The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	0	9898	5054509		uncultured_virus(100.0%)	9	NA	NA
WP_144318947.1|1042_1579_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_025210063.1|1560_2145_-	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_001295263.1|2214_2484_+	YihD family protein	NA	NA	NA	NA	NA
WP_001065519.1|2560_3547_+	stress response kinase SrkA	NA	NA	NA	NA	NA
WP_000725337.1|3563_4190_+	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_025210064.1|4344_5775_+	YdgA family protein	NA	NA	NA	NA	NA
WP_001550343.1|5815_6748_-	acyltransferase	NA	NA	NA	NA	NA
WP_000115996.1|6867_7110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000250006.1|7111_9898_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 2
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	13976	16447	5054509		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|13976_15386_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|15397_16447_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 3
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	33442	36222	5054509		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718901.1|33442_34339_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_000621642.1|34506_35403_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|35436_36222_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 4
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	45038	48089	5054509		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|45038_48089_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 5
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	64323	70619	5054509	transposase	Bacillus_phage(50.0%)	6	NA	NA
WP_001297064.1|64323_64944_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|65203_66187_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_025210077.1|66335_67010_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_110093301.1|67092_68440_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_000580417.1|68550_69924_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|69920_70619_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 6
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	82193	86696	5054509		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|82193_83039_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|83463_83709_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|83793_84279_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|84371_85298_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_025210079.1|85364_86696_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 7
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	92333	96551	5054509		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_025234895.1|92333_96551_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.0	6.4e-22
>prophage 8
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	108150	109704	5054509		Pandoravirus(100.0%)	1	NA	NA
WP_025210085.1|108150_109704_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	24.5	6.0e-10
>prophage 9
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	116572	123819	5054509		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424852.1|116572_117235_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001185146.1|117246_119748_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001590980.1|120056_121136_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_025210087.1|121150_121471_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_001590981.1|121521_123819_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 10
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	140915	142760	5054509		Acinetobacter_phage(100.0%)	1	NA	NA
WP_025210091.1|140915_142760_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 11
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	151101	154154	5054509		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023085.1|151101_152052_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	1.1e-27
WP_000031784.1|152969_154154_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 12
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	158270	166599	5054509		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|158270_162299_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|162375_166599_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 13
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	174896	176660	5054509		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|174896_175568_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000941119.1|175610_176201_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|176387_176660_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 14
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	182049	183639	5054509		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187540.1|182049_183639_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 15
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	199394	203078	5054509		Dickeya_phage(100.0%)	1	NA	NA
WP_024230067.1|199394_203078_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 16
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	229070	230186	5054509		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|229070_230186_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 17
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	239309	239918	5054509		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|239309_239918_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 18
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	246551	249099	5054509		Escherichia_phage(50.0%)	2	NA	NA
WP_000918364.1|246551_247967_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	1.1e-199
WP_001147328.1|248019_249099_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 19
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	253305	256919	5054509		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|253305_256128_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|256382_256919_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 20
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	260735	262085	5054509		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|260735_262085_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 21
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	267695	269654	5054509		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078201.1|267695_269654_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.7	1.1e-90
>prophage 22
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	278938	281086	5054509		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|278938_281086_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 23
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	286331	292700	5054509		Tetraselmis_virus(50.0%)	5	NA	NA
WP_025210114.1|286331_288317_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	1.9e-149
WP_025210115.1|288589_289519_-	allose kinase	NA	NA	NA	NA	NA
WP_001389715.1|289502_290198_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507104.1|290208_291189_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_025210116.1|291167_292700_-	D-allose ABC transporter ATP-binding protein AlsA	NA	A0A2H4PQG7	Staphylococcus_phage	31.6	6.3e-20
>prophage 24
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	298802	300421	5054509		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_001564234.1|298802_299483_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	7.1e-08
WP_001075536.1|299662_300421_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	7.9e-16
>prophage 25
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	305980	306769	5054509		Pithovirus(100.0%)	1	NA	NA
WP_001193403.1|305980_306769_-	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.2	3.2e-12
>prophage 26
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	311608	313111	5054509		Burkholderia_virus(100.0%)	1	NA	NA
WP_001313516.1|311608_313111_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	3.1e-56
>prophage 27
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	334318	337530	5054509	tRNA	Catovirus(50.0%)	2	NA	NA
WP_025210125.1|334318_335836_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856848.1|336072_337530_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.1	2.6e-47
>prophage 28
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	351807	353791	5054509		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|351807_352101_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|352144_353791_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 29
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	357994	358528	5054509		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|357994_358528_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 30
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	363448	364426	5054509		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|363448_364426_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 31
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	371854	372400	5054509		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|371854_372400_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 32
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	376436	389468	5054509	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990294.1|376436_377774_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001596421.1|377783_379631_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_001280339.1|379623_380574_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|380659_380968_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|381044_382325_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|382410_383670_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|383672_384677_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|384758_384956_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|385059_386358_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|386562_386988_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_025210130.1|387026_389468_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	1.1e-66
>prophage 33
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	393311	394475	5054509		Ralstonia_phage(100.0%)	1	NA	NA
WP_025210131.1|393311_394475_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	44.0	1.3e-81
>prophage 34
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	429377	435858	5054509		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055075.1|429377_429908_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|430217_431174_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_001577603.1|431306_432809_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001316039.1|432822_433845_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596020.1|433831_434827_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|434859_435858_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 35
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	440120	443426	5054509		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000212718.1|440120_440363_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.1e-14
WP_001105433.1|440352_440643_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_001009182.1|440643_441108_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
WP_000187798.1|441287_443426_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 36
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	447064	453161	5054509		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_025210138.1|447064_448012_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|448196_448250_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471847.1|448390_451087_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|451292_451679_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|451751_452213_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|452225_453161_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 37
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	461503	466447	5054509	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_000416382.1|461503_464359_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|464358_464802_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|464935_466447_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
>prophage 38
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	470678	474591	5054509	integrase,transposase	Acanthamoeba_polyphaga_mimivirus(33.33%)	3	466936:466950	490697:490711
466936:466950	attL	ACGCTGGGCAAACTG	NA	NA	NA	NA
WP_025210142.1|470678_471698_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	2.4e-44
WP_001577618.1|472177_473443_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	6.7e-84
WP_089642612.1|473470_474591_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.0	3.3e-50
490697:490711	attR	ACGCTGGGCAAACTG	NA	NA	NA	NA
>prophage 39
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	485444	487079	5054509		Rhizobium_phage(100.0%)	1	NA	NA
WP_001577627.1|485444_487079_-	DNA phosphorothioation system sulfurtransferase DndC	NA	R9TRT5	Rhizobium_phage	27.4	1.8e-20
>prophage 40
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	493248	499214	5054509	transposase	uncultured_Mediterranean_phage(50.0%)	3	NA	NA
WP_001577632.1|493248_496503_+	DEAD/DEAH box helicase	NA	A0A1B1ISM1	uncultured_Mediterranean_phage	25.9	3.8e-30
WP_001338066.1|498103_498226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001577634.1|498233_499214_-|transposase	transposase	transposase	H6WZJ9	Escherichia_phage	56.3	7.9e-101
>prophage 41
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	502572	504249	5054509		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|502572_503175_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|503652_504249_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 42
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	514452	515913	5054509		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208190.1|514452_515913_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 43
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	522588	523173	5054509		Clostridioides_phage(100.0%)	1	NA	NA
WP_001600939.1|522588_523173_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	3.7e-37
>prophage 44
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	538844	539789	5054509	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_001577654.1|538844_539789_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	6.5e-60
>prophage 45
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	546328	550297	5054509		Acinetobacter_phage(50.0%)	2	NA	NA
WP_000939429.1|546328_547834_-	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.8e-34
WP_001589606.1|547864_550297_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	6.1e-09
>prophage 46
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	557682	558621	5054509		Pandoravirus(100.0%)	1	NA	NA
WP_001672356.1|557682_558621_-	MBL fold metallo-hydrolase	NA	S4VYV9	Pandoravirus	29.8	2.6e-16
>prophage 47
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	567441	572806	5054509		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_021525751.1|567441_569106_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|569154_570516_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|570730_571645_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106044.1|571783_572806_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	25.9	6.1e-11
>prophage 48
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	576032	577312	5054509		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|576032_576770_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|576772_577312_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 49
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	585241	588117	5054509		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175940.1|585241_586831_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
WP_001295748.1|587223_587829_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|587955_588117_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 50
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	593621	594944	5054509		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|593621_594944_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 51
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	601661	602894	5054509		Enterococcus_phage(100.0%)	1	NA	NA
WP_000093813.1|601661_602894_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	2.1e-82
>prophage 52
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	608754	612570	5054509		Klosneuvirus(50.0%)	2	NA	NA
WP_000046743.1|608754_610422_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.2	8.3e-42
WP_000409419.1|610632_612570_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 53
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	615756	617870	5054509		Bacillus_phage(50.0%)	2	NA	NA
WP_001188669.1|615756_616446_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	34.8	4.4e-29
WP_001219578.1|616445_617870_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.3	5.5e-10
>prophage 54
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	629525	642525	5054509		Cyanophage(16.67%)	12	NA	NA
WP_000130187.1|629525_630479_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094685.1|630593_631181_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|631215_631782_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102367.1|631930_632644_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843562.1|632669_633074_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|633449_635366_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|635454_636585_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001181672.1|636688_636898_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_001274824.1|637452_638214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025210171.1|638233_639727_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	28.3	2.1e-28
WP_025210172.1|639856_641101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025210173.1|641358_642525_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	3.7e-89
>prophage 55
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	652012	654829	5054509	tRNA	Moumouvirus(100.0%)	1	NA	NA
WP_025210177.1|652012_654829_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2P1ELB8	Moumouvirus	26.3	3.5e-77
>prophage 56
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	659235	660384	5054509		Halovirus(100.0%)	1	NA	NA
WP_001309937.1|659235_660384_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.8	1.7e-49
>prophage 57
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	665971	671632	5054509		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001309938.1|665971_667525_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	1.2e-34
WP_000349928.1|667598_668816_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|668944_670087_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|670117_671632_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 58
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	679526	680926	5054509		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|679526_680006_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257178.1|680083_680926_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 59
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	689987	695409	5054509		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_025210179.1|689987_692894_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_001577707.1|693057_695409_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.2	1.8e-37
>prophage 60
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	701709	702408	5054509		Planktothrix_phage(100.0%)	1	NA	NA
WP_025210182.1|701709_702408_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.1e-23
>prophage 61
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	715433	717158	5054509		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_025210187.1|715433_717158_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	2.4e-36
>prophage 62
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	743242	744286	5054509		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217337.1|743242_744286_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 63
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	748531	749083	5054509		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923726.1|748531_749083_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	31.6	1.5e-11
>prophage 64
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	757710	759135	5054509		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|757710_759135_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 65
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	766785	773253	5054509		Mamastrovirus(33.33%)	5	NA	NA
WP_001189657.1|766785_768336_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001309217.1|768382_770773_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|770978_771515_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|771555_772218_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|772326_773253_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 66
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	776515	777460	5054509	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000339900.1|776515_777460_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	1.3e-60
>prophage 67
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	786946	793752	5054509	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174642.1|786946_788365_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_025210197.1|788403_789330_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|789366_789822_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396050.1|789999_790704_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294687.1|790718_791249_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_025210198.1|791322_793752_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	31.4	6.0e-41
>prophage 68
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	798893	799691	5054509		Planktothrix_phage(100.0%)	1	NA	NA
WP_024229461.1|798893_799691_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	6.0e-14
