The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007506	Pandoraea pnomenusa strain RB38, complete genome	5378916	953078	1081586	5378916	transposase	Burkholderia_virus(25.0%)	93	NA	NA
WP_155734150.1|953078_954316_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	87.3	1.6e-143
WP_155734151.1|954485_954716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249780.1|954932_955340_+	DNA mismatch endonuclease Vsr	NA	E5E3X5	Burkholderia_phage	49.6	2.0e-34
WP_025249779.1|955350_955662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025249778.1|955935_956541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081214897.1|957536_958403_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_051519078.1|958417_959776_+	MFS transporter	NA	NA	NA	NA	NA
WP_025249775.1|959860_961066_+	porin	NA	NA	NA	NA	NA
WP_025249774.1|961076_961961_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_025249773.1|961928_962849_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025249772.1|962960_964352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249771.1|964417_965302_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025249770.1|965426_966659_+	CoA transferase	NA	NA	NA	NA	NA
WP_025249769.1|966642_967458_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_025249768.1|967538_968915_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_025249767.1|968880_969759_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_025249766.1|969869_971147_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_025249765.1|971255_972041_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_025249764.1|972056_973016_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_025249763.1|973019_974897_-	bifunctional 3-(3-hydroxy-phenyl)propionate/3-hydroxycinnamic acid hydroxylase	NA	NA	NA	NA	NA
WP_023873218.1|975187_976003_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_023873219.1|976172_977060_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025249762.1|977188_978667_+	D-aminoacylase	NA	NA	NA	NA	NA
WP_025249761.1|978663_980001_+	MFS transporter	NA	NA	NA	NA	NA
WP_023873222.1|979997_981362_+	amidase	NA	NA	NA	NA	NA
WP_029754334.1|981576_981966_+	phosphonate transporter	NA	NA	NA	NA	NA
WP_025249759.1|981962_983303_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.1	1.1e-15
WP_025249758.1|983369_984161_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_025249757.1|984230_985880_-	gamma-glutamyltransferase family protein	NA	NA	NA	NA	NA
WP_025249756.1|985876_988474_-	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	28.1	7.0e-11
WP_023873229.1|988470_989349_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_025249755.1|989420_990683_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_048806837.1|991038_991965_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_155734152.1|992032_992908_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_023873233.1|992925_993561_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_025249753.1|994067_996233_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	25.6	1.4e-17
WP_025249752.1|996229_998026_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_081215018.1|998165_999017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081214898.1|999156_1010997_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.4	4.3e-23
WP_141570902.1|1010993_1011251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155734153.1|1011263_1012500_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	88.0	1.9e-144
WP_072619137.1|1012581_1012986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023873243.1|1013858_1014056_+	DUF4926 domain-containing protein	NA	NA	NA	NA	NA
WP_025249749.1|1014132_1015383_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.7	1.5e-40
WP_141570906.1|1015555_1015999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734154.1|1015985_1019057_-	adhesin	NA	NA	NA	NA	NA
WP_141570910.1|1019113_1019533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051519077.1|1019556_1022736_-	DUF637 domain-containing protein	NA	NA	NA	NA	NA
WP_025249747.1|1023340_1023973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734155.1|1024153_1024573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734156.1|1024652_1025755_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081214899.1|1025833_1026640_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	45.4	3.0e-37
WP_155734157.1|1027041_1029546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155734158.1|1029652_1029823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023872376.1|1030074_1031091_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	31.2	1.4e-36
WP_025249744.1|1031147_1031432_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	48.9	6.8e-13
WP_062802140.1|1031479_1031986_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.2	2.9e-30
