The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007391	Escherichia coli strain ST540 chromosome, complete genome	4875682	105322	114893	4875682	integrase,protease	Enterobacteria_phage(58.33%)	14	105654:105670	120745:120761
WP_158412998.1|105322_105757_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	47.6	3.1e-33
105654:105670	attL	AATCGAAAGAAACATCT	NA	NA	NA	NA
WP_025297219.1|105758_106355_+	hypothetical protein	NA	A0A2H4N7C5	Pectobacterium_phage	32.8	1.3e-16
WP_148295597.1|106318_106561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113706302.1|108660_109542_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.0	8.0e-161
WP_038427594.1|109710_109929_-	excisionase	NA	Q77WA4	Escherichia_phage	98.6	1.1e-34
WP_038427596.1|109968_110136_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	96.4	1.8e-26
WP_025269788.1|110294_110573_-	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	7.1e-47
WP_025297252.1|110572_111112_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	52.6	2.9e-60
WP_025269785.1|111413_111650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113706303.1|112273_112555_-	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	54.8	5.3e-18
WP_025297222.1|113143_113662_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	86.0	5.5e-61
WP_025269781.1|113662_114370_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	2.2e-137
WP_001243355.1|114624_114777_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|114761_114893_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
120745:120761	attR	AGATGTTTCTTTCGATT	NA	NA	NA	NA
>prophage 2
NZ_CP007391	Escherichia coli strain ST540 chromosome, complete genome	4875682	1129660	1142843	4875682		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1129660_1130422_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1130415_1131042_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1131181_1132321_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1132383_1133376_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1133469_1134834_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1134922_1135699_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_025269898.1|1135703_1136342_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.2e-81
WP_000590403.1|1136338_1137601_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1137597_1138506_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272547.1|1138671_1139469_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141322.1|1139519_1140176_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272898.1|1140281_1142843_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 3
NZ_CP007391	Escherichia coli strain ST540 chromosome, complete genome	4875682	1502031	1546807	4875682	integrase,terminase,holin	Salmonella_phage(29.63%)	67	1530887:1530902	1550512:1550527
WP_023301637.1|1502031_1502232_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	86.4	3.7e-29
WP_025269984.1|1502228_1502465_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.0	1.0e-06
WP_025269983.1|1502461_1502653_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_025269982.1|1502649_1503186_-	hypothetical protein	NA	J9Q748	Salmonella_phage	72.6	6.1e-71
WP_025269981.1|1503399_1503927_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	8.4e-57
WP_025269980.1|1503955_1504579_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	3.1e-58
WP_025269979.1|1504575_1505322_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	64.7	2.4e-65
WP_016529276.1|1505338_1505623_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_025269978.1|1505630_1506602_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.9	7.2e-38
WP_019704100.1|1506689_1506884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161953880.1|1506876_1507002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725100.1|1507312_1507516_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.2e-19
WP_025269976.1|1507555_1508473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025269975.1|1508469_1509057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025269974.1|1509367_1510078_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	71.4	3.7e-92
WP_001548452.1|1510182_1510374_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
WP_001548453.1|1510453_1510675_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_025269973.1|1510760_1511615_+	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	1.7e-62
WP_004141710.1|1511599_1512469_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.7	8.9e-96
WP_012542626.1|1512465_1512759_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_025269969.1|1513947_1514418_+	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	35.5	1.3e-19
WP_025269967.1|1514644_1514842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269966.1|1514878_1515061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269965.1|1515057_1515321_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.7	3.2e-25
WP_025269964.1|1515339_1515600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805077.1|1515835_1516303_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	5.7e-33
WP_038427665.1|1516283_1516454_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	71.4	2.2e-14
WP_025269963.1|1516446_1517028_+	hypothetical protein	NA	E7C9S3	Salmonella_phage	49.3	7.1e-41
WP_038427667.1|1517024_1517165_+	YlcG family protein	NA	NA	NA	NA	NA
WP_025269962.1|1517161_1517662_+	antiterminator	NA	G8C7V7	Escherichia_phage	90.9	9.7e-87
WP_012542609.1|1518117_1518387_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_025269961.1|1518364_1518862_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.8	9.6e-79
WP_025269960.1|1518858_1519248_+	hypothetical protein	NA	Q8SBD9	Shigella_phage	47.6	1.3e-22
WP_004218030.1|1519728_1520217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021312714.1|1520167_1521568_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_025269958.1|1521805_1523257_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	5.5e-191
WP_025269957.1|1523312_1523861_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.9e-49
WP_025269956.1|1523912_1525115_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	55.1	8.0e-111
WP_025269955.1|1525118_1525613_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.4	1.4e-50
WP_025269954.1|1525624_1526563_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	76.9	7.8e-138