>prophage 69
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	805602	805947	5054509		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_025234896.1|805602_805947_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	6.5e-26
>prophage 70
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	809876	811301	5054509	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|809876_811301_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 71
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	823148	897760	5054509	plate,tRNA,protease,transposase	Flavobacterium_phage(10.0%)	57	NA	NA
WP_001295562.1|823148_823907_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_019842250.1|823919_824777_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001520521.1|824788_826141_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|826170_828603_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|828724_829210_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_025210202.1|829213_830239_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|830343_830799_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|830802_831591_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_025210203.1|831590_832739_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569440.1|832735_833332_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.3e-26
WP_025210204.1|833368_836851_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	3.7e-209
WP_000055741.1|836863_837823_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001601040.1|837920_840062_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_001577743.1|840118_840508_+	VOC family protein	NA	NA	NA	NA	NA
WP_001577744.1|840572_841871_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062311.1|841919_842180_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|842166_842367_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185302.1|842532_843078_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|843074_843497_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239189.1|843510_844221_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000360446.1|844250_845075_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260707.1|845127_846846_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094026.1|846956_847664_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|847660_848065_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874226.1|848182_848998_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|849037_849691_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|849683_850715_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_025210205.1|850902_851475_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997053.1|857236_858040_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	5.4e-39
WP_000648583.1|858036_858951_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|859191_859992_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001521855.1|860069_860840_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|860886_862245_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052732.1|862316_863072_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001308373.1|863105_863828_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|863824_864292_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001308374.1|864356_865088_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001086163.1|865626_866412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025234897.1|866560_867028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908071.1|867037_867952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002621.1|867995_868478_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_025210206.1|868501_869854_-	membrane protein	NA	NA	NA	NA	NA
WP_001240537.1|873407_874820_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088867.1|874824_875568_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_025210207.1|875564_878348_-	type VI secretion system ATPase TssH	NA	A0A1C3S747	Escherichia_phage	30.6	2.3e-81
WP_025210208.1|879121_880453_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|880455_880980_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113717.1|880976_882257_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_025210209.1|882281_883364_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_025210210.1|883327_885178_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_025210211.1|885181_885595_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001550644.1|885601_887077_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521869.1|887127_887352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037390.1|887386_887887_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001550647.1|889310_891452_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_001077735.1|896025_896403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038428173.1|896623_897760_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 72
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	902308	905520	5054509		Caulobacter_phage(50.0%)	4	NA	NA
WP_000284050.1|902308_902887_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|902991_903759_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|903729_904470_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_025210214.1|904761_905520_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 73
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	915604	919316	5054509		Streptococcus_phage(66.67%)	3	NA	NA
WP_025210217.1|915604_916660_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.2e-117
WP_001285288.1|916947_918051_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_001550659.1|918062_919316_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	5.8e-96
>prophage 74
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	930953	933152	5054509		Acinetobacter_phage(100.0%)	1	NA	NA
WP_025210220.1|930953_933152_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.5e-38
>prophage 75
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	951374	952226	5054509		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001174452.1|951374_952226_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
>prophage 76
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	958271	961576	5054509		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001309281.1|958271_959141_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.7	1.2e-52
WP_001306921.1|959300_959894_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|959905_960142_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046306.1|960250_961576_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
>prophage 77
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	967134	973072	5054509	holin	Catovirus(50.0%)	4	NA	NA
WP_001159139.1|967134_968823_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	6.9e-60
WP_000089057.1|968836_970309_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001305448.1|970322_970910_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|971038_973072_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 78
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	985752	990290	5054509		Bacillus_virus(50.0%)	4	NA	NA
WP_000447338.1|985752_987237_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_025210229.1|987229_988201_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750342.1|988197_989154_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001550687.1|989240_990290_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.0	2.2e-72
>prophage 79
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	998670	1004265	5054509		Staphylococcus_phage(50.0%)	4	NA	NA
WP_025210231.1|998670_1000557_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	3.1e-53
WP_000076231.1|1000793_1002053_+	cytosine permease	NA	NA	NA	NA	NA
WP_001366517.1|1002042_1003326_+	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_025210232.1|1003365_1004265_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	7.2e-16
>prophage 80
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1008790	1013070	5054509		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_025210234.1|1008790_1011865_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.7	0.0e+00
WP_025210235.1|1011987_1013070_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	7.7e-190
>prophage 81
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1018480	1020441	5054509		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044321.1|1018480_1019431_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	1.9e-35
WP_000998300.1|1019427_1020441_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	4.1e-44
>prophage 82
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1023522	1024632	5054509		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|1023522_1024632_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 83
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1029921	1030689	5054509		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939339.1|1029921_1030689_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	2.1e-24
>prophage 84
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1037558	1038716	5054509		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830732.1|1037558_1038716_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	3.9e-06
>prophage 85
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1046130	1047246	5054509		Bacillus_phage(100.0%)	1	NA	NA
WP_000484041.1|1046130_1047246_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 86
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1051535	1061507	5054509		Bacillus_phage(60.0%)	7	NA	NA
WP_001366457.1|1051535_1052447_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_025210241.1|1052571_1053480_+	fructokinase	NA	NA	NA	NA	NA
WP_001328725.1|1053622_1054807_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_025210242.1|1054932_1058076_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	1.3e-11
WP_001221327.1|1058072_1059275_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|1059464_1060154_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|1060211_1061507_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 87
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1070309	1081037	5054509	tRNA,transposase	uncultured_Mediterranean_phage(50.0%)	10	NA	NA
WP_000667319.1|1070309_1071437_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|1071459_1071792_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_038428176.1|1071819_1073667_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|1073677_1074649_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|1074777_1075125_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|1075301_1076186_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_071847113.1|1077389_1078598_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	94.3	6.8e-211
WP_000543535.1|1078921_1079371_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_025210249.1|1079374_1080478_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	36.1	2.2e-54
WP_001021161.1|1080566_1081037_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 88
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1104596	1109643	5054509	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|1104596_1105220_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|1105345_1106620_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|1106807_1109162_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|1109370_1109643_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 89
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1112771	1113467	5054509		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817227.1|1112771_1113467_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 90
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1116790	1120337	5054509		Bacillus_phage(100.0%)	2	NA	NA
WP_025210253.1|1116790_1118563_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_025210254.1|1118555_1120337_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 91
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1129173	1132323	5054509		Leptospira_phage(100.0%)	1	NA	NA
WP_001132480.1|1129173_1132323_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	4.7e-54
>prophage 92
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1139161	1147619	5054509		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|1139161_1139713_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_001589814.1|1139841_1141773_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|1141825_1142155_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|1142154_1142760_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|1142869_1144744_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|1144924_1145569_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250117.1|1145700_1146663_+	ferrochelatase	NA	NA	NA	NA	NA
WP_025210257.1|1146659_1147619_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.0	1.5e-14
>prophage 93
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1156154	1158659	5054509		uncultured_virus(100.0%)	1	NA	NA
WP_000083991.1|1156154_1158659_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.5	1.3e-115
>prophage 94
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1183732	1185895	5054509		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_025210260.1|1183732_1185895_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	31.9	4.1e-17
>prophage 95
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1191598	1192276	5054509		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|1191598_1192276_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 96
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1195412	1203141	5054509		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|1195412_1196099_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_025210262.1|1196095_1198510_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014926.1|1198938_1203141_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.5	1.2e-23
>prophage 97
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1208398	1210180	5054509		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001558741.1|1208398_1210180_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	9.2e-39
>prophage 98
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1216372	1217518	5054509		Streptococcus_phage(100.0%)	1	NA	NA
WP_024230195.1|1216372_1217518_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.2	9.1e-48
>prophage 99
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1228939	1322296	5054509	head,capsid,protease,integrase,tail,transposase,terminase,portal,lysis,tRNA	Enterobacteria_phage(46.03%)	100	1239091:1239137	1285338:1285384
WP_000912355.1|1228939_1230325_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	5.1e-45
WP_001143546.1|1230360_1230882_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190286.1|1230989_1231202_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|1231203_1232070_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1232540_1233083_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|1233302_1233995_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_025210268.1|1234025_1236635_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691065.1|1236647_1237655_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001309313.1|1237665_1238181_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805414.1|1238183_1238816_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1239091:1239137	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001299447.1|1239150_1240314_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_000446905.1|1240169_1240541_-	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.1e-46
WP_000488407.1|1240512_1240791_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763390.1|1240838_1241057_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_077248689.1|1241155_1241437_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	2.1e-46
WP_000129285.1|1241447_1242005_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000682294.1|1241997_1242159_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000186833.1|1242155_1242836_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000100847.1|1242832_1243618_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995433.1|1243623_1243920_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000233576.1|1243995_1244202_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000259990.1|1244797_1245553_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_001067458.1|1245591_1245822_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|1245890_1246430_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001551200.1|1246516_1247446_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.0e-111
WP_000788815.1|1247442_1248144_+	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	2.4e-128
WP_025210269.1|1248140_1248443_+	hypothetical protein	NA	A0A0N6WES4	Escherichia_phage	94.6	3.3e-42
WP_001070442.1|1248510_1248843_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001299444.1|1248890_1249040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021537018.1|1249097_1250624_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	1.0e-30
WP_001445652.1|1251088_1251640_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1251649_1252447_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1252563_1252665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054342.1|1252661_1253117_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_000224916.1|1253116_1253287_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1253279_1253570_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099716.1|1253566_1253929_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_001307651.1|1253925_1254066_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	8.5e-09
WP_001204783.1|1254151_1254535_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	8.8e-56
WP_025210270.1|1254723_1255806_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.8	6.0e-166
WP_000839596.1|1256379_1256595_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135256.1|1256594_1257092_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	95.2	5.6e-87
WP_001228702.1|1257308_1257515_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|1257543_1257696_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079510.1|1258047_1258458_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	9.8e-53
WP_032231044.1|1258515_1258749_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|1259137_1259683_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|1259657_1261583_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_025210271.1|1261579_1261786_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001358226.1|1261782_1263384_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	8.8e-312
WP_000123248.1|1263364_1264684_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001358225.1|1264693_1265026_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063250.1|1265081_1266107_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_000158878.1|1266148_1266544_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	7.4e-58
WP_000785282.1|1266555_1266909_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|1266920_1267499_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|1267495_1267891_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_025210272.1|1267898_1268639_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	3.4e-128
WP_000479193.1|1268654_1269077_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|1269058_1269493_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_025210273.1|1269485_1272047_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.8	0.0e+00
WP_000847345.1|1272043_1272373_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152502.1|1272372_1273071_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_038428179.1|1273076_1273820_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.9e-147
WP_000090891.1|1273756_1274389_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_025211043.1|1274449_1277929_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_001228252.1|1277996_1278596_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_025210275.1|1278660_1281018_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	50.1	1.7e-117
WP_001544317.1|1281017_1281287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025210276.1|1281299_1281983_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	60.0	1.1e-56
WP_000355609.1|1281993_1282287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000386784.1|1282962_1283712_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_025210277.1|1283960_1284914_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|1285427_1286189_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1285338:1285384	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224574.1|1286371_1287262_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_025210278.1|1287262_1290235_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_025210279.1|1290221_1292459_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_021523035.1|1292656_1293793_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000769435.1|1294173_1294731_-	DUF4304 domain-containing protein	NA	NA	NA	NA	NA
WP_001328511.1|1294742_1295441_-	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	40.4	3.1e-14
WP_001038643.1|1295470_1295833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260286.1|1296329_1296545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522501.1|1297156_1297588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000154314.1|1298079_1298613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210280.1|1298609_1303439_-	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.8	2.2e-18
WP_001160804.1|1303458_1303920_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103213.1|1303947_1305849_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	7.1e-29
WP_025210281.1|1306585_1308034_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.5	5.1e-11
