The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006837	Lysinibacillus varians strain GY32 chromosome, complete genome	4662822	32543	43992	4662822		uncultured_virus(33.33%)	10	NA	NA
WP_025218317.1|32543_36056_-	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	36.9	1.0e-49
WP_024362940.1|36251_36767_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_025218318.1|36905_37241_+	winged helix-turn-helix transcriptional regulator	NA	A0A218MNF3	uncultured_virus	39.7	4.7e-05
WP_025218319.1|37272_38223_+	cation transporter	NA	NA	NA	NA	NA
WP_024362943.1|38299_38632_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_024362944.1|38689_38896_+	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_025218320.1|38977_41386_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.3	1.3e-125
WP_024362946.1|41755_42394_+	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	22.9	3.2e-10
WP_024362947.1|42390_43059_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	35.8	1.1e-24
WP_038509323.1|43461_43992_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	38.0	8.8e-22
>prophage 2
NZ_CP006837	Lysinibacillus varians strain GY32 chromosome, complete genome	4662822	312241	348847	4662822	plate,holin,integrase,head,tail,terminase,capsid,portal,protease	Bacillus_phage(33.33%)	52	312211:312232	350791:350812
312211:312232	attL	TTTAACCCCAATTTAACCCCAT	NA	NA	NA	NA
WP_025218436.1|312241_313429_-|integrase	site-specific integrase	integrase	A0A2I7SC08	Paenibacillus_phage	39.8	1.7e-73
WP_024360913.1|313637_313856_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_080653265.1|313992_314394_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JDE4	uncultured_Caudovirales_phage	58.0	4.6e-15
WP_025218437.1|314578_314794_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025218438.1|314809_314992_+	helix-turn-helix domain-containing protein	NA	U5P0W4	Brevibacillus_phage	51.0	1.6e-07
WP_038509361.1|314988_315168_+	hypothetical protein	NA	A0A2H4J246	uncultured_Caudovirales_phage	65.0	4.2e-08
WP_025218439.1|315221_315569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025218440.1|315568_315826_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	82.0	1.3e-15
WP_025218441.1|316048_317272_+	DEAD/DEAH box helicase	NA	A0A1B1P7L4	Bacillus_phage	82.3	2.2e-201
WP_025218442.1|317272_317599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025218443.1|317567_318164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025218444.1|318274_318559_+	nuclease	NA	A0A1B1P7M6	Bacillus_phage	91.4	1.4e-45
WP_025218445.1|318555_320412_+	AAA family ATPase	NA	A0A1B1P7N0	Bacillus_phage	73.8	1.3e-221
WP_025218446.1|320442_320754_+	hypothetical protein	NA	A0A1B1P7N6	Bacillus_phage	61.7	9.8e-21
WP_025218447.1|320753_321242_+	DUF669 domain-containing protein	NA	A0A1B1P7N3	Bacillus_phage	74.8	2.4e-66
WP_025218448.1|321290_321746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025218449.1|321841_323524_+	DNA polymerase	NA	A0A1B1P7M5	Bacillus_phage	80.5	4.9e-276
WP_025218450.1|323566_323833_-	hypothetical protein	NA	A0A2H4JB42	uncultured_Caudovirales_phage	42.9	1.4e-15
WP_025218451.1|323926_325795_+	DNA primase	NA	A0A1B1P7L5	Bacillus_phage	79.6	5.1e-298
WP_025218452.1|326280_326691_+	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	59.8	1.5e-37
WP_025218453.1|326856_327162_+	hypothetical protein	NA	A0A2H4J758	uncultured_Caudovirales_phage	46.4	9.9e-18
WP_025218454.1|327158_327506_+	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	60.7	5.2e-39
WP_025218455.1|327627_328161_+	hypothetical protein	NA	A0A2H4J216	uncultured_Caudovirales_phage	55.2	3.4e-37
WP_025218456.1|328157_329876_+|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	83.1	1.4e-289
WP_025218457.1|329890_331105_+|portal	phage portal protein	portal	A0A2H4J9C7	uncultured_Caudovirales_phage	66.7	2.2e-148
WP_025218458.1|331070_331658_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B2APW1	Phage_Wrath	70.0	5.7e-70
WP_025218459.1|331650_332988_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	65.1	4.2e-137
WP_025218460.1|332992_333250_+|head,tail	phage head-tail connector protein	head,tail	A0A1B1P7M9	Bacillus_phage	56.6	2.3e-20