WP_155734159.1|1031951_1033039_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_025249741.1|1033695_1033911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025249738.1|1039111_1039474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051519075.1|1039651_1040176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058952727.1|1040126_1042007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155734156.1|1042377_1043480_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_025249736.1|1043751_1044144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155734153.1|1044254_1045491_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	88.0	1.9e-144
WP_025249734.1|1045555_1045798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155734160.1|1046064_1048536_+	adhesin	NA	NA	NA	NA	NA
WP_081214901.1|1048561_1048876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_141570928.1|1048879_1049200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249732.1|1049378_1050395_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	31.2	1.9e-36
WP_023597415.1|1050806_1050941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023597414.1|1051198_1052071_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025249731.1|1052412_1053738_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	40.8	1.1e-81
WP_023873247.1|1053890_1055090_+	amidohydrolase	NA	NA	NA	NA	NA
WP_028731074.1|1055086_1056184_+	DUF2817 domain-containing protein	NA	NA	NA	NA	NA
WP_025249730.1|1056292_1057159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023597409.1|1057454_1058177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025249729.1|1058591_1060376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144347397.1|1060347_1060788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155734161.1|1060754_1061504_+	response regulator	NA	NA	NA	NA	NA
WP_025249727.1|1061500_1062505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080738790.1|1062529_1063378_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_144347396.1|1063313_1064723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081214902.1|1064739_1067325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080738788.1|1067355_1067709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023597356.1|1067932_1068388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023597355.1|1068521_1068803_-	XapX domain-containing protein	NA	NA	NA	NA	NA
WP_025249725.1|1068802_1069252_-	DoxX family protein	NA	NA	NA	NA	NA
WP_025249724.1|1069282_1071142_-	amidohydrolase	NA	NA	NA	NA	NA
WP_023597352.1|1071155_1071842_-	hydrolase	NA	NA	NA	NA	NA
WP_025249723.1|1072088_1072769_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_115344501.1|1079851_1080969_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-47
WP_081214903.1|1080983_1081586_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP007506	Pandoraea pnomenusa strain RB38, complete genome	5378916	1430176	1473430	5378916	transposase,integrase,tRNA,portal,protease,head,tail,terminase,capsid	Pseudomonas_phage(27.27%)	58	1431616:1431675	1475611:1475673
WP_023597078.1|1430176_1431481_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.2	1.6e-96
1431616:1431675	attL	ACTCGAAATCCGGTATACGGTTATACCGTATCGTGGGTTCGAATCCCACCCTCTCCGCCA	NA	NA	NA	NA
WP_025249618.1|1431706_1432759_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	44.1	6.8e-82
WP_150568411.1|1432614_1432944_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_041612570.1|1432996_1433266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249616.1|1433466_1435272_-	type II restriction endonuclease subunit M	NA	H9C171	Pectobacterium_phage	47.1	5.1e-162
WP_025249615.1|1435316_1435709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249614.1|1435719_1436340_-	hypothetical protein	NA	A0A0U1SZL2	Pseudomonas_phage	43.1	1.3e-32
WP_025249613.1|1436332_1437790_-	hypothetical protein	NA	X5I2N5	Pseudomonas_phage	58.2	5.8e-31
WP_141571302.1|1437782_1438073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141571304.1|1438410_1438932_+	hypothetical protein	NA	Q8W6Q5	Burkholderia_virus	44.6	4.3e-05
WP_025249610.1|1438985_1439891_-	hypothetical protein	NA	V5YTD4	Pseudomonas_phage	51.9	3.6e-55
WP_141571306.1|1439887_1440241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025249609.1|1440680_1441028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249608.1|1441239_1441731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249607.1|1441916_1442237_-	hypothetical protein	NA	A2I2Y8	Vibrio_virus	57.0	2.2e-23
WP_115344501.1|1442508_1443625_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-47
WP_155734166.1|1443904_1444693_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_155734167.1|1444694_1445006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081215022.1|1445186_1445678_-	S24 family peptidase	NA	A0A1I9KG86	Aeromonas_phage	45.5	2.4e-29
WP_155734168.1|1446212_1446407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249600.1|1446737_1447331_+	hypothetical protein	NA	A0A0S2SYA8	Pseudomonas_phage	40.6	5.6e-25