WP_000770953.1|1308023_1308707_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_025210282.1|1308863_1310246_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_000709869.1|1310269_1310602_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717111.1|1310617_1311841_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_025210283.1|1311852_1314996_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.4	3.7e-59
WP_000786320.1|1315097_1316474_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_001153132.1|1316541_1317789_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_025234898.1|1317896_1318550_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360954.1|1318643_1319012_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682518.1|1319076_1319325_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_025210284.1|1319390_1320509_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_085948682.1|1320927_1322296_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 100
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1327366	1333409	5054509		Tupanvirus(50.0%)	3	NA	NA
WP_025210287.1|1327366_1331248_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	6.4e-61
WP_025210288.1|1331463_1332597_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_024230162.1|1332593_1333409_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 101
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1347740	1349563	5054509		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502940.1|1347740_1348370_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	53.3	1.3e-56
WP_000029781.1|1348342_1349563_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.7e-58
>prophage 102
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1352671	1354786	5054509		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|1352671_1354237_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|1354357_1354786_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 103
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1368877	1369524	5054509		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|1368877_1369087_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939743.1|1369140_1369524_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	54.6	2.3e-24
>prophage 104
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1374339	1376779	5054509		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|1374339_1375551_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231428.1|1375690_1376779_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 105
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1383789	1388913	5054509	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001157896.1|1383789_1386372_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.2	1.2e-183
WP_001044880.1|1386607_1387090_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207527.1|1387134_1388070_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|1388187_1388913_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 106
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1394796	1395876	5054509		Pseudomonas_phage(100.0%)	1	NA	NA
WP_000490838.1|1394796_1395876_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.3e-47
>prophage 107
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1399971	1401636	5054509		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|1399971_1401636_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 108
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1406262	1410076	5054509	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023127.1|1406262_1408209_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.2e-07
WP_001287164.1|1408411_1410076_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	98.9	0.0e+00
>prophage 109
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1414228	1435062	5054509	transposase	Hokovirus(25.0%)	16	NA	NA
WP_025210299.1|1414228_1414993_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	32.4	5.8e-06
WP_000848387.1|1415177_1415723_+	replication initiation negative regulator SeqA	NA	NA	NA	NA	NA
WP_001297249.1|1415748_1417389_+	alpha-D-glucose phosphate-specific phosphoglucomutase	NA	NA	NA	NA	NA
WP_000502112.1|1417577_1418036_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
WP_000186067.1|1418263_1418941_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.6e-26
WP_025210300.1|1418937_1421622_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	1.1e-11
WP_001328699.1|1421614_1422187_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_025210301.1|1422195_1424244_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	7.1e-27
WP_025210302.1|1424266_1425940_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001365534.1|1425939_1426029_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424926.1|1426341_1426548_+	YbfA family protein	NA	NA	NA	NA	NA
WP_025210303.1|1426795_1430971_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	38.8	2.8e-22
WP_000494465.1|1430955_1431330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001577985.1|1431614_1432124_+	YbgA family protein	NA	NA	NA	NA	NA
WP_025210304.1|1432120_1433539_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.6	2.8e-62
WP_001032709.1|1433580_1435062_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	1.1e-45
>prophage 110
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1438440	1439232	5054509		Kaumoebavirus(100.0%)	1	NA	NA
WP_025210306.1|1438440_1439232_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	29.4	4.4e-09
>prophage 111
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1479624	1483144	5054509		Vibrio_phage(33.33%)	4	NA	NA
WP_000345406.1|1479624_1480344_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	4.1e-22
WP_000951276.1|1480340_1481282_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.9	2.9e-23
WP_000784339.1|1481395_1481776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210315.1|1482091_1483144_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.1	9.8e-81
>prophage 112
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1487506	1494082	5054509		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|1487506_1488523_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_001550833.1|1488785_1490258_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	4.2e-13
WP_001147439.1|1490325_1491114_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|1491242_1491392_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101994.1|1491558_1492332_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|1492331_1493021_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891696.1|1493023_1494082_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	2.0e-20
>prophage 113
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1504273	1505563	5054509		Klosneuvirus(100.0%)	1	NA	NA
WP_001589927.1|1504273_1505563_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	1.0e-18
>prophage 114
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1511999	1512908	5054509		Streptococcus_phage(100.0%)	1	NA	NA
WP_025210319.1|1511999_1512908_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	8.3e-28
>prophage 115
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1523181	1528173	5054509		Anomala_cuprea_entomopoxvirus(50.0%)	4	NA	NA
WP_001578024.1|1523181_1524918_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000976400.1|1524910_1525909_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|1525908_1526580_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007109.1|1526808_1528173_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
>prophage 116
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1532563	1541550	5054509		Bacillus_phage(25.0%)	8	NA	NA
WP_001578028.1|1532563_1534714_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	4.8e-42
WP_001522664.1|1534741_1535704_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_025210323.1|1535844_1536930_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|1537158_1537419_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146357.1|1537683_1537950_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	3.1e-07
WP_000990177.1|1538023_1538701_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_025210324.1|1538742_1541025_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|1541289_1541550_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 117
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1545089	1550314	5054509		Planktothrix_phage(33.33%)	7	NA	NA
WP_025210326.1|1545089_1545812_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.3	9.5e-35
WP_001159065.1|1545808_1546468_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|1546606_1547353_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|1547756_1548260_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|1548558_1549446_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|1549680_1549746_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|1549798_1550314_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 118
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1555310	1556906	5054509		Tupanvirus(100.0%)	1	NA	NA
WP_000961457.1|1555310_1556906_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	5.3e-62
>prophage 119
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1564507	1568638	5054509		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209332.1|1564507_1566940_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001562820.1|1566945_1567845_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001522680.1|1567975_1568638_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.6	4.3e-26
>prophage 120
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1571853	1573725	5054509		Planktothrix_phage(100.0%)	1	NA	NA
WP_025210331.1|1571853_1573725_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	8.8e-16
>prophage 121
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1585051	1586254	5054509		Stx2-converting_phage(100.0%)	1	NA	NA
WP_025210338.1|1585051_1586254_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	6.3e-100
>prophage 122
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1594820	1603970	5054509		Vibrio_phage(25.0%)	11	NA	NA
WP_025210339.1|1594820_1595078_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201580.1|1595237_1595525_+	YbjC family protein	NA	NA	NA	NA	NA
WP_001586851.1|1595508_1596231_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1596291_1597194_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_001522733.1|1597281_1597758_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126103.1|1598108_1599221_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996002.1|1599315_1600449_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105436.1|1600458_1601412_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061643.1|1601408_1602254_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389258.1|1602313_1602802_+	YbjO family protein	NA	NA	NA	NA	NA
WP_025210341.1|1602842_1603970_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	28.0	1.0e-27
>prophage 123
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1607095	1607824	5054509		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027208.1|1607095_1607824_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
>prophage 124
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1611504	1612335	5054509		Roseobacter_phage(100.0%)	1	NA	NA
WP_001255163.1|1611504_1612335_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	3.3e-07
>prophage 125
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1615922	1617641	5054509		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815340.1|1615922_1617641_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.4e-31
>prophage 126
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1626927	1650946	5054509	tRNA,protease	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188173.1|1626927_1628874_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1628946_1629171_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1629493_1629814_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1629844_1632121_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1632983_1633202_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1633486_1634191_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_025210346.1|1634232_1635954_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	3.8e-21
WP_025210347.1|1635954_1637721_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001522752.1|1637843_1638809_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|1639353_1639848_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_025210348.1|1639982_1644128_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1644286_1644898_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1644908_1646252_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1646342_1647635_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850333.1|1647873_1650318_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	8.6e-221
WP_000213098.1|1650328_1650946_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 127
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1655784	1658999	5054509		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|1655784_1656525_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292809.1|1656716_1658999_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
>prophage 128
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1663097	1666212	5054509	transposase	Streptococcus_phage(50.0%)	3	NA	NA
WP_000057142.1|1663097_1664186_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
WP_000445231.1|1664256_1665540_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_025210351.1|1665753_1666212_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
>prophage 129
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1669983	1674525	5054509		Bacillus_phage(100.0%)	2	NA	NA
WP_000167336.1|1669983_1670268_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000551266.1|1672776_1674525_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
>prophage 130
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1689230	1701627	5054509	tRNA,transposase	Rhodobacter_phage(16.67%)	9	NA	NA
WP_001295932.1|1689230_1689779_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109449.1|1689805_1690453_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|1690503_1691694_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977917.1|1691878_1692967_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|1693569_1694970_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_025210355.1|1695138_1696341_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001589972.1|1696606_1699219_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	9.1e-19
WP_107503769.1|1699286_1700635_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
WP_025210357.1|1700859_1701627_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	7.5e-30
>prophage 131
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1710528	1712436	5054509		Tupanvirus(100.0%)	1	NA	NA
WP_000053080.1|1710528_1712436_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
>prophage 132
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1725046	1727101	5054509		Bacillus_phage(100.0%)	1	NA	NA
WP_001445749.1|1725046_1727101_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 133
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1731334	1731994	5054509	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1731334_1731994_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 134
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1742988	1755303	5054509		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|1742988_1743201_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|1743211_1743400_+	cold-shock protein	NA	NA	NA	NA	NA
WP_038428195.1|1743374_1743605_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1743594_1743768_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_025210366.1|1743816_1744890_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_071849747.1|1744961_1747706_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	4.1e-38
WP_025210368.1|1747788_1748817_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1748789_1749482_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|1749611_1750784_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_025210369.1|1750783_1753330_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.0	2.0e-71
WP_025210370.1|1753326_1753926_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1754077_1754383_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420641.1|1754382_1755303_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	2.5e-11
>prophage 135
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1759607	1761707	5054509		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|1759607_1759781_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001586882.1|1759863_1761192_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	4.8e-234
WP_001028095.1|1761212_1761707_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 136
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1776433	1777498	5054509		Cronobacter_phage(100.0%)	1	NA	NA
WP_001599688.1|1776433_1777498_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	3.6e-91
>prophage 137
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1782485	1783319	5054509		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1782485_1783319_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 138
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1787455	1787989	5054509		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1787455_1787989_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 139
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1797297	1798218	5054509		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1797297_1798218_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 140
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1802880	1803126	5054509		Salmonella_phage(100.0%)	1	NA	NA
WP_024229637.1|1802880_1803126_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	5.9e-13
>prophage 141
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1818971	1819913	5054509		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001389589.1|1818971_1819913_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 142
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1832269	1833451	5054509		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1832269_1833004_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1833214_1833451_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 143
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1836723	1838366	5054509		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257002.1|1836723_1837365_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267921.1|1837361_1838366_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 144
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1850619	1850877	5054509		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1850619_1850877_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 145
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1858166	1861889	5054509		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033695.1|1858166_1858868_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_025210390.1|1858867_1860112_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|1860140_1861052_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|1861067_1861889_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 146
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1865160	1867138	5054509		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|1865160_1866018_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1866001_1867138_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 147
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1872159	1873530	5054509		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|1872159_1873530_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 148
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1876667	1880406	5054509		Phage_21(33.33%)	5	NA	NA
WP_001578178.1|1876667_1877918_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001309448.1|1878020_1878344_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	63.6	1.3e-39
WP_019842521.1|1878886_1878997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373096.1|1879049_1879454_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332300.1|1879674_1880406_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 149
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1885951	1888615	5054509		Escherichia_phage(100.0%)	1	NA	NA
WP_025210396.1|1885951_1888615_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.0	2.2e-84
>prophage 150
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1900213	1901901	5054509		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|1900213_1900633_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_025210399.1|1900632_1901901_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.9	5.1e-209
>prophage 151
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1905295	1905754	5054509	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502112.1|1905295_1905754_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
>prophage 152
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1920568	1921327	5054509		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_025210403.1|1920568_1921327_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.5e-14
>prophage 153
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1936728	1939480	5054509		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033363.1|1936728_1938408_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.8	7.9e-24
WP_001298109.1|1938532_1939480_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 154
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1942616	1949420	5054509		Pseudomonas_phage(33.33%)	9	NA	NA
WP_025210407.1|1942616_1943699_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_001578206.1|1943698_1944532_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200377.1|1944528_1944921_+	SirB family protein	NA	NA	NA	NA	NA