WP_025218461.1|333230_333569_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_025218462.1|333565_333994_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_025218463.1|333990_334488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025218464.1|334491_335550_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7S0D2	Clostridium_phage	44.2	7.1e-71
WP_025218465.1|335564_335999_+|tail	phage tail tube protein	tail	A0A0A7RVT1	Clostridium_phage	41.1	2.8e-26
WP_025218466.1|336020_336413_+	hypothetical protein	NA	A0A0A8WIB2	Clostridium_phage	34.5	9.5e-13
WP_025218467.1|336622_338749_+|tail	phage tail tape measure protein	tail	A0A2H5BLS1	Streptomyces_phage	32.0	4.8e-42
WP_025218468.1|338762_339185_+	hypothetical protein	NA	A0A0N7ACL7	Bacillus_phage	29.2	1.6e-05
WP_025218469.1|339184_340162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025218470.1|340163_340523_+	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_025218471.1|340522_340969_+	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_025218472.1|340969_342010_+|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	34.6	4.0e-50
WP_025218473.1|342006_342354_+	hypothetical protein	NA	A0A1B1INQ1	uncultured_Mediterranean_phage	35.1	6.9e-07
WP_158497860.1|342457_343183_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_025218475.1|343182_343524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025218476.1|343524_344274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025218477.1|344278_344545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158497861.1|344547_344721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025218478.1|344795_345572_+	hypothetical protein	NA	A0A0S2SXZ1	Bacillus_phage	62.3	7.7e-83
WP_025218479.1|345711_345963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025218480.1|346155_346614_+|holin	phage holin family protein	holin	D7RWK5	Brochothrix_phage	57.0	3.3e-33
WP_025218481.1|346613_347282_+	M15 family metallopeptidase	NA	A0A2D1GQ84	Lysinibacillus_phage	53.1	1.1e-58
WP_025218482.1|347404_348307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025218483.1|348325_348847_-	SHOCT domain-containing protein	NA	Q4ZA70	Staphylococcus_virus	27.6	7.9e-07
350791:350812	attR	TTTAACCCCAATTTAACCCCAT	NA	NA	NA	NA
>prophage 3
NZ_CP006837	Lysinibacillus varians strain GY32 chromosome, complete genome	4662822	1509476	1534245	4662822	holin,tail	Brevibacillus_phage(50.0%)	19	NA	NA
WP_025219028.1|1509476_1509767_-|holin	phage holin family protein	holin	A0A142F1N6	Bacillus_phage	59.8	3.0e-24
WP_144340672.1|1509784_1510171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219030.1|1510273_1510723_-	hypothetical protein	NA	A0A0K2FLF1	Brevibacillus_phage	36.1	8.9e-15
WP_025219031.1|1510745_1512662_-	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
WP_158497872.1|1512693_1514775_-	discoidin domain-containing protein	NA	G3MAA7	Bacillus_virus	46.5	2.1e-114
WP_025219033.1|1514841_1515606_-	hypothetical protein	NA	G3MAA6	Bacillus_virus	55.2	6.1e-08
WP_025219034.1|1515647_1516757_-	discoidin domain-containing protein	NA	NA	NA	NA	NA
WP_025219035.1|1516757_1517603_-	hypothetical protein	NA	G3MAA5	Bacillus_virus	55.8	8.8e-56
WP_025219036.1|1517599_1518673_-	hypothetical protein	NA	G3MAA4	Bacillus_virus	35.5	9.7e-52
WP_025219037.1|1518690_1519020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219038.1|1519045_1519642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219039.1|1519746_1520493_-	hypothetical protein	NA	A0A0K2FLS8	Brevibacillus_phage	35.2	4.1e-25
WP_025219040.1|1520555_1521719_-	hypothetical protein	NA	A0A0K2FMC4	Brevibacillus_phage	36.0	6.6e-70
WP_137036903.1|1521742_1522114_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_025219042.1|1522168_1525933_-|tail	phage tail protein	tail	A0A0K2FLF6	Brevibacillus_phage	32.4	1.1e-238
WP_025219043.1|1525956_1526598_-	hypothetical protein	NA	A0A0K2FM10	Brevibacillus_phage	35.8	1.1e-31
WP_025219044.1|1526609_1527266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219045.1|1527265_1527862_-|tail	phage tail family protein	tail	A0A0K2FMB9	Brevibacillus_phage	39.4	9.9e-38
WP_025219046.1|1527861_1534245_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0H3V0Q1	Geobacillus_virus	22.7	1.3e-18
>prophage 4
NZ_CP006837	Lysinibacillus varians strain GY32 chromosome, complete genome	4662822	2488112	2558194	4662822	holin,plate,integrase,head,tail,terminase,capsid,portal,protease	Bacillus_phage(14.0%)	92	2491075:2491090	2559271:2559286
