521182_+	hypothetical protein	NA	A0A2P0ZLA6	Lactobacillus_phage	98.2	5.5e-26
WP_016511377.1|521254_521506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643883.1|521502_521754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643884.1|521750_522230_+	siphovirus Gp157 family protein	NA	A0A2P0ZLB3	Lactobacillus_phage	95.6	1.3e-80
WP_003643885.1|522381_523641_+	DEAD/DEAH box helicase family protein	NA	A0A2P0ZLA5	Lactobacillus_phage	95.0	1.9e-227
WP_003643886.1|523637_524354_+	AAA family ATPase	NA	A0A2P0ZLB2	Lactobacillus_phage	99.1	3.5e-114
WP_003643887.1|524356_524956_+	hypothetical protein	NA	A0A2P0ZLB9	Lactobacillus_phage	98.9	1.6e-96
WP_003643888.1|524969_525524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643889.1|525597_526392_+	bifunctional DNA primase/polymerase	NA	A0A2P0ZLB0	Lactobacillus_phage	97.0	2.5e-145
WP_003643890.1|526388_527663_+	helicase	NA	A0A2P0ZLC4	Lactobacillus_phage	98.8	7.1e-243
WP_003643891.1|527920_528253_+	VRR-NUC domain-containing protein	NA	A0A2P0ZLB6	Lactobacillus_phage	96.4	8.2e-58
WP_003643892.1|528272_528497_+	hypothetical protein	NA	A0A2P0ZLC3	Lactobacillus_phage	87.8	1.1e-13
WP_162273788.1|528474_528909_+	hypothetical protein	NA	A0A2K9VD97	Lactobacillus_phage	57.4	4.7e-37
WP_003643894.1|528905_529367_+	DUF1642 domain-containing protein	NA	A0A2P0ZLB8	Lactobacillus_phage	47.5	1.9e-28
WP_003643895.1|529493_529805_+	hypothetical protein	NA	A0A2P0ZLD0	Lactobacillus_phage	97.1	2.6e-50
WP_003643896.1|529816_530248_+	hypothetical protein	NA	A0A2P0ZLC0	Lactobacillus_phage	97.1	2.7e-69
WP_003643897.1|530426_531134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003643898.1|531202_531418_+	hypothetical protein	NA	A0A2P0ZLC2	Lactobacillus_phage	81.4	2.2e-27
WP_033615432.1|531401_531740_+	HNH endonuclease	NA	A0A2P0ZLC6	Lactobacillus_phage	93.8	5.2e-60
WP_003643899.1|531739_531994_+	hypothetical protein	NA	A0A2P0ZLD3	Lactobacillus_phage	82.5	5.9e-32
WP_003643900.1|532027_532279_+	hypothetical protein	NA	A0A2P0ZLD2	Lactobacillus_phage	89.2	7.3e-35
WP_015825169.1|532389_532677_+|terminase	P27 family phage terminase small subunit	terminase	A0A2P0ZLC8	Lactobacillus_phage	88.4	1.9e-39
532379:532398	attR	GAAGGGAATTGATGCAACGA	NA	NA	NA	NA
WP_015825170.1|532673_534356_+|terminase	terminase large subunit	terminase	A0A2P0ZLE5	Lactobacillus_phage	99.1	0.0e+00
WP_003643903.1|534374_535517_+|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	96.3	6.4e-211
WP_015825171.1|535503_536247_+|protease	Clp protease ClpP	protease	A0A2P0ZLE3	Lactobacillus_phage	97.6	1.4e-129
WP_003643905.1|536267_537446_+|capsid	phage major capsid protein	capsid	A0A2P0ZLD6	Lactobacillus_phage	98.7	1.6e-217
WP_003643906.1|537585_537891_+	hypothetical protein	NA	A0A2P0ZLD5	Lactobacillus_phage	91.1	1.6e-44
WP_003643907.1|537871_538261_+	hypothetical protein	NA	A0A2P0ZLD1	Lactobacillus_phage	89.1	3.4e-63
WP_003643908.1|538257_538665_+	hypothetical protein	NA	A0A2P0ZLD7	Lactobacillus_phage	97.8	3.3e-69
WP_003643909.1|538661_539084_+	hypothetical protein	NA	A0A2P0ZLE4	Lactobacillus_phage	98.6	7.4e-72
WP_003643910.1|539098_539710_+|tail	tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	97.0	1.1e-105
WP_003643911.1|539802_540117_+	hypothetical protein	NA	A0A2P0ZLF3	Lactobacillus_phage	90.4	4.2e-48
>prophage 4
NZ_CP004406	Lactobacillus plantarum DOMLa chromosome, complete genome	3198796	1006892	1100201	3198796	protease,integrase,portal,capsid,head,terminase,tail,transposase,tRNA	Lactobacillus_phage(61.82%)	98	1078313:1078327	1103191:1103205
WP_015825317.1|1006892_1007213_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_015825318.1|1007212_1008676_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_015825319.1|1008675_1010100_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_003641344.1|1010204_1011227_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.5	2.6e-17
