The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007394	Escherichia coli strain ST2747 chromosome, complete genome	5090442	1236666	1334814	5090442	capsid,transposase,protease,tail,lysis,portal,head,tRNA,integrase,terminase	Enterobacteria_phage(47.54%)	97	1246818:1246864	1297857:1297903
WP_000912355.1|1236666_1238052_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	5.1e-45
WP_001143546.1|1238087_1238609_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190286.1|1238716_1238929_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|1238930_1239797_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1240267_1240810_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1241029_1241722_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_025210268.1|1241752_1244362_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691065.1|1244374_1245382_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001309313.1|1245392_1245908_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805414.1|1245910_1246543_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1246818:1246864	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|1246877_1248041_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000446905.1|1247896_1248268_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|1248239_1248518_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|1248565_1248784_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_077248689.1|1248882_1249164_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	2.1e-46
WP_000129285.1|1249174_1249732_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682294.1|1249724_1249886_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000186833.1|1249882_1250563_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|1250559_1251345_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|1251350_1251647_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|1251722_1251929_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|1252524_1253280_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|1253318_1253549_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|1253617_1254157_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001551200.1|1254243_1255173_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_000788815.1|1255169_1255871_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	2.4e-128
WP_025210269.1|1255867_1256170_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	94.6	3.3e-42
WP_001070442.1|1256237_1256570_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001299444.1|1256617_1256767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021537018.1|1256824_1258351_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	1.0e-30
WP_001445652.1|1258815_1259367_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1259376_1260174_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1260290_1260392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054342.1|1260388_1260844_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_000224916.1|1260843_1261014_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1261006_1261297_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099716.1|1261293_1261656_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_001307651.1|1261652_1261793_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	8.5e-09
WP_001204783.1|1261878_1262262_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	8.8e-56
WP_025210270.1|1262451_1263534_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	6.0e-166
WP_000839596.1|1264107_1264323_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135256.1|1264322_1264820_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
WP_001228702.1|1265036_1265243_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|1265271_1265424_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079510.1|1265775_1266186_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	9.8e-53
WP_032231044.1|1266243_1266477_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|1266865_1267411_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|1267385_1269311_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_025210271.1|1269307_1269514_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001358226.1|1269510_1271112_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	8.8e-312
WP_000123248.1|1271092_1272412_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001358225.1|1272421_1272754_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063250.1|1272809_1273835_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_000158878.1|1273876_1274272_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	7.4e-58
WP_000785282.1|1274283_1274637_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|1274648_1275227_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|1275223_1275619_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_025210272.1|1275626_1276367_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	3.4e-128
WP_000479193.1|1276382_1276805_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|1276786_1277221_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_025210273.1|1277213_1279775_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.8	0.0e+00
WP_000847345.1|1279771_1280101_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152502.1|1280100_1280799_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_038428179.1|1280804_1281548_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.9e-147
WP_000090891.1|1281484_1282117_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_001228252.1|1285726_1286326_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_025210275.1|1291179_1293537_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	1.7e-117
WP_001544317.1|1293536_1293806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025210276.1|1293818_1294502_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	60.0	1.1e-56
WP_000355609.1|1294512_1294806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000386784.1|1295481_1296231_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_025210277.1|1296479_1297433_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|1297946_1298708_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1297857:1297903	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224574.1|1298890_1299781_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_025210278.1|1299781_1302754_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_025210279.1|1302740_1304978_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_021523035.1|1305175_1306312_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000769435.1|1306692_1307250_-	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_001328511.1|1307261_1307960_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	40.4	3.1e-14