WP_025219658.1|2488112_2488529_-|holin	phage holin family protein	holin	S6AVT9	Thermus_phage	57.7	1.8e-33
WP_158497884.1|2488727_2488889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219659.1|2488890_2489202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219660.1|2489198_2490506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219661.1|2490505_2491402_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	40.8	2.1e-52
2491075:2491090	attL	ATAGTGTTCCTTTCTT	NA	NA	NA	NA
WP_025219662.1|2491404_2492502_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	D2J072	Enterococcus_phage	29.3	1.5e-31
WP_025219663.1|2492504_2493380_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_025219664.1|2493394_2498230_-	hypothetical protein	NA	A6XMK6	Bacillus_virus	51.9	2.5e-131
WP_025219665.1|2498495_2498852_-	hypothetical protein	NA	A6XMK4	Bacillus_virus	51.7	7.2e-28
WP_038510365.1|2498873_2499452_-|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	59.6	9.6e-54
WP_025219667.1|2499514_2499832_-	hypothetical protein	NA	A0A0U4JNN6	Exiguobacterium_phage	48.1	7.9e-18
WP_025219668.1|2499828_2500188_-	hypothetical protein	NA	D2XR21	Bacillus_phage	50.0	6.0e-22
WP_025219669.1|2500168_2500555_-|head	phage head closure protein	head	A0A0U4JE41	Bacillus_phage	32.5	3.9e-11
WP_052599582.1|2500541_2500790_-	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	72.2	4.0e-25
WP_025219671.1|2500840_2501032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219672.1|2501065_2502226_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	68.5	8.4e-142
WP_025219673.1|2502245_2502950_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	F8J1B3	Lactobacillus_phage	42.1	7.6e-29
WP_025219674.1|2502939_2504091_-|portal	phage portal protein	portal	A8AT96	Listeria_phage	52.1	7.4e-106
WP_025219675.1|2504106_2505792_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	75.9	2.4e-246
WP_025219676.1|2505788_2506121_-	hypothetical protein	NA	D2XR14	Bacillus_phage	41.8	1.5e-14
WP_025219677.1|2506239_2506575_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	67.9	1.1e-38
WP_025219678.1|2506580_2506898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219679.1|2507146_2507380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219680.1|2507688_2508132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219681.1|2508547_2508949_-	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	59.2	1.9e-37
WP_025219682.1|2509015_2509360_-	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	44.2	3.0e-23
WP_025219683.1|2509413_2509629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158497885.1|2509925_2512820_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_025219685.1|2512996_2513266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219686.1|2513298_2513499_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081769955.1|2513712_2514234_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038509697.1|2514261_2515479_+|integrase	site-specific integrase	integrase	A0A1Q1PVS7	Staphylococcus_phage	35.5	5.9e-53
WP_025219689.1|2515504_2516113_-	YpjP family protein	NA	NA	NA	NA	NA
WP_025219690.1|2516698_2517136_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025219691.1|2517665_2518517_-	AraC family transcriptional regulator	NA	A0A1B0RXG1	Streptococcus_phage	40.3	1.7e-19
WP_025219692.1|2518659_2519544_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_158497886.1|2520179_2520356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219694.1|2521131_2521923_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_024364685.1|2521910_2522342_-	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_025219695.1|2522667_2523966_+	Ig domain-containing protein	NA	A0A1P8BL30	Lactococcus_phage	39.6	1.0e-07
WP_025219696.1|2524016_2524682_-	M15 family metallopeptidase	NA	A0A2D1GQ84	Lysinibacillus_phage	52.3	1.7e-54
WP_025219697.1|2524678_2525095_-|holin	phage holin family protein	holin	S6AVT9	Thermus_phage	55.9	3.7e-31
WP_081769896.1|2525171_2525447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158497887.1|2525527_2525695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219698.1|2525696_2525972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219699.1|2525989_2526886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052599485.1|2526882_2527587_-|tail	phage tail protein	tail	A0A0A7RTP0	Clostridium_phage	61.3	8.1e-47