WP_015825320.1|1011560_1012934_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.0	3.2e-124
WP_003641346.1|1013387_1013966_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003646275.1|1014232_1016572_+	cation-translocating P-type ATPase	NA	M1HI01	Paramecium_bursaria_Chlorella_virus	24.8	7.1e-39
WP_003644132.1|1016821_1018138_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_003641349.1|1018130_1019015_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003644133.1|1019139_1020018_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003641351.1|1020042_1020819_+	lysozyme	NA	A0A141HSE6	Bacillus_phage	31.1	2.6e-06
WP_003641352.1|1020974_1021340_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_003638174.1|1021683_1021884_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.4	3.1e-20
WP_003641353.1|1022070_1023078_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_003641354.1|1023090_1024425_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.9	2.9e-37
WP_015825321.1|1024666_1025848_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	37.6	1.5e-58
WP_003641356.1|1026015_1026330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641358.1|1026663_1026864_-	hypothetical protein	NA	E9LUS6	Lactobacillus_phage	100.0	4.9e-26
WP_041161662.1|1026875_1027691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003641360.1|1027716_1028106_-	ImmA/IrrE family metallo-endopeptidase	NA	D6PSS8	Lactobacillus_phage	54.3	4.6e-36
WP_003641361.1|1028136_1028463_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Y2R0	Lactobacillus_phage	44.1	6.9e-17
WP_003641362.1|1028719_1028935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049821958.1|1029008_1029752_+	ORF6C domain-containing protein	NA	A0A1P8BM06	Lactococcus_phage	45.6	4.8e-50
WP_015825325.1|1029763_1029973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825327.1|1029985_1030201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825329.1|1031103_1031364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825330.1|1031506_1031686_+	helix-turn-helix domain-containing protein	NA	E9LUT5	Lactobacillus_phage	100.0	1.4e-24
WP_015825331.1|1031719_1031974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825332.1|1031976_1032177_+	hypothetical protein	NA	E9LUT7	Lactobacillus_phage	92.4	2.6e-27
WP_164878063.1|1032188_1032353_+	hypothetical protein	NA	E9LUT8	Lactobacillus_phage	65.4	1.4e-10
WP_021732029.1|1032355_1032502_+	hypothetical protein	NA	E9LUT9	Lactobacillus_phage	93.6	2.3e-17
WP_015825333.1|1032501_1033362_+	DUF1351 domain-containing protein	NA	A0A0P0IV40	Lactobacillus_phage	34.4	3.2e-37
WP_015825334.1|1033361_1033988_+	ERF family protein	NA	D7RWM8	Brochothrix_phage	37.4	6.1e-14
WP_015825335.1|1033984_1034446_+	single-stranded DNA-binding protein	NA	A0A2I2MUI5	uncultured_Caudovirales_phage	57.5	1.4e-39
WP_015825336.1|1034461_1035028_+	HNH endonuclease	NA	A0A249XVQ5	Enterococcus_phage	34.1	4.0e-20
WP_015825337.1|1035033_1035726_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	91.3	2.2e-121
WP_015825338.1|1035775_1036582_+	hypothetical protein	NA	A0A0S2MYA8	Enterococcus_phage	37.2	6.0e-46
WP_015825339.1|1036581_1037367_+	ATP-binding protein	NA	E9LUN6	Lactobacillus_phage	98.9	1.2e-144
WP_013355641.1|1037502_1037811_+	hypothetical protein	NA	E9LUN7	Lactobacillus_phage	94.1	3.2e-48
WP_015825340.1|1038085_1038517_+	transcriptional regulator	NA	E9LUP5	Lactobacillus_phage	93.7	3.4e-72
WP_041161663.1|1038739_1039006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825342.1|1039027_1039687_+	HNH endonuclease	NA	B8R694	Lactobacillus_phage	38.4	2.5e-21