WP_000725700.1|1526602_1526884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269953.1|1526852_1527272_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	62.2	8.8e-41
WP_025269952.1|1527268_1527775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009652660.1|1527774_1528179_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
WP_025269951.1|1528171_1528723_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	1.5e-40
WP_025269950.1|1528724_1529876_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	2.1e-177
WP_025269949.1|1529886_1530327_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	2.1e-61
WP_025269948.1|1530330_1530750_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	64.4	4.4e-40
WP_025269947.1|1530791_1530944_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	82.0	3.2e-17
1530887:1530902	attL	CCTGAAAGCCGATAAC	NA	NA	NA	NA
WP_025269946.1|1530933_1532850_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	58.1	1.6e-198
WP_025269945.1|1532849_1533425_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.0	5.0e-63
WP_025269944.1|1533500_1533728_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	5.6e-18
WP_025269943.1|1533730_1534798_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	68.5	1.5e-137
WP_000734772.1|1534794_1535127_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	64.5	3.4e-19
WP_000506882.1|1535157_1535475_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000539208.1|1535562_1536294_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	72.8	4.7e-98
WP_025269942.1|1536293_1536647_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	2.3e-50
WP_025269941.1|1536646_1537843_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	6.6e-158
WP_025269940.1|1537839_1538613_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.1	6.3e-77
WP_025269939.1|1538612_1539482_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	63.6	6.9e-32
WP_016244718.1|1539481_1539679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427684.1|1541889_1542693_+	hypothetical protein	NA	A0A2H4N7C5	Pectobacterium_phage	35.8	4.9e-32
WP_025269936.1|1542798_1543038_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	49.4	2.8e-15
WP_025269935.1|1543037_1543355_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	4.0e-22
WP_025269934.1|1543366_1544398_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	37.9	3.3e-12
WP_025269933.1|1544402_1545563_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	2.9e-219
WP_000368117.1|1545874_1546807_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.3e-166
1550512:1550527	attR	GTTATCGGCTTTCAGG	NA	NA	NA	NA
>prophage 4
NZ_CP007391	Escherichia coli strain ST540 chromosome, complete genome	4875682	1780998	1790439	4875682		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569356.1|1780998_1781925_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1781929_1782661_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1782641_1782749_-	protein YohO	NA	NA	NA	NA	NA
WP_021570169.1|1782808_1783540_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	1.4e-110
WP_001295431.1|1783761_1785447_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1785443_1786163_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1786209_1786680_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1786719_1787181_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001774944.1|1787305_1789306_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001774943.1|1789302_1790439_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 5
NZ_CP007391	Escherichia coli strain ST540 chromosome, complete genome	4875682	2013477	2024463	4875682		Escherichia_phage(30.0%)	15	NA	NA
WP_000019588.1|2013477_2014221_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2014261_2014657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042337314.1|2014709_2015387_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.2	2.9e-62
WP_016529276.1|2016086_2016371_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_025269996.1|2016378_2017350_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.8	2.5e-38
WP_025269967.1|2017599_2017797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269966.1|2017833_2018016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269997.1|2018012_2018276_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.7	1.5e-25
WP_025269998.1|2018382_2018850_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	48.7	1.3e-37
WP_001548467.1|2018937_2019078_+	YlcG family protein	NA	NA	NA	NA	NA
WP_025269999.1|2019074_2019764_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	6.5e-57
WP_025270001.1|2020626_2021508_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	61.1	4.3e-29
WP_140414703.1|2021759_2023844_+	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	47.3	7.1e-107
WP_025270003.1|2023852_2024032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025270004.1|2024145_2024463_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	5.3e-22
>prophage 6
NZ_CP007391	Escherichia coli strain ST540 chromosome, complete genome	4875682	2318409	2345800	4875682	tail,integrase,lysis	Enterobacteria_phage(33.33%)	35	2313699:2313715	2335638:2335654
2313699:2313715	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000041681.1|2318409_2320836_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001300836.1|2321034_2321340_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2321447_2322158_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2322160_2322721_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2322755_2323097_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2323231_2323558_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001457992.1|2323763_2324978_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.8	1.5e-45
WP_000836066.1|2324989_2326009_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_021531328.1|2326066_2326177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2326196_2327477_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2327511_2327748_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048324.1|2327835_2330307_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|2330400_2330592_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2330588_2330777_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001047135.1|2331392_2332145_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2332422_2332512_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2332566_2332779_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2333079_2333295_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2334048_2334264_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189909.1|2334268_2334583_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	93.3	1.3e-49