WP_025219700.1|2527587_2528235_-|tail	phage tail protein I	tail	A0A2K9V471	Faecalibacterium_phage	31.4	4.4e-23
WP_025219701.1|2528227_2529343_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	42.0	1.7e-78
WP_025219702.1|2529329_2529647_-	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	39.2	5.5e-11
WP_052599488.1|2529651_2530308_-|tail	phage tail protein	tail	A0A067ZI88	Vibrio_phage	35.2	2.7e-12
WP_052599491.1|2530322_2530730_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_025219703.1|2530729_2531749_-	hypothetical protein	NA	A0A067ZG47	Vibrio_phage	32.8	7.4e-41
WP_025219704.1|2531745_2531961_-|tail	tail protein X	tail	A0A0C5AEF4	Bacteriophage	42.2	1.1e-07
WP_025219705.1|2531953_2534737_-|tail	phage tail tape measure protein	tail	A0A0C5AJ16	Paenibacillus_phage	52.2	8.9e-97
WP_025219706.1|2534893_2535226_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_025219707.1|2535247_2535763_-|tail	phage major tail tube protein	tail	A0A0E3Y6F4	Fusobacterium_phage	28.6	1.1e-21
WP_025219708.1|2535774_2537217_-	hypothetical protein	NA	A0A059WKP9	Vibrio_phage	46.0	8.9e-117
WP_025219709.1|2537213_2537513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219710.1|2537505_2538000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219711.1|2538004_2538553_-|tail	phage tail protein	tail	A0A067ZG41	Vibrio_phage	35.0	1.5e-19
WP_025219712.1|2538561_2538891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219713.1|2538883_2539249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219714.1|2539261_2540287_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	36.4	7.1e-52
WP_025219715.1|2540291_2540657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219716.1|2540658_2541723_-|protease	Clp protease ClpP	protease	A0A0A7RWX3	Clostridium_phage	45.1	1.4e-45
WP_025219717.1|2541712_2543284_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	56.0	3.0e-158
WP_081769956.1|2543296_2543491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219719.1|2543533_2545345_-|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	52.0	2.8e-176
WP_025219720.1|2545307_2545877_-	hypothetical protein	NA	A0A0C5AN04	Bacteriophage	31.0	1.1e-09
WP_025219721.1|2546416_2546986_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLG4	Bacillus_phage	55.6	8.5e-47
WP_025219722.1|2546982_2547426_-	hypothetical protein	NA	Q0H270	Geobacillus_phage	39.6	1.8e-23
WP_025219723.1|2547606_2548485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219724.1|2548710_2549283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219725.1|2549385_2549583_-	hypothetical protein	NA	A0A1L2JY31	Aeribacillus_phage	54.5	2.9e-10
WP_025219726.1|2549674_2549893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137036959.1|2549929_2550049_-	BH0509 family protein	NA	NA	NA	NA	NA
WP_025219727.1|2550041_2550536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052599493.1|2550532_2551810_-	replicative DNA helicase	NA	A0A0U4B0A1	Bacillus_phage	37.9	1.3e-71
WP_025219729.1|2551809_2552616_-	conserved phage C-terminal domain-containing protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	49.4	3.9e-45
WP_025219730.1|2552612_2553263_-	ORF6N domain-containing protein	NA	A0A0K2CNP0	Brevibacillus_phage	34.9	9.2e-29
WP_025219731.1|2553366_2553576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219732.1|2553693_2554059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219733.1|2554078_2554348_-	helix-turn-helix transcriptional regulator	NA	S5MNZ7	Brevibacillus_phage	57.0	1.3e-16
WP_025219734.1|2554423_2554732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137036958.1|2554753_2555032_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052599496.1|2555000_2555225_-	helix-turn-helix transcriptional regulator	NA	S4SUN2	Staphylococcus_phage	48.3	3.7e-06
WP_025219737.1|2555430_2555670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025219738.1|2555982_2556174_-	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	61.0	1.6e-13
WP_167331271.1|2556324_2556705_+	helix-turn-helix domain-containing protein	NA	Q0H244	Geobacillus_phage	62.2	4.7e-17
WP_025219740.1|2556851_2557574_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_025219741.1|2557834_2558194_+	helix-turn-helix transcriptional regulator	NA	A0A290GJU0	Caldibacillus_phage	37.5	8.1e-11