WP_025210408.1|1944924_1945734_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1945769_1946624_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000176713.1|1946771_1946879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000170955.1|1947306_1947414_-	small toxic polypeptide LdrA/LdrC	NA	NA	NA	NA	NA
WP_001366250.1|1947819_1948920_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001578208.1|1949189_1949420_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 155
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1960554	1970565	5054509		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|1960554_1962093_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571693.1|1962089_1962800_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1962799_1963477_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|1964202_1965045_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001314642.1|1965094_1965553_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1965665_1966571_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|1966662_1967676_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1967877_1968786_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1968930_1969344_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|1969947_1970565_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
>prophage 156
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1978976	1981628	5054509	transposase	Planktothrix_phage(33.33%)	3	NA	NA
WP_025210409.1|1978976_1979990_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	3.4e-14
WP_000994905.1|1979986_1980991_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000502112.1|1981169_1981628_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
>prophage 157
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	1993359	1996317	5054509		Acinetobacter_phage(100.0%)	2	NA	NA
WP_025210411.1|1993359_1994718_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.7	8.6e-37
WP_000763517.1|1994721_1996317_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	2.2e-52
>prophage 158
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2004792	2010084	5054509	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_025210415.1|2004792_2005551_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422048.1|2005770_2006820_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	3.5e-22
WP_001031530.1|2006855_2007107_-	YciN family protein	NA	NA	NA	NA	NA
WP_001309471.1|2007486_2010084_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	9.2e-88
>prophage 159
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2015008	2015599	5054509		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|2015008_2015599_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 160
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2023413	2025348	5054509		Lactococcus_phage(100.0%)	1	NA	NA
WP_000485008.1|2023413_2025348_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	28.1	3.7e-33
>prophage 161
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2034281	2036300	5054509		Salmonella_phage(50.0%)	2	NA	NA
WP_021564305.1|2034281_2035445_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	6.2e-28
WP_000573407.1|2035493_2036300_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 162
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2049090	2050356	5054509		Klosneuvirus(100.0%)	1	NA	NA
WP_024229940.1|2049090_2050356_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.6	4.6e-24
>prophage 163
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2068732	2069248	5054509		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945046.1|2068732_2069248_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 164
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2079063	2187026	5054509	head,integrase,tail,transposase,terminase,lysis,tRNA,holin	Escherichia_phage(59.3%)	105	2172139:2172156	2183213:2183230
WP_001361837.1|2079063_2080296_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2080550_2081534_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001599773.1|2082010_2083384_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|2083512_2084448_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_001516465.1|2084499_2085735_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.5	8.4e-241
WP_000079604.1|2085736_2085952_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001605349.1|2086051_2086240_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	1.2e-26
WP_032159264.1|2086232_2086427_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	98.4	1.3e-31
WP_001004422.1|2086490_2087543_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	63.6	8.5e-117
WP_001605350.1|2087554_2090626_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	84.0	0.0e+00
WP_001344816.1|2090727_2091003_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|2091077_2091248_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2091247_2091469_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2091910_2092399_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2092395_2092551_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|2092561_2092741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551043.1|2093004_2093481_-	DNA-binding transcriptional repressor RacR	NA	NA	NA	NA	NA
WP_001551044.1|2093604_2093901_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	43.5	1.6e-09
WP_025210427.1|2093923_2094346_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.4e-67
WP_001396581.1|2094423_2095212_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788969.1|2095218_2095965_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	4.9e-111
WP_001605353.1|2095987_2096749_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.5	5.5e-118
WP_001605354.1|2096764_2097187_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	6.7e-65
WP_001100703.1|2098282_2099434_+	DNA cytosine methyltransferase	NA	Q8JKX6	Natrialba_phage	36.9	1.0e-22
WP_000016656.1|2099401_2100391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000138556.1|2100390_2101782_-	ATPase	NA	NA	NA	NA	NA
WP_000940319.1|2102281_2102881_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_001605357.1|2102880_2103171_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	8.2e-46
WP_000640161.1|2103167_2103710_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|2104754_2105183_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2105354_2105729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|2105980_2106196_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135310.1|2106195_2106693_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228688.1|2106909_2107095_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|2107291_2108749_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_025210428.1|2108886_2109678_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	39.8	8.2e-48
WP_001204037.1|2109670_2110603_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000126788.1|2110580_2110790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|2110793_2111888_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625348.1|2111868_2113170_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763704.1|2113172_2114579_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001351715.1|2114562_2115675_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000770042.1|2115779_2116544_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
WP_000918487.1|2116642_2117782_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000634214.1|2118004_2118400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|2118399_2118783_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|2118783_2119164_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|2119160_2119553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025234901.1|2119579_2120542_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|2120692_2121052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001605364.1|2121525_2124759_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.6	5.4e-114
WP_000024051.1|2124751_2125090_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001605366.1|2125089_2125788_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.5e-125
WP_001349921.1|2125793_2126537_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
WP_000090891.1|2126473_2127106_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_025234902.1|2130927_2131161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144318948.1|2131211_2131499_+	hypothetical protein	NA	Q71TC6	Escherichia_phage	33.3	2.3e-08
WP_025234903.1|2131857_2132424_+	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.9	9.5e-99
WP_000523980.1|2132434_2133046_+	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_025234904.1|2133060_2133942_+	hypothetical protein	NA	A0A1B0VBL3	Salmonella_phage	99.3	8.3e-174
WP_025210431.1|2134023_2137452_+	lytic transglycosylase domain-containing protein	NA	A0A1B0VDM8	Salmonella_phage	94.5	0.0e+00
WP_000002800.1|2137451_2137808_+	hypothetical protein	NA	Q71TP1	Escherichia_phage	100.0	1.0e-61
WP_025210432.1|2137804_2139238_+	bleomycin hydrolase	NA	Q71TP2	Escherichia_phage	99.4	2.0e-270
WP_025210433.1|2139237_2140074_+	hypothetical protein	NA	A0A077SLH5	Escherichia_phage	98.9	1.3e-152
WP_025210434.1|2140152_2140587_+	hypothetical protein	NA	Q71TD4	Escherichia_phage	96.5	3.4e-72
WP_077769110.1|2140598_2143499_+	hypothetical protein	NA	Q71TP5	Escherichia_phage	92.5	1.8e-254
WP_025234905.1|2143498_2143777_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	64.1	4.3e-28
WP_025210437.1|2144676_2145294_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.4	5.9e-86
WP_038428224.1|2145257_2145803_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000887652.1|2146819_2147149_+|holin	holin	holin	Q37876	Escherichia_phage	100.0	1.3e-52
WP_000580776.1|2147145_2147589_+	hypothetical protein	NA	A0A077SK09	Escherichia_phage	100.0	1.3e-82
WP_025210438.1|2147575_2148178_+	hypothetical protein	NA	Q1MVM6	Enterobacteria_phage	98.5	6.0e-99
WP_025210439.1|2148179_2150099_+	phage protein DarA	NA	A0A1B0V7H1	Salmonella_phage	98.6	0.0e+00
WP_023351539.1|2150095_2150461_+	hypothetical protein	NA	A0A077SK35	Escherichia_phage	99.2	3.0e-45
WP_025210440.1|2150473_2153461_+	hypothetical protein	NA	A0A077SK08	Escherichia_phage	97.3	0.0e+00
WP_001165936.1|2153450_2153759_+	hypothetical protein	NA	O21974	Escherichia_phage	97.1	5.4e-48
WP_025210441.1|2153788_2154577_-	hypothetical protein	NA	Q71TF1	Escherichia_phage	96.2	5.7e-142
WP_025210442.1|2154583_2155261_-	DUF2829 domain-containing protein	NA	A0A1B0VBT1	Salmonella_phage	98.2	4.9e-126
WP_025210444.1|2155458_2155947_-	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	99.4	3.2e-87
WP_025210445.1|2156116_2156674_+	lysozyme	NA	Q71TF3	Escherichia_phage	99.5	2.7e-106
WP_000132937.1|2156959_2157979_-|head	head processing protein	head	Q71TR6	Escherichia_phage	96.8	4.4e-179
WP_001312284.1|2158091_2159222_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	84.5	9.2e-186
WP_025210446.1|2159254_2160976_-	hypothetical protein	NA	Q1MVN6	Enterobacteria_phage	99.5	0.0e+00
WP_025234907.1|2161051_2167819_+	N-6 DNA methylase	NA	A0A077SK04	Escherichia_phage	98.3	0.0e+00
WP_000224043.1|2167852_2168293_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_025210447.1|2168576_2169299_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025210448.1|2169547_2170237_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_025210449.1|2170290_2170935_-	hypothetical protein	NA	A0A1B0VAG4	Salmonella_phage	86.3	1.3e-96
WP_072262119.1|2171124_2171511_-	Ref family protein	NA	Q71TG3	Escherichia_phage	93.7	8.0e-57
WP_000691857.1|2171729_2172506_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
2172139:2172156	attL	AACTCGCAGCAATTCTTG	NA	NA	NA	NA
WP_000104482.1|2172521_2173511_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071595431.1|2174715_2174823_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	1.5e-05
WP_016246567.1|2175015_2175327_-	hypothetical protein	NA	Q71TG4	Escherichia_phage	96.1	8.8e-46
WP_000067534.1|2175377_2176409_-|integrase	site-specific integrase	integrase	Q71TG5	Escherichia_phage	99.7	2.2e-194
WP_000542385.1|2176416_2176638_-	hypothetical protein	NA	Q38403	Escherichia_phage	100.0	2.6e-36
WP_000874156.1|2177242_2177452_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611666.1|2177562_2178414_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	2.8e-158
WP_000124159.1|2180126_2181611_-	hypothetical protein	NA	Q5QBP2	Enterobacteria_phage	99.8	4.3e-292
WP_025210451.1|2181610_2182804_-	hypothetical protein	NA	Q5QBP3	Enterobacteria_phage	91.9	7.2e-189
WP_001326849.1|2182889_2183342_-	late promoter-activating protein	NA	Q71T63	Escherichia_phage	100.0	3.0e-79
2183213:2183230	attR	CAAGAATTGCTGCGAGTT	NA	NA	NA	NA
WP_025210452.1|2183430_2184474_-	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	99.4	1.1e-206
WP_025210453.1|2184501_2184681_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	7.8e-23
WP_025210454.1|2184685_2185066_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	7.4e-63
WP_001190712.1|2185065_2185287_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_025210455.1|2185469_2187026_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	8.4e-105
>prophage 165
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2191737	2250163	5054509	plate,tail	Escherichia_phage(67.27%)	56	NA	NA
WP_025210458.1|2191737_2192244_-	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	98.8	7.0e-93
WP_000107690.1|2192316_2193579_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.8	1.6e-234
WP_000684845.1|2193880_2194582_-	hypothetical protein	NA	Q1MVG6	Enterobacteria_phage	100.0	4.2e-144
WP_025210461.1|2194578_2195256_-	serine/threonine protein phosphatase	NA	A0A077SLQ6	Escherichia_phage	99.1	2.9e-134
WP_000484111.1|2195252_2195879_-	norphogenetic protein	NA	A0A077SK52	Escherichia_phage	99.5	1.0e-122
WP_000096174.1|2196380_2196536_-	hypothetical protein	NA	Q71TJ4	Escherichia_phage	100.0	7.0e-20
WP_000943607.1|2196602_2197181_-	norphogenetic protein	NA	Q71T85	Escherichia_phage	99.5	5.7e-107
WP_000840931.1|2197183_2197429_-	hypothetical protein	NA	Q71T86	Escherichia_phage	100.0	5.7e-40
WP_000235786.1|2197575_2197953_+	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_025210462.1|2197962_2199180_+	hypothetical protein	NA	A0A077SL53	Escherichia_phage	99.8	5.4e-224
WP_000896806.1|2199183_2199912_+	hypothetical protein	NA	Q71TJ9	Escherichia_phage	100.0	4.2e-139
WP_015974270.1|2199898_2200684_+	hypothetical protein	NA	Q71T90	Escherichia_phage	100.0	9.4e-145
WP_000212025.1|2200685_2201702_+	hypothetical protein	NA	Q1MVH7	Enterobacteria_phage	100.0	3.5e-192
WP_000535202.1|2201694_2202327_+|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
WP_001198665.1|2202373_2203372_-	hypothetical protein	NA	A0A1B0VCH7	Salmonella_phage	100.0	1.1e-195
WP_025210463.1|2203371_2204736_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	99.6	1.2e-251
WP_000234830.1|2205203_2205368_-	DUF3927 family protein	NA	Q71T96	Escherichia_phage	96.3	5.0e-16
WP_000900641.1|2205367_2205793_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	99.3	2.4e-70
WP_162149578.1|2207128_2207389_+	hypothetical protein	NA	A0A1B0V7P4	Salmonella_phage	84.8	6.0e-16
WP_000660977.1|2207447_2210735_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	98.7	0.0e+00
WP_025210464.1|2210731_2211637_-	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	97.0	6.5e-158
WP_001177864.1|2211629_2211914_-	hypothetical protein	NA	Q71TA2	Escherichia_phage	98.9	1.7e-48
WP_025210465.1|2212376_2213165_+	hypothetical protein	NA	Q71TL4	Escherichia_phage	99.2	4.0e-119
WP_025210466.1|2213204_2213627_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	96.4	2.3e-57
WP_000336812.1|2213652_2213793_+	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_001281116.1|2213804_2214197_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_001113742.1|2214532_2215417_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_001154687.1|2215709_2216519_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
WP_001285362.1|2216687_2217884_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|2217900_2218902_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_025210467.1|2219127_2220834_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	98.1	0.0e+00
WP_025210468.1|2220894_2222484_+	hypothetical protein	NA	Q71TB2	Escherichia_phage	99.4	2.1e-305
WP_000041756.1|2222493_2223309_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	99.6	1.2e-113
WP_025210469.1|2223344_2223926_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	99.0	8.6e-103
WP_001615627.1|2223937_2224447_+	hypothetical protein	NA	A0A077SK14	Escherichia_phage	100.0	1.7e-91
WP_025210470.1|2224618_2225215_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	99.0	9.1e-108
WP_025210472.1|2225708_2226224_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	100.0	6.4e-94
WP_025210473.1|2226319_2227162_-	hypothetical protein	NA	A0A1B0VAC8	Salmonella_phage	98.9	2.7e-150
WP_071849758.1|2228639_2229440_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	68.8	8.8e-98
WP_071849748.1|2230027_2230249_-	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	98.6	7.4e-39
WP_025234908.1|2230675_2231314_+	hypothetical protein	NA	Q71TC4	Escherichia_phage	87.8	1.2e-12
WP_025234909.1|2231343_2232126_+	hypothetical protein	NA	Q38410	Escherichia_phage	33.6	1.4e-31
WP_025234903.1|2232270_2232837_+	hypothetical protein	NA	Q71TN7	Escherichia_phage	98.9	9.5e-99
WP_158413071.1|2234442_2234607_+	hypothetical protein	NA	Q71TP0	Escherichia_phage	92.3	6.3e-11
WP_144318949.1|2237141_2237813_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	83.0	3.8e-94
WP_025234914.1|2237873_2241353_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.6	0.0e+00
WP_001228228.1|2241420_2242020_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	93.0	1.2e-102
WP_000741766.1|2242084_2244460_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_000654143.1|2244459_2244741_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_025210478.1|2244750_2245791_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.0	5.4e-124
WP_000355601.1|2245833_2246127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025210479.1|2246354_2246945_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	3.6e-24
WP_000836768.1|2247261_2247495_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2247563_2247677_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001295593.1|2248454_2248889_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837902.1|2249029_2250163_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
>prophage 166
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2255118	2256108	5054509		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|2255118_2256108_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 167
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2287137	2291040	5054509		Klosneuvirus(100.0%)	1	NA	NA
WP_025210489.1|2287137_2291040_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 168
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2294979	2297618	5054509	transposase	Escherichia_phage(33.33%)	4	NA	NA
WP_025210490.1|2294979_2295510_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	1.6e-18
WP_000731851.1|2295754_2295928_+	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
WP_025210491.1|2295999_2296149_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_085948682.1|2296248_2297618_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 169
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2310557	2317607	5054509		Phage_TP(25.0%)	7	NA	NA
WP_001599842.1|2310557_2312519_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000494241.1|2312610_2312841_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|2313062_2313239_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|2313284_2313701_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_001599845.1|2313779_2315186_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001599847.1|2315430_2316576_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001599848.1|2316593_2317607_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	3.5e-27
>prophage 170
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2324731	2326834	5054509		Salmonella_phage(100.0%)	1	NA	NA
WP_024193102.1|2324731_2326834_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	66.2	4.3e-136
>prophage 171
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2333776	2342447	5054509		uncultured_Caudovirales_phage(33.33%)	4	NA	NA
WP_025210495.1|2333776_2337997_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.9	6.4e-22
WP_025210496.1|2337997_2338396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000236740.1|2339326_2340376_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	38.0	2.4e-18
WP_025210497.1|2340470_2342447_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	5.2e-160
>prophage 172
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2347012	2348557	5054509		Escherichia_phage(100.0%)	1	NA	NA
WP_001578328.1|2347012_2348557_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 173
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2356835	2357936	5054509		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768393.1|2356835_2357936_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	65.4	5.3e-138
>prophage 174
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2364093	2366101	5054509	transposase	Saccharomonospora_phage(33.33%)	3	NA	NA
WP_025210499.1|2364093_2364552_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	5.0e-13
WP_000781370.1|2364660_2364945_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642406.1|2365090_2366101_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 175
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2369374	2371280	5054509		Planktothrix_phage(100.0%)	2	NA	NA
WP_001595747.1|2369374_2370301_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.2	5.9e-13
WP_025210500.1|2370293_2371280_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.9e-17
>prophage 176
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2375596	2379403	5054509		Klosneuvirus(50.0%)	2	NA	NA
WP_025210501.1|2375596_2377996_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.2e-09