WP_001092965.1|2334638_2335172_+	lysozyme	NA	Q08J98	Stx2-converting_phage	92.7	9.9e-98
WP_001071777.1|2335168_2335666_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2335638:2335654	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000066495.1|2336029_2336242_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|2336252_2336441_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2336587_2336743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2336915_2337089_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_020239410.1|2337384_2337591_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_032145128.1|2337841_2338036_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	1.6e-26
WP_000453617.1|2338424_2338970_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	6.8e-94
WP_001439069.1|2340368_2340944_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	5.5e-102
WP_000078178.1|2341041_2341632_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2341948_2342182_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2342250_2342364_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2342967_2344251_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527806.1|2344339_2345800_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
>prophage 7
NZ_CP007391	Escherichia coli strain ST540 chromosome, complete genome	4875682	3154924	3189484	4875682	protease,integrase,terminase,holin	Enterobacteria_phage(56.52%)	52	3162180:3162195	3198854:3198869
WP_025269766.1|3154924_3156742_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	40.4	4.4e-20
WP_021518667.1|3156865_3157438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013026.1|3157441_3157879_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	1.1e-25
WP_025269767.1|3157882_3159277_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.6	1.8e-69
WP_025269768.1|3159281_3160220_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.9	6.5e-52
WP_025269769.1|3160203_3160638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021518664.1|3160634_3161063_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.3	1.1e-22
WP_017898838.1|3161059_3161542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021518663.1|3161614_3162646_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	45.8	3.3e-73
3162180:3162195	attL	TCCGGCGGCAGGGTTT	NA	NA	NA	NA
WP_025269770.1|3162659_3163520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021518661.1|3163535_3165149_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_025269771.1|3165161_3165983_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.2	4.0e-53
WP_001001273.1|3165979_3167395_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	36.7	4.2e-87
WP_004884204.1|3167406_3168738_-|terminase	terminase-like family protein	terminase	A0A0U2JTW9	Escherichia_phage	59.7	3.5e-152
WP_025269772.1|3168741_3169482_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	35.1	2.0e-16
WP_139298491.1|3169580_3169787_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	97.0	8.4e-29
WP_016244744.1|3170003_3170480_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	4.9e-88
WP_000783732.1|3170463_3170787_-|holin	phage holin, lambda family	holin	K7PHK8	Enterobacteria_phage	100.0	1.0e-52
WP_001235461.1|3171149_3171773_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_025269774.1|3171769_3172435_-	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	96.8	2.0e-127
WP_025269775.1|3172431_3173037_-	recombination protein NinG	NA	K7PHP1	Enterobacterial_phage	97.5	8.1e-96
WP_000950963.1|3173029_3173206_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_000386657.1|3173205_3173565_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
WP_001254255.1|3173567_3173744_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_025269776.1|3173740_3174586_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	57.3	8.4e-91
WP_038428102.1|3174582_3175110_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.1e-100
WP_000736903.1|3175106_3175547_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_025269777.1|3175623_3177060_-	AAA family ATPase	NA	K7P7N4	Enterobacteria_phage	99.8	1.4e-274
WP_025269778.1|3177049_3177940_-	hypothetical protein	NA	K7PJJ7	Enterobacteria_phage	98.3	4.9e-158
WP_000189606.1|3178120_3178417_-	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
WP_000437876.1|3178554_3178755_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	100.0	3.3e-30
WP_001274760.1|3178855_3179569_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_042336691.1|3179994_3180261_+	hypothetical protein	NA	K7P7N9	Enterobacteria_phage	98.9	2.3e-42
WP_015980176.1|3180248_3180899_+	hypothetical protein	NA	K7P6H4	Enterobacteria_phage	100.0	1.3e-107
WP_000198446.1|3181392_3181776_+	hypothetical protein	NA	A4KWV5	Enterobacteria_phage	100.0	3.9e-64
WP_038427836.1|3181904_3182105_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	5.5e-33
WP_025269780.1|3182279_3183248_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.7	4.5e-56
WP_000638547.1|3183272_3183404_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|3183388_3183541_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_025269781.1|3183795_3184503_+	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	2.2e-137
WP_000168261.1|3184503_3185019_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	90.1	1.4e-67
WP_025269782.1|3185027_3185576_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.9	5.6e-104
WP_025269783.1|3185592_3185889_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	88.8	1.6e-41
WP_001214456.1|3185899_3186064_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_025269784.1|3186060_3186501_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	53.2	1.0e-31
WP_025269785.1|3186497_3186734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269786.1|3186730_3187048_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	92.0	6.8e-46
WP_025297252.1|3187034_3187574_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	52.6	2.9e-60
WP_025269788.1|3187573_3187852_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	7.1e-47
WP_038427596.1|3188010_3188178_+	hypothetical protein	NA	K7P728	Enterobacteria_phage	96.4	1.8e-26