WP_049821959.1|1039878_1040313_+|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	37.7	8.3e-18
WP_015825344.1|1040299_1042216_+|terminase	terminase large subunit	terminase	A0A0M7RDK9	Lactobacillus_phage	41.4	8.2e-134
WP_165274444.1|1042229_1042394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825345.1|1042435_1043554_+|portal	phage portal protein	portal	Q9AZM4	Lactococcus_phage	39.5	3.6e-65
WP_015825346.1|1043525_1044131_+|head,protease	HK97 family phage prohead protease	head,protease	B8R651	Lactobacillus_phage	49.1	8.2e-40
WP_015825347.1|1044137_1045520_+|capsid	phage major capsid protein	capsid	A0A0M7RF71	Lactobacillus_phage	60.1	4.9e-96
WP_015825348.1|1045610_1045889_+	hypothetical protein	NA	A0A2P0ZLF2	Lactobacillus_phage	73.6	2.2e-32
WP_041161664.1|1045889_1046237_+|head	phage head closure protein	head	A0A2P0ZLF0	Lactobacillus_phage	92.2	1.4e-55
WP_015825350.1|1046239_1046647_+	HK97 gp10 family phage protein	NA	A0A2P0ZLE6	Lactobacillus_phage	90.9	1.1e-64
WP_015825351.1|1046646_1047027_+	DUF806 family protein	NA	A0A2P0ZLF4	Lactobacillus_phage	90.5	8.5e-59
WP_015825352.1|1047041_1047683_+|tail	phage tail protein	tail	A0A2P0ZLH1	Lactobacillus_phage	92.0	3.4e-108
WP_015825353.1|1047759_1048134_+|tail	phage tail assembly chaperone	tail	A0A2P0ZLH4	Lactobacillus_phage	93.5	2.0e-57
WP_015825354.1|1048178_1048364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825355.1|1048395_1053546_+	C40 family peptidase	NA	A0A2P0ZLG0	Lactobacillus_phage	53.8	0.0e+00
WP_015825356.1|1053622_1055395_+|tail	phage tail family protein	tail	A0A2P0ZLH2	Lactobacillus_phage	92.9	2.5e-310
WP_015825357.1|1055461_1057873_+|tail	phage tail protein	tail	A0A2P0ZLF8	Lactobacillus_phage	94.5	0.0e+00
WP_015825358.1|1057889_1060685_+|tail	tail fiber protein	tail	E9LUR4	Lactobacillus_phage	71.1	7.5e-221
WP_003641409.1|1060677_1060917_+	hypothetical protein	NA	A0A2K9VDF6	Lactobacillus_phage	97.4	1.9e-32
WP_166485333.1|1060920_1061082_+	hypothetical protein	NA	A0A2P0ZLG1	Lactobacillus_phage	98.1	2.1e-19
WP_015825359.1|1061065_1062181_+	collagen-like protein	NA	A0A2P0ZLF6	Lactobacillus_phage	85.7	9.1e-61
WP_041161665.1|1062177_1062435_+	hypothetical protein	NA	A0A0A1ENR9	Lactobacillus_phage	76.4	3.7e-18
WP_015825360.1|1062447_1063605_+	LysM peptidoglycan-binding domain-containing protein	NA	E9LUR8	Lactobacillus_phage	85.1	3.8e-187
WP_015825361.1|1063604_1063868_+	hemolysin XhlA family protein	NA	E9LUR9	Lactobacillus_phage	98.9	7.4e-38
WP_003643301.1|1064565_1065006_-	universal stress protein	NA	NA	NA	NA	NA
WP_015825363.1|1065139_1066447_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_045352539.1|1066439_1067306_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_076630458.1|1067457_1067658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003643305.1|1067857_1068298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003646269.1|1068730_1069294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825366.1|1069900_1070980_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	32.1	4.2e-18
WP_015825367.1|1070988_1073043_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_172436956.1|1073347_1074703_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_015825369.1|1074959_1076135_+	serine hydrolase	NA	NA	NA	NA	NA
WP_015825370.1|1076324_1077443_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	31.3	7.1e-21
WP_015825371.1|1077829_1078759_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
1078313:1078327	attL	GTGATCTTGAATTTA	NA	NA	NA	NA
WP_003643315.1|1078948_1079665_+	aquaporin family protein	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	32.7	5.6e-19