WP_000260286.1|1308847_1309063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522501.1|1309674_1310106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000154314.1|1310597_1311131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001160804.1|1315976_1316438_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103213.1|1316465_1318367_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	7.1e-29
WP_025210281.1|1319103_1320552_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.5	5.1e-11
WP_000770953.1|1320541_1321225_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_025210282.1|1321381_1322764_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709869.1|1322787_1323120_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717111.1|1323135_1324359_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_025210283.1|1324370_1327514_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	3.7e-59
WP_000786320.1|1327615_1328992_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153132.1|1329059_1330307_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_025234898.1|1330414_1331068_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360954.1|1331161_1331530_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682518.1|1331594_1331843_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_025210284.1|1331908_1333027_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_085948682.1|1333445_1334814_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 2
NZ_CP007394	Escherichia coli strain ST2747 chromosome, complete genome	5090442	2092586	2148402	5090442	transposase,lysis,head,tRNA,integrase,terminase	Escherichia_phage(57.78%)	57	2083481:2083496	2129237:2129252
2083481:2083496	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001361837.1|2092586_2093819_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_001599773.1|2095532_2096906_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2097034_2097970_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_001516465.1|2098021_2099257_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	8.4e-241
WP_000079604.1|2099258_2099474_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001605349.1|2099573_2099762_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	1.2e-26
WP_032159264.1|2099754_2099949_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	1.3e-31
WP_001004422.1|2100012_2101065_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	63.6	8.5e-117
WP_001605350.1|2101076_2104148_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	84.0	0.0e+00
WP_001344816.1|2104249_2104525_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|2104599_2104770_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2104769_2104991_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2105432_2105921_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2105917_2106073_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|2106083_2106263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551043.1|2106526_2107003_-	DNA-binding transcriptional repressor RacR	NA	NA	NA	NA	NA
WP_001551044.1|2107126_2107423_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	43.5	1.6e-09
WP_025210427.1|2107445_2107868_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.4e-67
WP_001396581.1|2107945_2108734_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788969.1|2108740_2109487_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	4.9e-111
WP_001605353.1|2109509_2110271_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	5.5e-118
WP_001605354.1|2110286_2110709_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	6.7e-65
WP_001100703.1|2111804_2112956_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|2112923_2113913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|2113912_2115304_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|2115803_2116403_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_001605357.1|2116402_2116693_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	8.2e-46
WP_000640161.1|2116689_2117232_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|2118276_2118705_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2118876_2119251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|2119502_2119718_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135310.1|2119717_2120215_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228688.1|2120431_2120617_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|2120813_2122271_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_025210428.1|2122408_2123200_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	39.8	8.2e-48
WP_001204037.1|2123192_2124125_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000126788.1|2124102_2124312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|2124315_2125410_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625348.1|2125390_2126692_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763704.1|2126694_2128101_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001351715.1|2128084_2129197_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000770042.1|2129301_2130066_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
2129237:2129252	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_000918487.1|2130164_2131304_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000634214.1|2131526_2131922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|2131921_2132305_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|2132305_2132686_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|2132682_2133075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025234901.1|2133101_2134064_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|2134214_2134574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051539322.1|2139816_2140089_+	hypothetical protein	NA	A0A077SK35	Escherichia_phage	98.7	5.5e-36
WP_025210440.1|2140101_2143089_+	hypothetical protein	NA	A0A077SK08	Escherichia_phage	97.3	0.0e+00
WP_001165936.1|2143078_2143387_+	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_025210442.1|2143764_2144442_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	98.2	4.9e-126
WP_025210444.1|2144639_2145128_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	3.2e-87
WP_025210445.1|2145297_2145855_+	lysozyme	NA	Q71TF3	Escherichia_phage	99.5	2.7e-106
WP_000132937.1|2146139_2147159_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001312284.1|2147271_2148402_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	84.5	9.2e-186