2559271:2559286	attR	AAGAAAGGAACACTAT	NA	NA	NA	NA
>prophage 5
NZ_CP006837	Lysinibacillus varians strain GY32 chromosome, complete genome	4662822	3183224	3244682	4662822	holin,tRNA,head,tail,terminase,capsid,portal,protease	Bacillus_phage(23.26%)	91	NA	NA
WP_024363169.1|3183224_3184370_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.8	1.0e-86
WP_025220112.1|3184488_3185532_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_024363171.1|3185550_3186555_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	23.9	2.0e-06
WP_025220113.1|3186573_3187194_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_052599508.1|3187307_3188141_-	phosphotransferase	NA	NA	NA	NA	NA
WP_174412977.1|3188175_3189219_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024363175.1|3189332_3189866_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_024363176.1|3190014_3190413_-	thiol-disulfide oxidoreductase DCC family protein	NA	NA	NA	NA	NA
WP_025220115.1|3190435_3191317_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_024363178.1|3191658_3192114_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_025220116.1|3192138_3193428_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_025220117.1|3193433_3193961_-	Spo0B domain-containing protein	NA	NA	NA	NA	NA
WP_024363181.1|3194098_3194398_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_024363182.1|3194394_3194751_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_010860053.1|3194765_3195074_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_025220118.1|3195209_3195821_-	stage IV sporulation protein FB	NA	NA	NA	NA	NA
WP_025220119.1|3195810_3196365_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_024363185.1|3196492_3197290_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_025220120.1|3197291_3197960_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_024363187.1|3197989_3198514_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_024363188.1|3198513_3199425_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_024363189.1|3199438_3200458_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_158497892.1|3201503_3201671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220121.1|3201836_3202733_-	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	26.8	1.8e-11
WP_158497893.1|3202755_3202932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220122.1|3203123_3203345_+	helix-turn-helix transcriptional regulator	NA	L0L8F4	Bacillus_phage	47.7	2.2e-06
WP_025220123.1|3203421_3204294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174412978.1|3204407_3204599_+	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	67.7	2.1e-18
WP_025220125.1|3204625_3205039_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	61.8	7.1e-43
WP_025220126.1|3205060_3205420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052599509.1|3205412_3205637_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_158497894.1|3205804_3205954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024364127.1|3206210_3206450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025220127.1|3206577_3207246_-	M15 family metallopeptidase	NA	A0A2D1GQ84	Lysinibacillus_phage	53.1	2.5e-58
WP_025220128.1|3207242_3207659_-|holin	phage holin family protein	holin	S6AVT9	Thermus_phage	56.9	2.3e-33
WP_158497895.1|3207857_3208025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220129.1|3208074_3208446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220130.1|3208451_3209441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220131.1|3209440_3210340_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	50.8	4.2e-48
WP_025220132.1|3210342_3211440_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	D2J072	Enterococcus_phage	29.3	2.6e-31
WP_025220133.1|3211442_3212321_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_025220134.1|3212336_3217334_-|tail	phage tail tape measure protein	tail	A0A1Q1PW35	Staphylococcus_phage	45.6	2.4e-76
WP_025220135.1|3217529_3217841_-	hypothetical protein	NA	A0A288WGA9	Bacillus_phage	40.4	5.0e-09
WP_025220136.1|3217913_3218498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052599513.1|3218518_3218863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220138.1|3218859_3219264_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_025220139.1|3219264_3219597_-|head	phage head closure protein	head	A0A088F713	Idiomarinaceae_phage	31.1	3.3e-06