WP_015825372.1|1079916_1081110_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_077727009.1|1081858_1082068_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_015825374.1|1082064_1082613_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	40.3	3.1e-30
WP_099112445.1|1082681_1083728_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_015825376.1|1084164_1084947_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_015825377.1|1085012_1085978_+	Stealth CR1 domain-containing protein	NA	NA	NA	NA	NA
WP_015825378.1|1085980_1087027_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015825379.1|1087067_1087985_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_015825380.1|1087971_1089057_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_015825381.1|1089117_1090278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015825382.1|1090507_1091170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015825383.1|1091166_1091766_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_015825384.1|1091768_1092905_+	serine hydrolase	NA	NA	NA	NA	NA
WP_015825385.1|1092948_1094487_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_015825386.1|1094502_1095372_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	61.2	9.2e-101
WP_015825387.1|1095375_1095957_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	45.1	2.5e-38
WP_015825388.1|1095966_1096995_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.1	3.8e-69
WP_015825389.1|1097064_1097907_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.2	1.4e-34
WP_049821960.1|1097988_1099515_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_015825391.1|1099604_1100201_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	43.0	9.6e-33
1103191:1103205	attR	GTGATCTTGAATTTA	NA	NA	NA	NA
>prophage 5
NZ_CP004406	Lactobacillus plantarum DOMLa chromosome, complete genome	3198796	1282054	1291901	3198796		Lactobacillus_phage(87.5%)	9	NA	NA
WP_015825454.1|1282054_1283293_+	hypothetical protein	NA	A0A2P0ZL72	Lactobacillus_phage	99.2	6.3e-220
WP_015825455.1|1283383_1284355_-	peptidase S41	NA	A0A2P0ZL68	Lactobacillus_phage	99.4	1.8e-182
WP_003643099.1|1284540_1285488_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	100.0	2.7e-178
WP_003643097.1|1285831_1286446_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	100.0	6.3e-112
WP_015825456.1|1286448_1288887_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	99.5	0.0e+00
WP_003643095.1|1288974_1289535_+	hypothetical protein	NA	A0A2P0ZL75	Lactobacillus_phage	100.0	2.7e-101
WP_011101401.1|1289605_1290046_-	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	98.6	3.0e-76
WP_015380221.1|1290141_1290279_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003645220.1|1290905_1291901_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	38.8	3.1e-52
>prophage 6
NZ_CP004406	Lactobacillus plantarum DOMLa chromosome, complete genome	3198796	2330709	2339220	3198796		Synechococcus_phage(33.33%)	9	NA	NA
WP_003645867.1|2330709_2331288_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.9	1.3e-21
WP_015380733.1|2331280_2332306_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	41.0	1.2e-59
WP_003642591.1|2332302_2333757_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.0	2.5e-50
WP_015825820.1|2333741_2335961_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	40.1	3.8e-143
WP_011101895.1|2335953_2336634_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003642588.1|2336633_2336888_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003642587.1|2336889_2337621_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	37.3	1.6e-37
WP_015380738.1|2337623_2338754_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_003645861.1|2338737_2339220_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.0	2.3e-16