WP_038427594.1|3188217_3188436_+	excisionase	NA	Q77WA4	Escherichia_phage	98.6	1.1e-34
WP_025269789.1|3188413_3189484_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.2	2.1e-200
3198854:3198869	attR	AAACCCTGCCGCCGGA	NA	NA	NA	NA
>prophage 8
NZ_CP007391	Escherichia coli strain ST540 chromosome, complete genome	4875682	3639410	3703443	4875682	tail,holin,integrase,terminase,lysis	Shigella_phage(42.86%)	65	3643784:3643798	3699835:3699849
WP_001543525.1|3639410_3641444_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.2	9.9e-21
WP_001543524.1|3641572_3642160_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089075.1|3642173_3643646_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_025269807.1|3643659_3645330_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	2.3e-60
3643784:3643798	attL	ACTTCCGCACCCAGA	NA	NA	NA	NA
WP_001209097.1|3645542_3646211_+	membrane protein	NA	NA	NA	NA	NA
WP_000370306.1|3646453_3647149_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_021570030.1|3647141_3648569_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102119.1|3648579_3649299_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3649825_3650680_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001543522.1|3650905_3652231_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_024166601.1|3652339_3652576_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|3652587_3653181_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3653770_3654622_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025269808.1|3654761_3659018_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3660132_3660234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3660597_3660861_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3660860_3661001_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3661035_3661263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3662085_3662628_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000150118.1|3662653_3663289_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3663346_3664015_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131091.1|3664040_3666566_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001543518.1|3666555_3668199_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301243.1|3668167_3668878_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|3669190_3669520_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3669767_3670382_-	YagU family protein	NA	NA	NA	NA	NA
WP_001543517.1|3670799_3671489_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|3671485_3672442_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_001543516.1|3672438_3674637_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	8.7e-39
WP_000121349.1|3674646_3675603_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3675581_3675992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269809.1|3676523_3677303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016244976.1|3679254_3679806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269810.1|3679965_3680376_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	78.7	5.6e-24
WP_038428115.1|3680832_3682332_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.6	5.3e-298
WP_000929175.1|3682328_3682823_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_025269811.1|3682948_3683299_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.0	7.5e-62
WP_000738423.1|3683823_3684117_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_123000755.1|3684207_3684390_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	95.0	1.2e-15
WP_025269812.1|3684606_3685083_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	8.6e-85
WP_001120497.1|3685086_3685413_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	1.5e-56
WP_025269813.1|3685489_3686542_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.6	2.8e-205
WP_000917724.1|3686692_3686896_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000357056.1|3687215_3688235_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_080086273.1|3688249_3688630_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
WP_001583194.1|3688644_3689634_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.1	1.6e-194
WP_001061445.1|3689641_3690451_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_001545197.1|3690857_3691184_-	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	2.7e-53
WP_077698505.1|3691183_3691678_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	1.6e-86
WP_000104977.1|3691674_3692616_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	2.2e-140
WP_001250269.1|3692605_3692785_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_025269815.1|3692960_3693518_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.1	4.4e-96
WP_000205494.1|3693555_3693756_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3693853_3694480_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000917896.1|3694665_3694962_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000135680.1|3695562_3695925_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_025269816.1|3695990_3696815_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	6.0e-150
WP_000008202.1|3696942_3697479_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001242749.1|3697469_3697832_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3697831_3698137_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000433939.1|3698136_3698487_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051893.1|3698363_3699527_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_000893278.1|3699731_3700985_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3699835:3699849	attR	ACTTCCGCACCCAGA	NA	NA	NA	NA
WP_001285288.1|3700996_3702100_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3702387_3703443_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 9
NZ_CP007391	Escherichia coli strain ST540 chromosome, complete genome	4875682	4046144	4101836	4875682	transposase,integrase	Escherichia_phage(33.33%)	40	4087471:4087530	4094850:4095440
WP_000080164.1|4046144_4047758_+|transposase	IS66-like element ISEc47 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	7.3e-176