WP_025220140.1|3219574_3219907_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0K2CZI4	Paenibacillus_phage	38.8	5.0e-07
WP_025220141.1|3219906_3220143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220142.1|3220188_3221331_-|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	63.3	8.6e-131
WP_025220143.1|3221345_3222083_-|protease	Clp protease ClpP	protease	A0A0U3U021	Bacillus_phage	47.2	5.1e-60
WP_052599607.1|3222069_3223275_-|portal	phage portal protein	portal	A0A0U3SQF0	Bacillus_phage	63.6	9.6e-149
WP_025220145.1|3223327_3225031_-|terminase	terminase large subunit	terminase	Q2LII3	Bacillus_virus	64.2	1.8e-209
WP_025220146.1|3225027_3225546_-|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	60.1	9.2e-48
WP_025220147.1|3225671_3226043_-	HNH endonuclease	NA	A0A1U7Q1S7	Geobacillus_virus	51.2	1.5e-31
WP_025220148.1|3226032_3226350_-	hypothetical protein	NA	A0A0K2CZP5	Paenibacillus_phage	41.1	1.4e-11
WP_025220149.1|3226353_3226803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220150.1|3226807_3227107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220151.1|3227218_3227857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220152.1|3228180_3228567_-	hypothetical protein	NA	D2XR52	Bacillus_phage	35.0	5.3e-08
WP_038509846.1|3228603_3229005_-	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	56.1	1.3e-33
WP_167331269.1|3229035_3229209_-	hypothetical protein	NA	A0A2I6QR06	Streptococcus_phage	54.7	7.3e-10
WP_025220154.1|3229234_3229690_-	methyltransferase domain-containing protein	NA	A0A059T693	Listeria_phage	69.1	1.4e-63
WP_025220155.1|3229704_3230232_-	hypothetical protein	NA	A0A1Q1PVZ6	Staphylococcus_phage	35.0	1.9e-08
WP_025220156.1|3230228_3230585_-	hypothetical protein	NA	A0A2P1CA53	Pseudomonas_phage	42.9	7.0e-07
WP_025220157.1|3230585_3230981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220158.1|3231062_3231272_-	hypothetical protein	NA	A0A2D1GQB9	Lysinibacillus_phage	54.7	3.8e-13
WP_025220159.1|3231344_3231752_-	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	57.8	9.1e-27
WP_025220160.1|3231768_3232194_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	54.5	8.9e-33
WP_025220161.1|3232206_3232740_-	HNH endonuclease	NA	A0A218KBW3	Bacillus_phage	54.7	3.5e-50
WP_025220162.1|3232765_3233275_-	single-stranded DNA-binding protein	NA	A0A290GHL8	Caldibacillus_phage	51.2	8.4e-38
WP_025220163.1|3233281_3233716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220164.1|3233702_3234938_-	DNA helicase	NA	A0A0U4B0A1	Bacillus_phage	39.0	5.4e-70
WP_025220165.1|3234937_3235783_-	phage replisome organizer N-terminal domain-containing protein	NA	V9QKF6	Oenococcus_phage	37.0	2.4e-37
WP_025220166.1|3235794_3236424_-	ERF family protein	NA	A0A2D1GQF7	Lysinibacillus_phage	51.9	6.5e-48
WP_025220167.1|3236438_3236939_-	siphovirus Gp157 family protein	NA	B6CXH7	Clostridium_phage	34.9	3.2e-13
WP_025220168.1|3236935_3237652_-	hypothetical protein	NA	A0A2H4J2J8	uncultured_Caudovirales_phage	45.2	1.9e-11
WP_025220169.1|3237648_3237840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220170.1|3237848_3238121_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	55.7	2.1e-11
WP_025220171.1|3238117_3238477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158497896.1|3238460_3238613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220172.1|3238596_3239016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220173.1|3239044_3239875_-	hypothetical protein	NA	A0A2H4J989	uncultured_Caudovirales_phage	40.9	8.4e-35
WP_158497897.1|3239921_3240083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220174.1|3240079_3240802_-	ORF6C domain-containing protein	NA	S5MP04	Brevibacillus_phage	40.9	3.1e-41
WP_025220175.1|3240862_3241372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158497898.1|3241364_3241538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220176.1|3241664_3241883_-	helix-turn-helix transcriptional regulator	NA	A6M975	Geobacillus_virus	54.4	3.0e-08
WP_025220177.1|3242103_3242742_+	XRE family transcriptional regulator	NA	A0A2I7SCV6	Paenibacillus_phage	41.7	3.6e-38
WP_025220178.1|3242821_3243154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025220179.1|3243251_3244682_+	recombinase family protein	NA	A0A2H4JFH9	uncultured_Caudovirales_phage	53.6	8.8e-133