WP_155734169.1|1447327_1447516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249599.1|1447526_1447790_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025249598.1|1447786_1448587_+	helix-turn-helix domain-containing protein	NA	Q3HQZ6	Burkholderia_phage	62.9	6.3e-88
WP_025249597.1|1448583_1449240_+	hypothetical protein	NA	Q3HQZ7	Burkholderia_phage	63.0	6.8e-72
WP_029754245.1|1449445_1449745_+	hypothetical protein	NA	A0A1I9KG18	Aeromonas_phage	54.7	1.8e-16
WP_025249594.1|1449741_1450092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249593.1|1450202_1450442_+	hypothetical protein	NA	A0A2H4JA03	uncultured_Caudovirales_phage	65.8	5.4e-19
WP_155734170.1|1450507_1450903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249591.1|1450902_1451331_+	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	58.6	1.9e-11
WP_025249590.1|1451323_1451704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081214914.1|1452055_1452460_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	38.2	1.0e-06
WP_025249588.1|1452510_1452927_+|terminase	terminase	terminase	NA	NA	NA	NA
WP_025249587.1|1452919_1454638_+|terminase	terminase large subunit	terminase	A0A0U4B0M7	Pseudomonas_phage	73.6	2.4e-254
WP_025249586.1|1454634_1455933_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	65.3	1.3e-151
WP_025249585.1|1455937_1456804_+|protease	Clp protease ClpP	protease	A0A2H4PI16	Pseudomonas_phage	53.6	9.5e-74
WP_025249584.1|1456806_1458009_+|capsid	phage major capsid protein	capsid	A0A2H4PI18	Pseudomonas_phage	60.4	2.3e-126
WP_025249581.1|1458779_1459091_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_081214915.1|1459002_1459428_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_025249579.1|1459420_1459933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081214916.1|1459929_1460307_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	43.0	4.2e-18
WP_025249578.1|1460370_1460853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249577.1|1460854_1461184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249576.1|1461264_1461498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249575.1|1461494_1463612_+	hypothetical protein	NA	A0A0U2BXT9	Paracoccus_phage	31.6	3.3e-19
WP_025249574.1|1463611_1463950_+|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	50.9	1.2e-27
WP_155734235.1|1464035_1465058_+	hypothetical protein	NA	A0A0F7LBT2	uncultured_marine_virus	38.8	6.5e-21
WP_025249572.1|1465064_1465769_+|tail	phage minor tail protein L	tail	A0A2R3UA90	Siphoviridae_environmental_samples	62.3	4.8e-84
WP_025249571.1|1465768_1466482_+	C40 family peptidase	NA	A0A1B1IV85	uncultured_Mediterranean_phage	52.2	1.7e-68
WP_025249570.1|1466513_1466852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249569.1|1466913_1467510_+|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	57.9	2.3e-50
WP_025249568.1|1467576_1470738_+	host specificity protein J	NA	Q8W6T0	Burkholderia_virus	56.3	0.0e+00
WP_025249567.1|1470737_1471040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155734171.1|1471054_1471798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249565.1|1471865_1472207_+	hypothetical protein	NA	Q6J1Q7	Burkholderia_virus	68.2	1.0e-31
WP_025249564.1|1472206_1472485_+	hypothetical protein	NA	Q6J1Q6	Burkholderia_virus	52.2	2.3e-21
WP_025249563.1|1472471_1472948_+	glycoside hydrolase family 104 protein	NA	Q9MC90	Pseudomonas_phage	61.6	4.0e-50
WP_058952725.1|1472944_1473430_+	DUF2514 family protein	NA	C7BGD9	Burkholderia_phage	43.4	8.6e-24
1475611:1475673	attR	ACTCGAAATCCGGTATACGGTTATACCGTATCGTGGGTTCGAATCCCACCCTCTCCGCCAAGC	NA	NA	NA	NA
>prophage 3
NZ_CP007506	Pandoraea pnomenusa strain RB38, complete genome	5378916	1758023	1767273	5378916	integrase	Burkholderia_virus(42.86%)	12	1750041:1750056	1774042:1774057
1750041:1750056	attL	ACCATGGCGAGCAACA	NA	NA	NA	NA
WP_025249438.1|1758023_1759937_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.9	4.6e-20
WP_029754174.1|1760124_1760442_-|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	47.6	4.8e-15
WP_144347378.1|1760655_1760841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155734239.1|1760901_1761309_+	glycoside hydrolase family protein	NA	A0A0U4JP67	Pseudomonas_phage	54.5	8.0e-31
WP_150646730.1|1761338_1761680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249434.1|1762006_1762798_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	78.6	1.6e-123
WP_025249433.1|1762807_1763122_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	73.1	2.6e-29
WP_025249432.1|1763125_1763422_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	62.2	3.5e-28
WP_155734178.1|1763829_1764510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155734179.1|1764720_1765479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025249429.1|1765633_1766242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025249428.1|1766247_1767273_-	ParA family protein	NA	Q56VQ0	Pseudomonas_phage	61.1	2.8e-104
1774042:1774057	attR	TGTTGCTCGCCATGGT	NA	NA	NA	NA