>prophage 3
NZ_CP007394	Escherichia coli strain ST2747 chromosome, complete genome	5090442	2162744	2175866	5090442		Escherichia_phage(100.0%)	10	NA	NA
WP_000896806.1|2162744_2163473_+	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_000660977.1|2164411_2167699_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	98.7	0.0e+00
WP_025210464.1|2167695_2168601_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	97.0	6.5e-158
WP_001177864.1|2168593_2168878_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_025210465.1|2169339_2170128_+	hypothetical protein	NA	Q71TL4	Escherichia_phage	99.2	4.0e-119
WP_025210466.1|2170167_2170590_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	96.4	2.3e-57
WP_001281116.1|2170767_2171160_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_001154687.1|2172673_2173483_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
WP_001285362.1|2173651_2174848_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|2174864_2175866_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
>prophage 4
NZ_CP007394	Escherichia coli strain ST2747 chromosome, complete genome	5090442	2181430	2196135	5090442	tail	Enterobacteria_phage(42.86%)	16	NA	NA
WP_000024051.1|2181430_2181769_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001605366.1|2181768_2182467_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.5e-125
WP_001349921.1|2182472_2183216_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
WP_000090891.1|2183152_2183785_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_025234914.1|2183845_2187325_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_001228228.1|2187392_2187992_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.0	1.2e-102
WP_000741766.1|2188056_2190432_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_000654143.1|2190431_2190713_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_025210478.1|2190722_2191763_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.0	5.4e-124
WP_000355601.1|2191805_2192099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025210479.1|2192326_2192917_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	3.6e-24
WP_000836768.1|2193233_2193467_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2193535_2193649_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001157926.1|2193988_2194162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295593.1|2194426_2194861_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837902.1|2195001_2196135_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
>prophage 5
NZ_CP007394	Escherichia coli strain ST2747 chromosome, complete genome	5090442	2855487	2867382	5090442		Enterobacteria_phage(30.0%)	11	NA	NA
WP_025210609.1|2855487_2856234_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	39.3	2.7e-08
WP_025210610.1|2856233_2857640_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	2.0e-49
WP_021562286.1|2857645_2858107_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_025210611.1|2858109_2859075_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	50.5	4.2e-86
WP_158413305.1|2859078_2861022_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	66.2	1.3e-99
WP_025210617.1|2861076_2861622_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	8.4e-52
WP_025210618.1|2861626_2862505_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	1.5e-106
WP_001023641.1|2862562_2863462_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_025210619.1|2863461_2864547_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.0e-101
WP_000183060.1|2864919_2865813_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_025210620.1|2865987_2867382_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	3.7e-19
>prophage 6
NZ_CP007394	Escherichia coli strain ST2747 chromosome, complete genome	5090442	2917020	2957128	5090442	capsid,portal,tail,lysis,plate,head,tRNA,holin,integrase,terminase	Escherichia_phage(61.9%)	50	2921309:2921336	2955313:2955340
WP_000675144.1|2917020_2918424_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137877.1|2918420_2919143_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2919322_2919655_+	YegP family protein	NA	NA	NA	NA	NA
WP_025210639.1|2919802_2921164_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.2e-216
2921309:2921336	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2921436_2921655_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882931.1|2921736_2922900_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	3.1e-205
WP_025210640.1|2922899_2923379_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	3.3e-84
WP_025210641.1|2923393_2925841_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	95.2	0.0e+00
WP_000785970.1|2925833_2925953_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2925985_2926261_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2926317_2926836_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|2926848_2928039_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_025210642.1|2928098_2928692_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	8.7e-103
WP_025210643.1|2928890_2929208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025234921.1|2929351_2929720_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	99.2	1.1e-63
WP_001008234.1|2929740_2930184_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_025210644.1|2930155_2930758_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	3.5e-99
WP_025234922.1|2930757_2932083_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.0	3.0e-183
WP_016236406.1|2932079_2932691_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_025210646.1|2932683_2933592_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_025210647.1|2933596_2933944_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	5.0e-58
WP_025210648.1|2933940_2934576_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	1.4e-111
WP_025210649.1|2934676_2936029_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_025210650.1|2936039_2936579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210651.1|2936594_2937056_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.3	1.3e-45
WP_025210652.1|2937048_2937516_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	2.2e-80
WP_001440152.1|2937478_2937652_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_023278421.1|2937623_2938049_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.6e-66
WP_025210653.1|2938036_2938462_-	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	94.3	4.7e-58