WP_025210502.1|2378020_2379403_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.8	1.5e-17
>prophage 177
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2384681	2391617	5054509		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_000402810.1|2384681_2387477_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	23.8	1.7e-18
WP_000832500.1|2387521_2389894_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_000628569.1|2389931_2391617_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.0	2.9e-10
>prophage 178
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2412748	2414149	5054509		Escherichia_phage(100.0%)	1	NA	NA
WP_033870153.1|2412748_2414149_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.5	2.8e-107
>prophage 179
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2421571	2423107	5054509		Staphylococcus_phage(100.0%)	1	NA	NA
WP_024229265.1|2421571_2423107_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	31.4	1.2e-21
>prophage 180
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2430978	2432397	5054509		Bacillus_phage(100.0%)	1	NA	NA
WP_000558440.1|2430978_2432397_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 181
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2440144	2442274	5054509		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|2440144_2440528_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803518.1|2440559_2440778_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_025210513.1|2440834_2442274_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	3.7e-30
>prophage 182
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2449778	2450669	5054509		Bacillus_phage(100.0%)	1	NA	NA
WP_025210516.1|2449778_2450669_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	3.1e-19
>prophage 183
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2455560	2470997	5054509		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|2455560_2455764_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527790.1|2455798_2457259_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_001599923.1|2457348_2458716_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_025210518.1|2458773_2459793_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	5.7e-17
WP_001295394.1|2459804_2461019_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_025210519.1|2461223_2461550_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.5	3.8e-23
WP_000705197.1|2461684_2462026_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|2462060_2462621_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|2462623_2463334_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2463441_2463747_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041650.1|2463945_2466372_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.3e-213
WP_012602795.1|2466432_2468856_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	1.4e-207
WP_000213028.1|2468866_2469484_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001551147.1|2469485_2470340_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_025210520.1|2470382_2470997_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 184
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2488758	2490060	5054509		Bacillus_phage(100.0%)	1	NA	NA
WP_000732505.1|2488758_2490060_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	4.2e-17
>prophage 185
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2499955	2501767	5054509		Vaccinia_virus(100.0%)	1	NA	NA
WP_025210529.1|2499955_2501767_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.3	0.0e+00
>prophage 186
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2521646	2522921	5054509	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2521646_2522921_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 187
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2529832	2531331	5054509		Salmonella_phage(50.0%)	2	NA	NA
WP_001298528.1|2529832_2530354_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	56.3	6.0e-47
WP_000250671.1|2530434_2531331_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 188
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2540135	2548939	5054509		Streptomyces_phage(20.0%)	9	NA	NA
WP_001578428.1|2540135_2540963_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|2541090_2541672_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_025210537.1|2541817_2542987_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|2543152_2543242_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|2543540_2544566_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269493.1|2544562_2545495_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182362.1|2545607_2546819_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098886.1|2547109_2548258_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	7.2e-85
WP_000493947.1|2548297_2548939_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 189
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2554444	2556711	5054509		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587586.1|2554444_2555257_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069972.1|2555260_2556046_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001309532.1|2556042_2556711_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.8	4.5e-23
>prophage 190
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2565002	2570086	5054509		environmental_halophage(33.33%)	5	NA	NA
WP_025210539.1|2565002_2566223_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.9	3.8e-92
WP_000907973.1|2566219_2567491_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948865.1|2567465_2568212_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	3.8e-10
WP_001308677.1|2568221_2569709_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367171.1|2569717_2570086_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	5.6e-15
>prophage 191
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2588678	2608127	5054509	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_128971863.1|2588678_2590379_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.7	3.6e-32
WP_025210544.1|2590435_2592814_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	2.7e-171
WP_000368046.1|2593146_2593980_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001520625.1|2594136_2595183_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	1.2e-83
WP_025210545.1|2595314_2595506_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_021517148.1|2595509_2596946_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001520627.1|2597008_2597722_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209784.1|2597968_2598433_-	endopeptidase	NA	A0A217EQL1	Bacillus_phage	35.3	8.6e-13
WP_000029466.1|2598510_2599260_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|2599259_2599811_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_001520628.1|2599873_2600854_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|2600954_2601254_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_025210546.1|2601258_2603646_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018588.1|2603660_2604644_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_001386830.1|2604782_2604827_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2604949_2605306_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2605358_2605556_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2605652_2606195_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_025210547.1|2606198_2608127_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	4.7e-129
>prophage 192
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2619415	2621677	5054509		Tupanvirus(100.0%)	1	NA	NA
WP_024229571.1|2619415_2621677_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 193
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2627795	2628623	5054509		Bacillus_virus(100.0%)	1	NA	NA
WP_000175037.1|2627795_2628623_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	2.0e-73
>prophage 194
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2636099	2637320	5054509		Klosneuvirus(100.0%)	1	NA	NA
WP_025210552.1|2636099_2637320_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	1.5e-27
>prophage 195
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2644085	2644739	5054509		Planktothrix_phage(100.0%)	1	NA	NA
WP_025210554.1|2644085_2644739_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	30.2	9.9e-15
>prophage 196
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2650337	2652299	5054509		Streptococcus_phage(100.0%)	1	NA	NA
WP_025210557.1|2650337_2652299_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	1.2e-39
>prophage 197
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2657224	2661310	5054509		Tupanvirus(50.0%)	4	NA	NA
WP_001135079.1|2657224_2657866_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.4	3.8e-19
WP_000438819.1|2657958_2659317_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|2659434_2660193_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723698.1|2660329_2661310_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	22.0	1.0e-07
>prophage 198
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2670123	2670978	5054509		Indivirus(100.0%)	1	NA	NA
WP_025210559.1|2670123_2670978_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	25.0	3.9e-11
>prophage 199
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2674296	2678873	5054509		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|2674296_2675580_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000621404.1|2675726_2677202_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_001322965.1|2677382_2678873_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 200
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2693626	2701731	5054509	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|2693626_2695312_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|2695516_2696098_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001595842.1|2696136_2696832_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|2696889_2698800_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|2698931_2699276_+	RidA family protein	NA	NA	NA	NA	NA
WP_001322969.1|2699637_2699997_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2700116_2700296_-	YoaH family protein	NA	NA	NA	NA	NA
WP_025210562.1|2700369_2701731_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.9	8.0e-43
>prophage 201
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2705593	2707150	5054509		Moraxella_phage(100.0%)	1	NA	NA
WP_000394985.1|2705593_2707150_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 202
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2712791	2713001	5054509		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2712791_2713001_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 203
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2718333	2720382	5054509		Moraxella_phage(100.0%)	1	NA	NA
WP_025210563.1|2718333_2720382_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 204
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2727878	2736212	5054509	transposase	Escherichia_phage(40.0%)	10	NA	NA
WP_025210567.1|2727878_2728535_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.1	2.6e-55
WP_000976472.1|2728929_2729271_-	YebY family protein	NA	NA	NA	NA	NA
WP_025210568.1|2729283_2730156_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168745.1|2730159_2730534_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2730672_2730903_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011651.1|2731004_2731661_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2731684_2732347_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_025210569.1|2732343_2734404_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000064873.1|2734560_2734986_-|transposase	IS200/IS605-like element ISEc46 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.6	8.9e-25
WP_025210570.1|2735042_2736212_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	99.5	7.0e-205
>prophage 205
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2742166	2743642	5054509		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|2742166_2743642_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 206
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2746695	2755418	5054509	transposase	Bacillus_virus(40.0%)	11	NA	NA
WP_025210574.1|2746695_2747154_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_000448381.1|2747261_2748233_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|2748351_2749674_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_011076428.1|2749689_2750622_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202987.1|2750700_2751456_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571471.1|2751452_2752238_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568522.1|2752387_2753398_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2753406_2754018_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072146566.1|2754156_2754222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210575.1|2754292_2754895_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2754896_2755418_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 207
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2759436	2761487	5054509		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_025210576.1|2759436_2760255_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	97.6	1.2e-70
WP_000252980.1|2760307_2760703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|2760743_2761487_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 208
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2767971	2769705	5054509	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_025210579.1|2767971_2769705_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 209
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2774225	2779869	5054509		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|2774225_2774615_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2774629_2775679_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204337.1|2775681_2776542_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_025210580.1|2776560_2778162_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	2.7e-13
WP_024242500.1|2778207_2779869_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 210
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2789957	2791472	5054509		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001187819.1|2789957_2791472_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 211
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2803464	2804217	5054509		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|2803464_2804217_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 212
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2816403	2817072	5054509		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001578522.1|2816403_2817072_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	1.4e-80
>prophage 213
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2832886	2845372	5054509		Bacillus_phage(33.33%)	12	NA	NA
WP_077768612.1|2832886_2834581_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2834751_2834934_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_025210590.1|2835012_2835930_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212222.1|2836102_2837023_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000785988.1|2837011_2837482_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	9.9e-33
WP_001157214.1|2837462_2838881_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365574.1|2838947_2839643_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|2839682_2840048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824409.1|2840613_2841792_+	porin	NA	Q1MVN1	Enterobacteria_phage	55.4	1.4e-104
WP_000218214.1|2842383_2843235_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826807.1|2843342_2844701_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|2844700_2845372_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 214
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2865610	2870960	5054509		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_025210596.1|2865610_2869792_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.0	9.8e-23
WP_025210597.1|2870313_2870775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001578542.1|2870771_2870960_+	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	58.1	2.1e-10
>prophage 215
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2886207	2887374	5054509		Stx2-converting_phage(100.0%)	1	NA	NA
WP_025210602.1|2886207_2887374_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	1.7e-227
>prophage 216
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2893571	2894471	5054509		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131789.1|2893571_2894471_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 217
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2900755	2911700	5054509	transposase	Paramecium_bursaria_Chlorella_virus(28.57%)	10	NA	NA
WP_000526135.1|2900755_2901214_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_021577641.1|2901412_2902393_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_025210607.1|2902539_2903706_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	7.5e-114
WP_000043458.1|2903954_2905361_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.4e-37
WP_025210608.1|2905557_2906982_-	phosphomannomutase	NA	NA	NA	NA	NA
WP_025210609.1|2906987_2907734_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	39.3	2.7e-08
WP_025210610.1|2907733_2909140_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.5	2.0e-49
WP_021562286.1|2909145_2909607_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_025210611.1|2909609_2910575_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	50.5	4.2e-86
WP_025210612.1|2910578_2911700_-	GDP-mannose 4,6-dehydratase	NA	M1HVG7	Acanthocystis_turfacea_Chlorella_virus	64.7	1.6e-134
>prophage 218
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2917426	2923732	5054509		Enterobacteria_phage(50.0%)	6	NA	NA
WP_025210617.1|2917426_2917972_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	8.4e-52
WP_025210618.1|2917976_2918855_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	1.5e-106
WP_001023641.1|2918912_2919812_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_025210619.1|2919811_2920897_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	3.0e-101
WP_000183060.1|2921269_2922163_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_025210620.1|2922337_2923732_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.2	3.7e-19
>prophage 219
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2929239	2935942	5054509		Bacillus_phage(25.0%)	6	NA	NA
WP_025210623.1|2929239_2930610_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	6.4e-32
WP_000079285.1|2930711_2932148_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_025210624.1|2932150_2933374_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001351161.1|2933370_2933850_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043606.1|2933852_2934818_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_001600111.1|2934820_2935942_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	2.0e-132
>prophage 220
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2940186	2950596	5054509		Catovirus(40.0%)	8	NA	NA
WP_000654487.1|2940186_2941026_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A1V0S9B9	Catovirus	28.3	4.1e-05
WP_025210629.1|2941118_2943281_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.1e-17
WP_000482908.1|2943283_2943727_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2943732_2944872_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_001366304.1|2945530_2947114_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_025210630.1|2947406_2949260_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|2949281_2949863_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|2949954_2950596_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 221
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2955259	2956612	5054509		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_025210633.1|2955259_2956612_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	2.1e-06
>prophage 222
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	2970382	3010490	5054509	head,plate,capsid,integrase,tail,terminase,portal,lysis,tRNA,holin	Escherichia_phage(63.41%)	49	2974671:2974698	3008675:3008702
WP_000675144.1|2970382_2971786_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
WP_000137877.1|2971782_2972505_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|2972684_2973017_+	YegP family protein	NA	NA	NA	NA	NA
WP_025210639.1|2973164_2974526_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.2	1.2e-216
2974671:2974698	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2974798_2975017_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882931.1|2975098_2976262_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	3.1e-205
WP_025210640.1|2976261_2976741_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	3.3e-84
WP_025210641.1|2976755_2979203_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	95.2	0.0e+00
WP_000785970.1|2979195_2979315_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2979347_2979623_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2979679_2980198_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|2980210_2981401_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_025210642.1|2981460_2982054_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	8.7e-103
WP_025210643.1|2982252_2982570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025234921.1|2982713_2983082_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	99.2	1.1e-63
WP_001008234.1|2983102_2983546_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_025210644.1|2983517_2984120_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	3.5e-99
WP_025234922.1|2984119_2985445_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.0	3.0e-183
WP_016236406.1|2985441_2986053_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_025210646.1|2986045_2986954_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_025210647.1|2986958_2987306_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	5.0e-58