>prophage 6
NZ_CP006837	Lysinibacillus varians strain GY32 chromosome, complete genome	4662822	3326101	3336450	4662822	transposase	Bacillus_phage(42.86%)	10	NA	NA
WP_025220225.1|3326101_3327064_+	S8 family peptidase	NA	A0A127AWU5	Bacillus_phage	50.3	4.6e-77
WP_025220226.1|3327063_3327873_+	endonuclease	NA	A0A2P0VMP9	Tetraselmis_virus	32.1	5.7e-12
WP_025220227.1|3328305_3328803_-	ATP-binding protein	NA	A0A1Q1PVZ2	Staphylococcus_phage	63.6	9.4e-58
WP_025220228.1|3329202_3329532_-	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_025220229.1|3329854_3330433_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025220230.1|3330722_3331283_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	36.2	2.3e-12
WP_038509858.1|3331300_3331699_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	56.6	1.1e-29
WP_158497902.1|3331685_3332111_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.8	2.0e-08
WP_025220231.1|3332352_3332679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220232.1|3333123_3336450_-	AAA family ATPase	NA	A0A076FFX0	Aureococcus_anophage	22.7	1.2e-10
>prophage 7
NZ_CP006837	Lysinibacillus varians strain GY32 chromosome, complete genome	4662822	3915687	3964442	4662822	holin,tRNA,integrase,head,tail,terminase,capsid,portal,protease	Bacillus_phage(35.29%)	67	3929368:3929386	3964589:3964607
WP_025220535.1|3915687_3916161_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_025220536.1|3916175_3917306_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_025220537.1|3917365_3918055_+|tRNA	tRNA synthetase subunit beta	tRNA	NA	NA	NA	NA
WP_024362339.1|3918069_3918579_+	hypothetical protein	NA	L0L915	Bacillus_phage	34.3	1.8e-16
WP_025220538.1|3918859_3920434_+	catalase	NA	A0A2K9L572	Tupanvirus	43.0	1.5e-101
WP_024362341.1|3920569_3921472_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_024362342.1|3921591_3922470_+	DMT family transporter	NA	NA	NA	NA	NA
WP_024362343.1|3922511_3923225_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_025220539.1|3923421_3924165_+	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_025220540.1|3924201_3925293_-	S-layer homology domain-containing protein	NA	G9J240	Bacillus_phage	28.3	6.3e-14
WP_024362347.1|3927574_3928870_+	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	37.2	1.0e-34
3929368:3929386	attL	TGATACCGGTGGTCGGGGT	NA	NA	NA	NA
WP_158497906.1|3929620_3929788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025220541.1|3929867_3930431_+	DUF5067 domain-containing protein	NA	NA	NA	NA	NA
WP_025220542.1|3930484_3931225_-	N-acetylmuramoyl-L-alanine amidase	NA	D6QWL8	uncultured_phage	37.2	3.2e-30
WP_025220543.1|3931224_3931485_-|holin	phage holin	holin	A0A1Q1PW49	Staphylococcus_phage	54.9	1.2e-19
WP_025220544.1|3931474_3931744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220545.1|3931801_3931999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158497907.1|3932037_3932199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220546.1|3932200_3932545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220547.1|3932547_3933882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220548.1|3933881_3934778_-	hypothetical protein	NA	E2ELJ8	Clostridium_phage	51.9	2.2e-49
WP_025220549.1|3934780_3935878_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	D2J072	Enterococcus_phage	27.3	3.1e-29
WP_025220550.1|3935880_3936756_-|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_025220551.1|3936770_3941270_-	hypothetical protein	NA	A6XMK6	Bacillus_virus	53.4	6.6e-150
WP_025220552.1|3941539_3941893_-	hypothetical protein	NA	A0A2H4J224	uncultured_Caudovirales_phage	46.2	2.6e-22
WP_038510611.1|3941907_3942516_-|tail	phage tail protein	tail	D2XR23	Bacillus_phage	59.2	1.0e-58
WP_025220554.1|3942617_3942932_-	hypothetical protein	NA	A0A2H4J234	uncultured_Caudovirales_phage	50.5	2.1e-18
WP_052599535.1|3942928_3943333_-	hypothetical protein	NA	D2XR21	Bacillus_phage	48.3	4.1e-19
WP_025220556.1|3943283_3943628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220557.1|3943614_3943911_-	hypothetical protein	NA	A0A0S2SXS0	Bacillus_phage	49.5	1.9e-18
WP_025220558.1|3943910_3944096_-	hypothetical protein	NA	A0A0S2SXV2	Bacillus_phage	61.4	7.6e-13
WP_025220559.1|3944115_3945402_-|capsid	phage major capsid protein	capsid	Q0H261	Geobacillus_phage	80.4	3.9e-140