WP_001066942.1|4050403_4051144_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361610.1|4051428_4052406_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_077698508.1|4055304_4055472_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000192349.1|4055483_4056530_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_025269838.1|4056638_4057571_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|4057557_4058961_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_012372828.1|4059168_4060185_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513661.1|4060523_4060703_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|4060707_4061088_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|4061087_4061309_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_025269840.1|4061491_4063048_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	8.4e-105
WP_025269841.1|4063044_4064259_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	24.9	1.4e-17
WP_025269842.1|4064380_4067497_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_000991832.1|4068544_4069477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246636.1|4069480_4070476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350635.1|4070940_4073079_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044768.1|4073240_4073657_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|4073653_4073884_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_085947917.1|4076281_4077555_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000545983.1|4078906_4080040_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000642771.1|4080059_4080344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000215657.1|4080340_4080538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639434.1|4082820_4083102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016494.1|4086678_4087470_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
4087471:4087530	attL	GTCACAAATCATAATTATGAATTGTGATTTATTCTATAAAAGAAGAGACCACTGCAATAT	NA	NA	NA	NA
WP_000239529.1|4087607_4087883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639434.1|4090196_4090478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021512928.1|4091385_4092711_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	6.5e-114
WP_001505086.1|4092859_4093564_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.5e-138
WP_001707302.1|4093629_4094061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016494.1|4094057_4094849_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
WP_000239529.1|4094986_4095262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|4095255_4095900_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
4094850:4095440	attR	GTCACAAATCATAATTATGAATTGTGATTTATTCTATAAAAGAAGAGACCACTGCAATATGTGATCTCTTGTATGCAAGGGTGCTTAAACAGTGTGAATTCACAAGTGTGATTTCATAAGTAATAACTTCTTGATTATTACGTTAGTGTTTTTAAGTATTGCTCAAGGGCTACTCTGACGATGGCACTTACATTTTTTGGATCTTTACCATTGCGTTTATTCCTCAATGCCAGATCTTCTATTGTGACAAGCATGCTTTCACCAAGAGAGATTGTCGTCCGACATTGTTTTTCTGGTTCGGGTTTTTCCGGCGCGCCGTATGGTTTATCCGCAAGGCGCTGAGCCAGAGCCTCTGCTTGTTCTACCGTAACTGCAGCTCTGTTTAATGCTTGCTGGCTGGGTTTCTTCACCATGGGCCAAATACCTCATTCATTAAATGTTCAATTTCTGCTCTGGCTGCTGTATTGTTCGTTTCTACTACACCGGTGCCGTTGCTCATGCAATCGCGATAGACTTTTCTGAAACAAATAACTGAATCCAGGACTTGAATTGTTGGGAATTCTTCAAGATATTCAAGGAATTCTTTTCTCT	NA	NA	NA	NA
WP_001103691.1|4096121_4097093_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.6	6.3e-66
WP_000340829.1|4097097_4097490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269845.1|4097494_4098766_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	2.4e-142
WP_000109071.1|4098765_4099203_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|4099199_4099448_-	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	38.8	2.3e-12
WP_001348615.1|4099865_4100768_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|4101152_4101836_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.0	5.8e-26
>prophage 10
NZ_CP007391	Escherichia coli strain ST540 chromosome, complete genome	4875682	4153116	4174221	4875682	transposase,integrase,protease	Escherichia_phage(50.0%)	24	4161482:4161506	4174629:4174653
WP_000616807.1|4153116_4153770_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|4153862_4154120_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|4154052_4154454_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001262765.1|4154738_4156049_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000429836.1|4156881_4157316_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|4157387_4157738_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|4157751_4158027_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|4158062_4158485_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|4158536_4160231_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|4160248_4160611_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|4160607_4160844_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|4160879_4161548_+	EAL domain-containing protein	NA	NA	NA	NA	NA
4161482:4161506	attL	TGTCATTTTCAGAAGACGACTGCAC	NA	NA	NA	NA
WP_000935452.1|4161586_4162891_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|4162937_4163642_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240537.1|4164397_4165369_+	replication protein C	NA	NA	NA	NA	NA
WP_001043265.1|4165556_4166372_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|4166432_4167236_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4167235_4168072_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|4168132_4168837_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4169764_4170580_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|4170769_4171474_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001387387.1|4171520_4171922_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|4172071_4172932_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|4173516_4174221_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
4174629:4174653	attR	GTGCAGTCGTCTTCTGAAAATGACA	NA	NA	NA	NA
>prophage 11
NZ_CP007391	Escherichia coli strain ST540 chromosome, complete genome	4875682	4248897	4257932	4875682	transposase	uncultured_Caudovirales_phage(14.29%)	8	NA	NA
WP_000684856.1|4248897_4249854_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4249854_4250622_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4251179_4251437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747102.1|4252570_4252921_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4253021_4253594_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4253642_4254467_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_001299662.1|4255280_4256300_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_001301177.1|4256429_4257932_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	7.9e-84