WP_025210648.1|2987302_2987938_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	1.4e-111
WP_025210649.1|2988038_2989391_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_025210650.1|2989401_2989941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210651.1|2989956_2990418_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.3	1.3e-45
WP_025210652.1|2990410_2990878_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	96.8	2.2e-80
WP_023278421.1|2990985_2991411_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.6e-66
WP_025210653.1|2991398_2991824_-	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	94.3	4.7e-58
WP_001144101.1|2991838_2992336_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2992335_2992617_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|2992620_2992824_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|2992823_2993333_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_025210654.1|2993432_2994176_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	98.4	7.3e-123
WP_001248574.1|2994179_2995253_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	100.0	1.8e-202
WP_025210655.1|2996099_2997872_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_025210656.1|2997871_2998906_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	98.8	4.6e-200
WP_106121066.1|2999217_3001110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000548273.1|3001240_3001705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024174129.1|3001718_3002627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210657.1|3002749_3005023_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.4	0.0e+00
WP_021540634.1|3005012_3005288_-	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	8.6e-45
WP_001113264.1|3005284_3005509_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277954.1|3005508_3005811_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	98.0	6.5e-46
WP_000217670.1|3006098_3006599_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_038428309.1|3006776_3007052_-	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	98.9	2.8e-48
WP_001306384.1|3007166_3007466_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_025210659.1|3007581_3008595_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	3.1e-193
WP_001303579.1|3008858_3009176_-	hypothetical protein	NA	NA	NA	NA	NA
3008675:3008702	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_025210660.1|3009590_3010490_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	9.8e-13
>prophage 223
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3019630	3023187	5054509		Serratia_phage(50.0%)	4	NA	NA
WP_001578612.1|3019630_3020635_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	30.0	8.9e-15
WP_001578613.1|3020631_3021597_+	kinase	NA	NA	NA	NA	NA
WP_001578614.1|3021570_3022317_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001578615.1|3022368_3023187_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.1	6.1e-22
>prophage 224
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3033839	3035873	5054509	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001306372.1|3033839_3035873_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
>prophage 225
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3047716	3057159	5054509		Enterobacteria_phage(85.71%)	10	NA	NA
WP_025210665.1|3047716_3048853_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	5.5e-162
WP_025210666.1|3048849_3050850_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|3050974_3051436_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3051477_3051948_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001308766.1|3051994_3052714_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|3052710_3054396_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|3054617_3055349_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|3055408_3055516_+	protein YohO	NA	NA	NA	NA	NA
WP_000783144.1|3055496_3056228_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001600159.1|3056232_3057159_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
>prophage 226
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3083366	3084887	5054509		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255032.1|3083366_3084887_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 227
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3088581	3092355	5054509		Cellulophaga_phage(50.0%)	3	NA	NA
WP_025210676.1|3088581_3089250_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	1.5e-55
WP_025210677.1|3089507_3090344_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489252.1|3090375_3092355_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	1.9e-13
>prophage 228
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3096424	3097282	5054509		Catovirus(100.0%)	1	NA	NA
WP_024230056.1|3096424_3097282_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	35.0	4.0e-24
>prophage 229
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3111776	3116077	5054509		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_025210684.1|3111776_3113243_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	30.0	3.0e-43
WP_000198818.1|3113360_3114347_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000594599.1|3114385_3115099_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|3115510_3116077_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 230
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3121831	3129480	5054509		Vibrio_phage(50.0%)	7	NA	NA
WP_000194914.1|3121831_3123421_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_000202798.1|3123424_3123769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213385.1|3124101_3125292_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_025210688.1|3125319_3126015_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_001544736.1|3126164_3127925_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	2.4e-100
WP_000494186.1|3128049_3128334_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|3128472_3129480_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 231
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3141177	3141795	5054509		Bacillus_virus(100.0%)	1	NA	NA
WP_025210690.1|3141177_3141795_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.3	2.5e-12
>prophage 232
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3150561	3156342	5054509		Bacillus_phage(25.0%)	5	NA	NA
WP_000422197.1|3150561_3152205_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.2	7.2e-14
WP_000884972.1|3152280_3152931_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_025210692.1|3152930_3153995_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	39.1	1.8e-18
WP_025210693.1|3154068_3155124_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865595.1|3155235_3156342_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.1	2.8e-118
>prophage 233
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3160504	3165347	5054509		Hokovirus(50.0%)	2	NA	NA
WP_025210694.1|3160504_3163354_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.1e-41
WP_025210695.1|3163520_3165347_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	26.9	4.4e-20
>prophage 234
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3180270	3193612	5054509	transposase	Pseudomonas_phage(33.33%)	7	NA	NA
WP_001281242.1|3180270_3182898_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990771.1|3183044_3183767_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_106361772.1|3183921_3185269_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
WP_025234924.1|3185342_3189101_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	26.4	1.0e-18
WP_001075170.1|3189796_3192082_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332037.1|3192227_3193358_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000101256.1|3193357_3193612_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	63.1	1.5e-24
>prophage 235
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3196657	3197734	5054509		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001590411.1|3196657_3197734_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.9e-08
>prophage 236
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3203626	3208268	5054509	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_001561721.1|3203626_3204622_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.2	5.3e-68
WP_001561722.1|3204634_3204856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992991.1|3204896_3205700_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001551379.1|3205716_3207006_-	MFS transporter	NA	NA	NA	NA	NA
WP_001551380.1|3207062_3208268_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	2.7e-26
>prophage 237
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3211871	3216875	5054509		Tupanvirus(50.0%)	4	NA	NA
WP_001306469.1|3211871_3212474_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_025210701.1|3212781_3213921_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L0G1	Tupanvirus	30.4	2.2e-30
WP_000461642.1|3213924_3214893_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	4.0e-36
WP_025210702.1|3214892_3216875_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	2.4e-19
>prophage 238
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3251705	3254933	5054509		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|3251705_3252305_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012889.1|3252363_3254196_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203403.1|3254282_3254933_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	27.5	2.8e-09
>prophage 239
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3265492	3267364	5054509		Sodalis_phage(50.0%)	2	NA	NA
WP_001578709.1|3265492_3266395_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.2	1.8e-67
WP_001293607.1|3266590_3267364_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	27.7	4.8e-08
>prophage 240
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3271575	3273093	5054509		Mollivirus(100.0%)	1	NA	NA
WP_000334221.1|3271575_3273093_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	4.5e-87
>prophage 241
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3279557	3280694	5054509		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_025210714.1|3279557_3280694_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	2.6e-23
>prophage 242
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3289165	3293423	5054509	transposase	Pandoravirus(50.0%)	4	NA	NA
WP_001297933.1|3289165_3290251_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001306448.1|3290285_3291218_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000727295.1|3291383_3291935_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_110093301.1|3292074_3293423_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 243
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3309752	3322866	5054509	integrase,transposase	Enterobacteria_phage(42.86%)	10	3310806:3310821	3318220:3318235
WP_000368131.1|3309752_3310685_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
3310806:3310821	attL	TTGCAGGTTCGATTCC	NA	NA	NA	NA
WP_025210722.1|3310996_3312154_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	98.2	2.5e-218
WP_158413073.1|3312270_3314190_+	acyltransferase family protein	NA	A0A193GZ69	Enterobacter_phage	33.4	8.3e-86
WP_086936919.1|3316538_3317707_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.5e-183
WP_001281192.1|3317785_3318130_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	100.0	5.3e-60
WP_001163428.1|3318254_3318455_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3318220:3318235	attR	TTGCAGGTTCGATTCC	NA	NA	NA	NA
WP_001316510.1|3318752_3318905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001197021.1|3318984_3320232_-	MFS transporter	NA	NA	NA	NA	NA
WP_001578725.1|3320293_3321217_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_025210725.1|3321432_3322866_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	1.2e-28
>prophage 244
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3329520	3337096	5054509		Bacillus_phage(50.0%)	4	NA	NA
WP_025210729.1|3329520_3333114_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	6.2e-10
WP_001314918.1|3333169_3334315_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|3334388_3335333_-	transporter YfdV	NA	NA	NA	NA	NA
WP_025210730.1|3335401_3337096_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.8	8.0e-24
>prophage 245
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3340787	3341708	5054509		Morganella_phage(100.0%)	1	NA	NA
WP_000484395.1|3340787_3341708_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	6.4e-76
>prophage 246
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3345526	3346261	5054509		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|3345526_3346261_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 247
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3371952	3387334	5054509		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443685.1|3371952_3373968_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.0e-150
WP_001578745.1|3374038_3375037_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|3375266_3376028_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|3376212_3377184_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|3377567_3377825_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|3377869_3379597_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|3379637_3380147_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096672.1|3380188_3381040_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719960.1|3381144_3381513_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001306253.1|3381515_3382427_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	2.9e-57
WP_000021036.1|3382560_3383658_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|3383647_3384523_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|3384522_3385356_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290223.1|3385355_3386372_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517443.1|3386542_3387334_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	6.8e-18
>prophage 248
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3390812	3395747	5054509		Mycobacterium_phage(33.33%)	6	NA	NA
WP_024230548.1|3390812_3392114_+	penicillin binding protein PBP4B	NA	A0A2K9VHZ2	Mycobacterium_phage	23.2	1.9e-09
WP_000084590.1|3392171_3393071_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|3393166_3393742_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001296281.1|3393802_3394252_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|3394238_3394664_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102892.1|3394877_3395747_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
>prophage 249
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3414354	3415305	5054509		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|3414354_3415305_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 250
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3428718	3430066	5054509	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_110093301.1|3428718_3430066_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 251
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3433992	3434706	5054509		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|3433992_3434706_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 252
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3455974	3459976	5054509		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|3455974_3457264_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|3457349_3457976_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001445866.1|3458300_3459338_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
WP_001028621.1|3459337_3459976_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.9	9.0e-29
>prophage 253
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3466223	3472712	5054509		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|3466223_3466376_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|3466393_3466585_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|3466895_3467414_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_025210744.1|3467429_3467969_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	88.3	4.1e-43
WP_000138282.1|3468061_3469639_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001296289.1|3469707_3471174_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_021551967.1|3471335_3472712_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	5.3e-42
>prophage 254
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3493180	3493612	5054509		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963841.1|3493180_3493612_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	4.8e-18
>prophage 255
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3503740	3510264	5054509		Mycoplasma_phage(20.0%)	8	NA	NA
WP_025210750.1|3503740_3505024_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	4.9e-34
WP_000523616.1|3505268_3505469_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124471.1|3505480_3505816_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_025210751.1|3505817_3507668_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384404.1|3507684_3508200_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|3508295_3508619_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|3508635_3509022_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|3509049_3510264_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 256
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3525400	3526912	5054509		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493495.1|3525400_3526912_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 257
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3532670	3543959	5054509		Bacillus_phage(50.0%)	7	NA	NA
WP_000919149.1|3532670_3533924_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	1.0e-100
WP_001521077.1|3534251_3535442_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3535486_3535825_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|3535885_3537220_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_025210760.1|3537209_3537923_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_025210761.1|3538087_3539515_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_025210762.1|3540071_3543959_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	1.0e-130
>prophage 258
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3548078	3548339	5054509		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196282.1|3548078_3548339_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	50.0	2.5e-17
>prophage 259
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3551799	3555542	5054509		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|3551799_3552480_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|3552752_3553727_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3553742_3555542_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 260
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3561313	3567395	5054509	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|3561313_3562648_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_025210767.1|3562680_3563562_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189223.1|3563664_3564252_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|3564306_3564690_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262721.1|3564994_3565684_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_025210768.1|3565731_3566769_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3566975_3567395_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 261
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3572688	3575644	5054509	transposase	Burkholderia_virus(50.0%)	2	NA	NA
WP_000841106.1|3572688_3573987_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	2.8e-45
WP_110093301.1|3574295_3575644_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
>prophage 262
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3583438	3586012	5054509		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3583438_3586012_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 263
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3591918	3592989	5054509		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168045.1|3591918_3592989_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 264
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3606735	3618146	5054509	integrase	Enterobacteria_phage(70.0%)	12	3602492:3602505	3609840:3609853
3602492:3602505	attL	CATGATAATTTCTT	NA	NA	NA	NA
WP_000162574.1|3606735_3607218_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000124726.1|3607979_3609188_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	6.6e-105
WP_001183326.1|3609191_3611150_+	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	31.1	8.8e-67
3609840:3609853	attR	CATGATAATTTCTT	NA	NA	NA	NA
WP_025210772.1|3611367_3611940_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_000638629.1|3612013_3612514_-	transactivation protein	NA	NA	NA	NA	NA
WP_001283029.1|3612510_3613245_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	1.0e-129
WP_001149160.1|3613796_3614063_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_038430326.1|3614059_3614614_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_001244665.1|3614606_3614894_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_025210773.1|3614886_3615342_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	97.3	1.0e-63
WP_000856729.1|3615477_3615798_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_025210774.1|3615812_3618146_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	98.8	0.0e+00
>prophage 265
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3623721	3623940	5054509		Salmonella_phage(100.0%)	1	NA	NA
WP_071528172.1|3623721_3623940_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	72.0	5.4e-10
>prophage 266
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3633503	3637555	5054509		Klosneuvirus(50.0%)	4	NA	NA
WP_025210777.1|3633503_3634784_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.4e-33