WP_001144101.1|2938476_2938974_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2938973_2939255_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|2939258_2939462_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2939461_2939971_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_025210654.1|2940070_2940814_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	98.4	7.3e-123
WP_001248574.1|2940817_2941891_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	100.0	1.8e-202
WP_025210655.1|2942737_2944510_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_025210656.1|2944509_2945544_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	98.8	4.6e-200
WP_106121066.1|2945855_2947748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000548273.1|2947878_2948343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174129.1|2948356_2949265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210657.1|2949387_2951661_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.4	0.0e+00
WP_021540634.1|2951650_2951926_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	8.6e-45
WP_001113264.1|2951922_2952147_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277954.1|2952146_2952449_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	98.0	6.5e-46
WP_000217670.1|2952736_2953237_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_038428309.1|2953414_2953690_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	98.9	2.8e-48
WP_001306384.1|2953804_2954104_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_025210659.1|2954219_2955233_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	3.1e-193
WP_001303579.1|2955496_2955814_-	hypothetical protein	NA	NA	NA	NA	NA
2955313:2955340	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_025210660.1|2956228_2957128_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	9.8e-13
>prophage 7
NZ_CP007394	Escherichia coli strain ST2747 chromosome, complete genome	5090442	2994352	3003795	5090442		Enterobacteria_phage(85.71%)	10	NA	NA
WP_025210665.1|2994352_2995489_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	5.5e-162
WP_025210666.1|2995485_2997486_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|2997610_2998072_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2998113_2998584_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001308766.1|2998630_2999350_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|2999346_3001032_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|3001253_3001985_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|3002044_3002152_+	protein YohO	NA	NA	NA	NA	NA
WP_000783144.1|3002132_3002864_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001600159.1|3002868_3003795_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
>prophage 8
NZ_CP007394	Escherichia coli strain ST2747 chromosome, complete genome	5090442	3541435	3556562	5090442	integrase	Enterobacteria_phage(76.92%)	16	3537192:3537205	3544540:3544553
3537192:3537205	attL	CATGATAATTTCTT	NA	NA	NA	NA
WP_000162574.1|3541435_3541918_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000124726.1|3542679_3543888_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	6.6e-105
WP_001183326.1|3543891_3545850_+	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	31.1	8.8e-67
3544540:3544553	attR	CATGATAATTTCTT	NA	NA	NA	NA
WP_025210772.1|3546067_3546640_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_000638629.1|3546713_3547214_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283029.1|3547210_3547945_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
WP_001149160.1|3548496_3548763_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_038429560.1|3548759_3549023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038429561.1|3548968_3549313_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.1	2.3e-39
WP_001244665.1|3549305_3549593_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_025210773.1|3549585_3550041_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	1.0e-63
WP_001149160.1|3552214_3552481_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001365039.1|3552834_3553032_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	100.0	4.0e-28
WP_025263442.1|3553356_3553758_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	95.8	4.0e-51
WP_000856729.1|3553893_3554214_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_025210774.1|3554228_3556562_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
>prophage 9
NZ_CP007394	Escherichia coli strain ST2747 chromosome, complete genome	5090442	4675454	4684911	5090442	integrase	Enterobacteria_phage(87.5%)	10	4670670:4670683	4684841:4684854
4670670:4670683	attL	CCAACCTGACGCTG	NA	NA	NA	NA
WP_001218969.1|4675454_4676627_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.2	3.6e-209
WP_000022311.1|4676679_4678365_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	54.2	5.1e-180
WP_000446147.1|4678652_4679225_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_000638628.1|4679298_4679799_-	transactivation protein	NA	NA	NA	NA	NA
WP_025210993.1|4679795_4680530_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	2.0e-128
WP_001149160.1|4681082_4681349_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_025210994.1|4681345_4681945_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.0	2.5e-49
WP_001244665.1|4681937_4682225_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_162472404.1|4683754_4684033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077768635.1|4684041_4684911_+	poxvirus D5 -like family protein	NA	Q7M2A8	Enterobacteria_phage	98.2	2.6e-156
4684841:4684854	attR	CCAACCTGACGCTG	NA	NA	NA	NA
>prophage 10
NZ_CP007394	Escherichia coli strain ST2747 chromosome, complete genome	5090442	4911877	4919662	5090442	integrase	Morganella_phage(28.57%)	11	4908907:4908920	4927806:4927819
4908907:4908920	attL	TGCCCTGAAGGATG	NA	NA	NA	NA
WP_000086148.1|4911877_4912561_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.4	2.0e-26
WP_014640311.1|4912636_4912948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077768653.1|4912944_4913847_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618111.1|4914264_4914513_+	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	38.8	1.7e-12
WP_025263465.1|4914509_4914947_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	5.4e-25
WP_025263466.1|4914946_4916218_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	2.4e-142
WP_000340829.1|4916222_4916615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103690.1|4916619_4917591_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000633913.1|4917819_4918464_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|4918457_4918733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016494.1|4918870_4919662_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
4927806:4927819	attR	TGCCCTGAAGGATG	NA	NA	NA	NA