WP_025220560.1|3945398_3945980_-|head,protease	HK97 family phage prohead protease	head,protease	Q0H262	Geobacillus_phage	69.4	2.6e-67
WP_025220561.1|3945972_3947169_-|portal	phage portal protein	portal	Q0H263	Geobacillus_phage	65.1	2.7e-151
WP_158497908.1|3947169_3947340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220562.1|3947347_3949102_-|terminase	terminase large subunit	terminase	C5J959	Streptococcus_phage	59.5	1.2e-200
WP_052599622.1|3949107_3949437_-|terminase	P27 family phage terminase small subunit	terminase	Q0H265	Geobacillus_phage	71.4	2.3e-28
WP_025220564.1|3949586_3949880_-	HNH endonuclease	NA	A0A0S2SXR6	Bacillus_phage	65.9	3.4e-31
WP_025220565.1|3949879_3950536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220566.1|3950553_3950778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144340676.1|3950794_3951004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220568.1|3951018_3951375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220569.1|3951455_3951674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220570.1|3951942_3952512_-	hypothetical protein	NA	A0A1S7FZ07	Listeria_phage	30.7	8.9e-12
WP_025220571.1|3952548_3952737_-	hypothetical protein	NA	A0A218KC21	Bacillus_phage	69.0	1.4e-17
WP_137036947.1|3953049_3953634_-	hypothetical protein	NA	A0A0K2CNV8	Brevibacillus_phage	53.3	1.7e-18
WP_025220573.1|3953689_3953971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220574.1|3954060_3954381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052599537.1|3954419_3954890_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025220576.1|3954926_3955124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220577.1|3955162_3955702_-	hypothetical protein	NA	A0A218KCM5	Bacillus_phage	39.7	5.7e-08
WP_025220578.1|3955713_3955908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137036945.1|3955947_3956238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220580.1|3956244_3956559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220581.1|3956558_3956780_-	hypothetical protein	NA	A0A2D1GQB9	Lysinibacillus_phage	49.2	1.2e-09
WP_025220582.1|3956776_3957319_-	Holliday junction resolvase RecU	NA	S5MCC4	Brevibacillus_phage	37.4	1.9e-19
WP_025220583.1|3957350_3957608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220584.1|3957635_3958607_-	DUF3850 domain-containing protein	NA	H7BUL7	unidentified_phage	33.5	1.6e-21
WP_025220585.1|3958642_3959404_-	ParA family protein	NA	H7BUL8	unidentified_phage	38.0	2.6e-43
WP_025220586.1|3959381_3960302_-	hypothetical protein	NA	H7BW41	unidentified_phage	32.9	1.5e-21
WP_167331270.1|3960571_3960727_-	hypothetical protein	NA	Q2I8D2	Bacillus_phage	42.0	2.6e-06
WP_025220587.1|3960859_3961213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220588.1|3961209_3961500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220589.1|3961799_3962126_-	DUF771 domain-containing protein	NA	U3PBP3	Staphylococcus_phage	44.3	3.0e-12
WP_158497909.1|3962146_3962320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025220590.1|3962451_3962868_+	helix-turn-helix transcriptional regulator	NA	A0A0A8WEL4	Clostridium_phage	44.0	1.0e-09
WP_025220591.1|3963338_3964442_+|integrase	site-specific integrase	integrase	Q5YAA6	Bacillus_phage	57.7	5.8e-116
3964589:3964607	attR	TGATACCGGTGGTCGGGGT	NA	NA	NA	NA
>prophage 8
NZ_CP006837	Lysinibacillus varians strain GY32 chromosome, complete genome	4662822	4140747	4149290	4662822		Bacillus_virus(42.86%)	9	NA	NA
WP_024363980.1|4140747_4141572_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	5.9e-73
WP_024363979.1|4141587_4143057_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	46.1	7.2e-114
WP_024363978.1|4143368_4143710_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_024363977.1|4143723_4145019_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	40.3	2.8e-69
WP_025220671.1|4145112_4145613_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	48.7	2.4e-21
WP_025220672.1|4145732_4146464_+	phosphate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	6.3e-18
WP_025220673.1|4146460_4147213_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_024363973.1|4147288_4148263_+	proline dehydrogenase family protein	NA	A0A2H4PQT6	Staphylococcus_phage	51.5	6.9e-89
WP_024363972.1|4148573_4149290_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	77.0	9.1e-46