WP_001295173.1|3635021_3636422_+	GABA permease	NA	NA	NA	NA	NA
WP_000156814.1|3636442_3637105_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|3637105_3637555_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 267
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3643361	3648659	5054509		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|3643361_3643607_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080954.1|3643603_3644005_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.6e-18
WP_025210779.1|3643986_3646131_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	3.8e-196
WP_025210780.1|3646140_3647100_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	3.5e-133
WP_000985494.1|3647456_3648659_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 268
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3661731	3667117	5054509	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3661731_3661917_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047170.1|3662151_3664782_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_024229839.1|3664909_3665410_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3665478_3666540_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|3666619_3667117_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 269
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3672584	3673550	5054509		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|3672584_3673550_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 270
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3680963	3681977	5054509		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001521133.1|3680963_3681977_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	1.3e-26
>prophage 271
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3700840	3711423	5054509		uncultured_Mediterranean_phage(33.33%)	11	NA	NA
WP_001272887.1|3700840_3703402_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	4.6e-31
WP_025210791.1|3703577_3703988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210792.1|3704069_3704726_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	3.9e-51
WP_000562980.1|3704766_3705003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000863188.1|3705013_3706441_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_000767723.1|3706440_3707034_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_001208077.1|3707180_3707588_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000081550.1|3707707_3708700_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3708762_3709902_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3710041_3710668_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3710661_3711423_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 272
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3714535	3716568	5054509		Tupanvirus(50.0%)	2	NA	NA
WP_025210794.1|3714535_3715141_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	1.2e-27
WP_025210795.1|3715140_3716568_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
>prophage 273
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3740236	3741022	5054509		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021318.1|3740236_3741022_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	8.5e-21
>prophage 274
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3745371	3750291	5054509		Vibrio_phage(33.33%)	4	NA	NA
WP_001199976.1|3745371_3746043_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.3e-14
WP_025210805.1|3746335_3747208_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|3747267_3748566_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|3748653_3750291_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 275
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3753687	3757802	5054509		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046786.1|3753687_3754989_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	6.7e-39
WP_000186450.1|3755045_3757802_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 276
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3765344	3766193	5054509		Vibrio_phage(100.0%)	1	NA	NA
WP_025210809.1|3765344_3766193_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	2.1e-41
>prophage 277
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3770960	3771806	5054509		Bacillus_phage(100.0%)	1	NA	NA
WP_023308259.1|3770960_3771806_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.6e-10
>prophage 278
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3783382	3798767	5054509	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_025210812.1|3783382_3784588_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.0e-73
WP_000184256.1|3784587_3785031_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117726.1|3785081_3785888_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.9	1.7e-16
WP_000678646.1|3785963_3787061_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|3787639_3788893_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|3789124_3790456_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_001600422.1|3790517_3792344_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	5.9e-25
WP_025210813.1|3792343_3795886_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.8	2.0e-08
WP_025210814.1|3795878_3798767_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	6.9e-68
>prophage 279
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3804244	3811017	5054509		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|3804244_3805039_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|3805045_3805921_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957911.1|3806071_3808318_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|3808330_3808861_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|3809545_3810235_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|3810303_3811017_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 280
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3820648	3823143	5054509		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|3820648_3822067_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603518.1|3822381_3823143_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 281
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3854951	3855704	5054509		Clostridium_phage(100.0%)	1	NA	NA
WP_001309712.1|3854951_3855704_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 282
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3879984	3895376	5054509	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280192.1|3879984_3881385_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001469293.1|3881402_3882719_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|3882754_3884122_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_025210836.1|3884157_3884646_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001564003.1|3884645_3886565_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|3887000_3888449_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001050745.1|3888450_3888576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|3888572_3888644_-	protein YqfH	NA	NA	NA	NA	NA
WP_025210837.1|3888698_3889247_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003071.1|3889289_3890807_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|3890816_3891915_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813215.1|3892005_3893739_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_025210838.1|3893744_3894455_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|3894479_3895376_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 283
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3899181	3903654	5054509		Pandoravirus(50.0%)	2	NA	NA
WP_025210839.1|3899181_3900615_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.1	3.3e-31
WP_000195042.1|3900780_3903654_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	2.8e-263
>prophage 284
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3911791	3913024	5054509		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3911791_3913024_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 285
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3934110	3935019	5054509		Yersinia_phage(100.0%)	1	NA	NA
WP_025210847.1|3934110_3935019_+	prohibitin family protein	NA	A0A2C9D0H9	Yersinia_phage	56.1	1.2e-53
>prophage 286
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3938164	3939512	5054509	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_106361772.1|3938164_3939512_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	5.1e-74
>prophage 287
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3944269	3945424	5054509		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3944269_3945424_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 288
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3972177	3973161	5054509		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001298261.1|3972177_3973161_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.4	1.4e-36
>prophage 289
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3981241	3981907	5054509		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_001554269.1|3981241_3981907_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.7	1.0e-06
>prophage 290
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	3985311	3986622	5054509		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_001554271.1|3985311_3986622_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	35.7	4.4e-06
>prophage 291
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4018395	4019568	5054509		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524987.1|4018395_4019568_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	31.0	7.2e-40
>prophage 292
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4041728	4042613	5054509		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|4041728_4042613_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 293
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4048456	4059279	5054509		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|4048456_4049284_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_025210873.1|4049483_4050410_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848523.1|4050460_4050718_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_025210874.1|4050759_4052979_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|4053089_4054502_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|4054576_4055314_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_025210875.1|4055547_4057806_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.9	2.0e-83
WP_000183492.1|4058351_4058834_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|4058886_4059279_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 294
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4067122	4083843	5054509	transposase	uncultured_Caudovirales_phage(14.29%)	13	NA	NA
WP_000986430.1|4067122_4068106_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	8.5e-10
WP_000940887.1|4068102_4068912_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.4e-13
WP_025210878.1|4069285_4071427_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000195296.1|4071490_4073383_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|4073411_4073993_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|4073992_4074820_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|4074844_4075267_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|4075267_4075897_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735289.1|4076101_4077583_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|4077730_4078402_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|4078407_4079568_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_025210879.1|4080052_4081849_+	aryl-sulfate sulfotransferase	NA	NA	NA	NA	NA
WP_085948682.1|4082474_4083843_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 295
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4092258	4092912	5054509		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001076993.1|4092258_4092912_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 296
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4096823	4098257	5054509		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|4096823_4098257_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 297
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4103394	4104633	5054509	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708490.1|4103394_4104633_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	7.7e-93
>prophage 298
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4110935	4127072	5054509	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264352.1|4110935_4111949_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|4112186_4112402_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|4112512_4114258_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|4114452_4116294_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_001590737.1|4116372_4116879_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065912.1|4117132_4117897_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018015.1|4118173_4118797_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094690.1|4118902_4120423_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_001603792.1|4120729_4122220_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.2	2.4e-32
WP_000450588.1|4122261_4122594_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212456.1|4122812_4123796_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_025210884.1|4123979_4127072_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.1	1.3e-157
>prophage 299
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4139663	4140629	5054509		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|4139663_4140629_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 300
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4153419	4153878	5054509	transposase	Saccharomonospora_phage(100.0%)	1	NA	NA
WP_000502112.1|4153419_4153878_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	1.0e-13
>prophage 301
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4162133	4164428	5054509		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|4162133_4164428_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 302
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4172412	4173558	5054509		Streptococcus_phage(100.0%)	1	NA	NA
WP_001330125.1|4172412_4173558_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	42.0	5.2e-51
>prophage 303
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4191180	4198985	5054509		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809263.1|4191180_4192044_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.6e-50
WP_025210894.1|4192108_4194145_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246828.1|4194102_4194498_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|4194517_4195108_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646047.1|4195117_4195693_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147607.1|4195814_4196855_-	permease	NA	NA	NA	NA	NA
WP_001309782.1|4196927_4197563_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|4197690_4198209_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449456.1|4198188_4198632_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189303.1|4198682_4198985_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
>prophage 304
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4204687	4206577	5054509		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|4204687_4206577_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 305
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4212053	4218692	5054509		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|4212053_4214726_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|4214750_4216238_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|4216265_4216718_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|4217348_4218692_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 306
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4222772	4225645	5054509	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|4222772_4223621_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|4223710_4225645_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 307
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4232273	4233752	5054509		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|4232273_4233245_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445407.1|4233473_4233752_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	3.4e-17
>prophage 308
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4237820	4252614	5054509		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|4237820_4238630_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922881.1|4238839_4239817_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|4239830_4240817_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030006.1|4240837_4241404_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.5	6.5e-55
WP_000030537.1|4241400_4241976_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|4241944_4242502_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|4242508_4243234_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|4243281_4244715_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|4244737_4245025_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|4245142_4245634_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|4245679_4246534_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|4246530_4246803_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620420.1|4247015_4247648_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047064.1|4247644_4248373_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|4248369_4249023_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|4249252_4251589_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|4251684_4252614_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 309
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4259363	4264111	5054509		Salmonella_phage(50.0%)	5	NA	NA
WP_001586299.1|4259363_4260491_+	DUF1016 domain-containing protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_025210898.1|4260550_4261015_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209038.1|4261011_4261887_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_001306034.1|4261883_4262573_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_025210899.1|4262620_4264111_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	3.7e-09
>prophage 310
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4267816	4268314	5054509	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366126.1|4267816_4268314_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	2.5e-26
>prophage 311
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4272279	4274804	5054509	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001316675.1|4272279_4273647_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	1.3e-21
WP_000497723.1|4273736_4274804_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 312
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4291300	4292344	5054509		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|4291300_4292344_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 313
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4302908	4303793	5054509		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258945.1|4302908_4303793_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	29.8	1.6e-23
>prophage 314
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4310297	4314451	5054509		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738584.1|4310297_4311323_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	4.0e-71
WP_001445827.1|4311390_4312572_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001308990.1|4312581_4313685_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078344.1|4313692_4314451_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 315
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4324955	4326427	5054509	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114986.1|4324955_4325465_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	1.1e-18
WP_001579065.1|4325479_4326427_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 316
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4346304	4351878	5054509		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000031783.1|4346304_4347489_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124703.1|4347559_4349674_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.7	1.1e-57
WP_001138043.1|4349770_4350241_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|4350337_4350712_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|4350837_4351125_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|4351132_4351492_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_025210906.1|4351491_4351878_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	7.4e-18
>prophage 317
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4357448	4366994	5054509		Tupanvirus(25.0%)	9	NA	NA
WP_001551739.1|4357448_4359368_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	3.3e-74
WP_001551740.1|4359367_4360390_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|4360383_4360602_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|4360655_4361525_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|4361579_4361984_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|4362285_4362918_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|4362968_4365059_+	membrane protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_001551741.1|4365121_4366345_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601862.1|4366430_4366994_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	2.3e-60
>prophage 318
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4385899	4386736	5054509		Vibrio_phage(100.0%)	1	NA	NA
WP_000742141.1|4385899_4386736_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	2.9e-67
>prophage 319
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4403642	4407411	5054509		Bacillus_phage(66.67%)	4	NA	NA
WP_001590822.1|4403642_4405265_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.3	1.5e-141
WP_001253707.1|4405341_4406694_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	4.7e-11
WP_001650895.1|4406690_4406957_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_144318952.1|4406985_4407411_-	response regulator	NA	W8CYM9	Bacillus_phage	38.5	4.3e-19
>prophage 320
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4413976	4414870	5054509		Sodalis_phage(100.0%)	1	NA	NA
WP_000039100.1|4413976_4414870_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.5e-69
>prophage 321
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4421030	4423424	5054509		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_025210923.1|4421030_4423424_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 322
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4427814	4429041	5054509		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105466.1|4427814_4429041_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	1.5e-133
>prophage 323
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4442662	4445110	5054509		Dickeya_phage(100.0%)	1	NA	NA
WP_000993442.1|4442662_4445110_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 324
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4465120	4466931	5054509		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073586.1|4465120_4465864_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	9.9e-11
WP_025210935.1|4465860_4466931_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 325
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4470473	4471956	5054509		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|4470473_4471187_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_025210936.1|4471188_4471956_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	1.1e-12
>prophage 326
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4477691	4480510	5054509		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4477691_4478546_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_025210939.1|4478790_4479849_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|4479841_4480510_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 327
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4483516	4487648	5054509		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|4483516_4484143_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_025210941.1|4484216_4486415_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.4	5.5e-118
WP_000130615.1|4486516_4486762_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|4486982_4487648_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 328
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4495540	4501143	5054509		Bacillus_virus(50.0%)	3	NA	NA
WP_025210944.1|4495540_4496347_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	5.9e-17
WP_001190062.1|4496351_4496753_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_025210945.1|4496955_4501143_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	43.8	7.5e-23
>prophage 329
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4505084	4511314	5054509		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_001551788.1|4505084_4505744_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	37.8	1.1e-24
WP_000649530.1|4506057_4506537_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_001216257.1|4507454_4508579_-	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_001600636.1|4508578_4511314_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 330
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4524724	4526767	5054509		Indivirus(100.0%)	1	NA	NA
WP_001298719.1|4524724_4526767_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.1	6.8e-46
>prophage 331
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4530115	4532251	5054509		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_025210949.1|4530115_4530469_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	52.9	4.8e-24
WP_001590850.1|4530523_4531813_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	1.7e-172
WP_000065800.1|4531825_4532251_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.5e-51
>prophage 332
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4545318	4546788	5054509		Pithovirus(50.0%)	2	NA	NA
WP_001328193.1|4545318_4546089_+	heme ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	29.6	2.3e-18
WP_000123131.1|4546140_4546788_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	40.0	8.0e-17
>prophage 333
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4593204	4595189	5054509		Bacillus_virus(50.0%)	2	NA	NA
WP_000103574.1|4593204_4594209_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196487.1|4594205_4595189_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 334
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4605130	4607464	5054509		Escherichia_phage(100.0%)	1	NA	NA
WP_025210962.1|4605130_4607464_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	7.0e-71
>prophage 335
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4611118	4613535	5054509	transposase	Morganella_phage(50.0%)	4	NA	NA
WP_000014594.1|4611118_4611331_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_071847130.1|4611384_4611756_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_025210964.1|4611911_4612064_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085948682.1|4612165_4613535_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 336
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4617401	4618397	5054509		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_025210967.1|4617401_4618397_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.2	7.0e-12
>prophage 337
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4623713	4625255	5054509		Staphylococcus_phage(100.0%)	1	NA	NA
WP_025210969.1|4623713_4625255_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	1.1e-16
>prophage 338
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4646727	4655192	5054509		Acinetobacter_phage(40.0%)	7	NA	NA
WP_000499746.1|4646727_4647138_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.0	1.1e-19
WP_000833473.1|4647154_4647340_-	addiction module toxin, HicA family	NA	A0A0D4DC32	Acinetobacter_phage	54.2	4.4e-13
WP_032140338.1|4647820_4648894_+	restriction endonuclease or methylase	NA	A0A1S5SAB0	Streptococcus_phage	40.7	2.1e-62
WP_025210980.1|4648934_4650473_-	aldehyde dehydrogenase AldB	NA	NA	NA	NA	NA
WP_025210981.1|4650580_4651876_-	Fic family protein	NA	A0A1V0E025	Clostridioides_phage	30.9	1.4e-20
WP_000741502.1|4652006_4653158_-	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_000582429.1|4653347_4655192_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.2	1.9e-15
>prophage 339
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4683763	4693270	5054509		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|4683763_4684015_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4684156_4684588_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|4684832_4686377_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214156.1|4686386_4687670_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_025210985.1|4687673_4688633_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_025210986.1|4688619_4689654_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|4689892_4690918_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|4690927_4692124_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|4692337_4693270_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 340
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4696624	4698458	5054509		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_001052917.1|4696624_4697398_-	glycosyltransferase family 25 protein	NA	A0A0P0YNC5	Yellowstone_lake_phycodnavirus	33.7	7.6e-06
WP_025210989.1|4697429_4698458_-	galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.6e-11
>prophage 341
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4705896	4710459	5054509		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|4705896_4706376_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_025210992.1|4706414_4707224_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	30.9	2.2e-24
WP_001051798.1|4707321_4707489_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4707509_4707746_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001297375.1|4707962_4708631_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_000050171.1|4708802_4710023_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.0e-44
WP_000976070.1|4710000_4710459_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 342
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4713832	4720583	5054509		Morganella_phage(25.0%)	6	NA	NA
WP_001297374.1|4713832_4714657_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	77.0	6.3e-91
WP_000924289.1|4714948_4715566_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_000870052.1|4715562_4717245_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	2.5e-22
WP_001295237.1|4717502_4718126_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4718180_4718456_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|4718474_4720583_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 343
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4725704	4727096	5054509		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|4725704_4727096_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 344
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4733238	4743261	5054509	integrase	Enterobacteria_phage(88.89%)	11	4728454:4728467	4743191:4743204
4728454:4728467	attL	CCAACCTGACGCTG	NA	NA	NA	NA
WP_001218969.1|4733238_4734411_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.2	3.6e-209
WP_000022311.1|4734463_4736149_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	54.2	5.1e-180
WP_000446147.1|4736436_4737009_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_000638628.1|4737082_4737583_-	transactivation protein	NA	NA	NA	NA	NA
WP_025210993.1|4737579_4738314_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	2.0e-128
WP_001149160.1|4738866_4739133_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_025210994.1|4739129_4739729_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	81.0	2.5e-49
WP_001244665.1|4739721_4740009_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459294.1|4740001_4740457_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_000856729.1|4740592_4740913_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000783658.1|4740927_4743261_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
4743191:4743204	attR	CCAACCTGACGCTG	NA	NA	NA	NA
>prophage 345
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4749894	4751229	5054509		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|4749894_4751229_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 346
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4761920	4770397	5054509		Micromonas_sp._RCC1109_virus(25.0%)	9	NA	NA
WP_025210995.1|4761920_4763609_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.6	1.2e-56
WP_001300753.1|4763714_4763813_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|4764377_4764467_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_025210996.1|4764746_4765931_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	4.0e-14
WP_000148043.1|4765938_4766436_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113437.1|4766432_4766795_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4766784_4767132_-	YidH family protein	NA	NA	NA	NA	NA
WP_025210997.1|4767191_4768685_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.7	6.6e-30
WP_001521693.1|4768681_4770397_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	4.3e-41
>prophage 347
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4777257	4778211	5054509		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|4777257_4777686_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4777797_4778211_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 348
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4782638	4783787	5054509		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705012.1|4782638_4783787_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	2.7e-52
>prophage 349
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4788491	4795860	5054509		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|4788491_4790906_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|4790934_4792008_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4792007_4793108_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|4793112_4794516_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_122134670.1|4794812_4794893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000831330.1|4795122_4795263_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4795279_4795639_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4795602_4795860_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 350
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4808525	4809863	5054509		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|4808525_4809863_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 351
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4818639	4822481	5054509		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|4818639_4819413_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|4819503_4820394_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|4820393_4821353_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867161.1|4821440_4822481_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 352
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4828015	4831377	5054509		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_025211009.1|4828015_4829845_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	8.6e-133
WP_025211010.1|4830006_4831377_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 353
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4843329	4844322	5054509		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845128.1|4843329_4844322_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	5.8e-51
>prophage 354
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4847490	4853343	5054509		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_025211011.1|4847490_4849359_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001318146.1|4849525_4849945_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_025211012.1|4849952_4851458_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	26.7	1.7e-14
WP_000211858.1|4851462_4852428_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|4852452_4853343_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 355
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4866733	4868380	5054509		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012630.1|4866733_4868380_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	32.2	6.7e-68
>prophage 356
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4876708	4891103	5054509	transposase	Bacillus_phage(14.29%)	13	NA	NA
WP_001238886.1|4876708_4878730_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001366744.1|4878776_4880261_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|4880396_4881662_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|4881792_4882122_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_001295255.1|4882262_4882364_+	rho operon leader peptide rhoL	NA	NA	NA	NA	NA
WP_001054527.1|4882448_4883708_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_025210499.1|4883897_4884356_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	5.0e-13
WP_001050960.1|4884646_4885750_+	UDP-N-acetylglucosamine--undecaprenyl-phosphate N-acetylglucosaminephosphotransferase	NA	NA	NA	NA	NA
WP_001295256.1|4885761_4886808_+	ECA polysaccharide chain length modulation protein	NA	NA	NA	NA	NA
WP_025211014.1|4886863_4887994_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.0e-27
WP_025211015.1|4887990_4889253_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	2.3e-23
WP_025211016.1|4889293_4889968_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_025211017.1|4889972_4891103_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.6e-18
>prophage 357
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4899112	4900768	5054509		Tetraselmis_virus(100.0%)	1	NA	NA
WP_025211018.1|4899112_4900768_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	1.8e-44
>prophage 358
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4911074	4914933	5054509		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|4911074_4911971_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|4911970_4912687_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383407.1|4912770_4914933_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 359
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4922302	4924132	5054509		Catovirus(100.0%)	1	NA	NA
WP_024177878.1|4922302_4924132_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 360
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4938889	4942176	5054509		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187543.1|4938889_4940530_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	4.8e-42
WP_001295260.1|4940608_4940878_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4940881_4941397_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4941399_4942176_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 361
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4950964	4951579	5054509		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|4950964_4951579_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 362
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4966245	4966824	5054509		Escherichia_phage(100.0%)	1	NA	NA
WP_051529560.1|4966245_4966824_+	hypothetical protein	NA	A0A2L1IV13	Escherichia_phage	38.8	4.5e-11
>prophage 363
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4975492	4981969	5054509	plate,tail	Escherichia_phage(75.0%)	9	NA	NA
WP_025210648.1|4975492_4976128_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	1.4e-111
WP_025210647.1|4976124_4976472_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	5.0e-58
WP_016236406.1|4977376_4977988_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.4e-116
WP_025210645.1|4977984_4979184_+|tail	tail protein	tail	A0A0F7LBW5	Escherichia_phage	97.0	2.0e-215
WP_001008234.1|4979204_4979648_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_025210644.1|4979619_4980222_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	3.5e-99
WP_024191231.1|4980221_4980716_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	60.4	3.7e-46
WP_025210643.1|4980859_4981177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025210642.1|4981375_4981969_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	8.7e-103
>prophage 364
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4985707	4986865	5054509	integrase	Ralstonia_phage(100.0%)	1	4971795:4971854	4992726:4993456
4971795:4971854	attL	TTCACCGGCCATGCTTCGCCTCCTGTGCATTTGCATCCTCAAACGGCACGATGTCATTGG	NA	NA	NA	NA
WP_025211037.1|4985707_4986865_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	40.1	1.7e-41
WP_025211037.1|4985707_4986865_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	40.1	1.7e-41
4992726:4993456	attR	TTCACCGGCCATGCTTCGCCTCCTGTGCATTTGCATCCTCAAACGGCACGATGTCATTGGCCATAAACGGGTCCACCCGTCCGGCCAGCACATGATGCCGGGCATGCTGACTCAGGCTGATTCCACCCTGACGCAGCCACAGCGTGCGTGCCGCATCCTCGCCTTCATCGTGGTAGGTGCGGAGGATTTCCGGACTGGTTTTCATCACTTCCGCTGCCACCGTCCGGCCTTTCAGACCGTGACTGGTTGCGGTGCCCATCACCGGACGGATGCATTCACTGCACCCGTCAGGATTGCGGAAACGCAGGGCTTCCTGCTGCTGTGGCGTGAACCAGCGGTCCGTGAACTGCTGTTGCTCCGGTGTCAGGGCGGCCTCTTCGCGTGTCCGTGCGCAGTGCGGACAGAGTGTCGGCAGCAGACGCTGGGCAATCAGCCCCTGAAACAGACGGCTGCTGCGCAGGAAGCCCTGCGGCACGCCGATGATTTGCAGGCGGTTGAGATTTCCCAGCGGACTGTTGGCGTGTTGTGTGGTCAGCACGATGTGACCGGATTCGGCAAAGTTGATGGCGGCCATGGCGGAGTCATGGTCGCGGATTTCACCGATATAGACCGCATCCGGGTCCAGACGGAGTATGGCACGACGACCACGCAGCCAGGCGAGGTTGATGTCCTCCTCGCTGGAGCGGTCGGCGGTCACCGAGGTGTGGATGGCCCCTTCGACTTCCCCCTCC	NA	NA	NA	NA
>prophage 365
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	4999788	5006493	5054509	integrase	Ralstonia_phage(66.67%)	5	4986920:4986979	5016773:5017434
4986920:4986979	attL	GTGCCAATCCGGTATCTGGTCGAATAACCAGAAGAAAGAACGTTTCACCGTGTATGGAGG	NA	NA	NA	NA
WP_025211032.1|4999788_5000289_-	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	36.6	7.3e-10
WP_025211033.1|5000336_5000939_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_025211041.1|5000963_5002028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071849754.1|5002442_5002994_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	39.8	2.3e-12
WP_025211037.1|5005335_5006493_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	40.1	1.7e-41
5016773:5017434	attR	GTGCCAATCCGGTATCTGGTCGAATAACCAGAAGAAAGAACGTTTCACCGTGTATGGAGGTAACGGATGCTGGCAGACCTGGTCCTATGCAGTGTGTCCGAGTGGTAGCACTCTGGTATCTGGAGGATACCGATTGTCACGGTGGGTGGATGACGGCTACAACTCGCCGGACGGGAGTTACCCTGATTATGCCAACAATCGTTGGATTGCCACCGGTTCAGGTTCTCTGAGCTGCTTCCAGGCTGTCGCAATCTGCGAGAAGTGACACCGGGCGCTACTGATACTGCAACATCGAGAAAGTGCCGTAGTCACAGCCGTAGTTCACCATTCCGGCAGATGTGACAGAAAATGCCGAACCAGCGGGAACATCGAAAACGATATTCCCTGACTTTCCCCAGTTTGAATTGTTGTCAGTAGAATTAGCAACTACCTGTCCGCCAACAGTAGCCACCAGGGAAAAGGTATTAACACAGTTGTCTGCATCTCCTGCGTCAATTGTTCTGTAGGGCGGATTCCCGCCGCGCGCGTAAATTTTCATCGTTTTCCCGGTTGTGTTGCTGCCGTTGTAAGTGCCTTTGAAAGCCCCCAAAGAGGTGTAAACGCCGTCAGCAACAGGGGAACGCCAGGCACCGGGTTGGCACGGAGGCCAGTGCCAATCCGGT	NA	NA	NA	NA
>prophage 366
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	5011986	5012565	5054509		Escherichia_phage(100.0%)	1	NA	NA
WP_158413074.1|5011986_5012565_-	lipopolysaccharide core heptose(II)-phosphate phosphatase	NA	A0A2L1IV13	Escherichia_phage	39.8	2.4e-12
>prophage 367
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	5024852	5027378	5054509		Enterobacteria_phage(100.0%)	1	NA	NA
WP_071849756.1|5024852_5027378_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.8e-126
>prophage 368
NZ_CP007392	Escherichia coli strain ST2747 chromosome, complete genome	5054509	5046341	5046842	5054509		Ralstonia_phage(100.0%)	1	NA	NA
WP_025211032.1|5046341_5046842_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	36.6	7.3e-10
