The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007390	Escherichia coli strain ST540 chromosome, complete genome	4807977	1039221	1052404	4807977		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1039221_1039983_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1039976_1040603_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1040742_1041882_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1041944_1042937_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1043030_1044395_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1044483_1045260_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_025269898.1|1045264_1045903_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.2e-81
WP_000590403.1|1045899_1047162_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1047158_1048067_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272547.1|1048232_1049030_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141322.1|1049080_1049737_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272898.1|1049842_1052404_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP007390	Escherichia coli strain ST540 chromosome, complete genome	4807977	1407256	1452032	4807977	holin,terminase,integrase	Salmonella_phage(29.63%)	67	1436112:1436127	1455737:1455752
WP_023301637.1|1407256_1407457_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	86.4	3.7e-29
WP_025269984.1|1407453_1407690_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	51.0	1.0e-06
WP_025269983.1|1407686_1407878_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	62.7	6.0e-13
WP_025269982.1|1407874_1408411_-	hypothetical protein	NA	J9Q748	Salmonella_phage	72.6	6.1e-71
WP_025269981.1|1408624_1409152_-	phage N-6-adenine-methyltransferase	NA	Q9ZWX6	Enterobacteria_phage	61.0	8.4e-57
WP_025269980.1|1409180_1409804_-	exonuclease	NA	A0A0S2SY31	Pseudomonas_phage	60.2	3.1e-58
WP_025269979.1|1409800_1410547_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	64.7	2.4e-65
WP_016529276.1|1410563_1410848_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_025269978.1|1410855_1411827_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	75.9	7.2e-38
WP_019704100.1|1411914_1412109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161953880.1|1412101_1412227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725100.1|1412537_1412741_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	73.1	1.2e-19
WP_025269976.1|1412780_1413698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025269975.1|1413694_1414282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025269974.1|1414592_1415303_-	helix-turn-helix domain-containing protein	NA	K7P7K3	Enterobacteria_phage	71.4	3.7e-92
WP_001548452.1|1415407_1415599_+	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
WP_001548453.1|1415678_1415900_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_025269973.1|1415985_1416840_+	replication protein	NA	K7PGT1	Enterobacteria_phage	54.8	1.7e-62
WP_004141710.1|1416824_1417694_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	69.7	8.9e-96
WP_012542626.1|1417690_1417984_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	2.5e-26
WP_025269969.1|1419172_1419643_+	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	35.5	1.3e-19
WP_025269967.1|1419869_1420067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269966.1|1420103_1420286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269965.1|1420282_1420546_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.7	3.2e-25
WP_025269964.1|1420564_1420825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805077.1|1421060_1421528_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	46.5	5.7e-33
WP_038427665.1|1421508_1421679_+	hypothetical protein	NA	G8C7V4	Escherichia_phage	71.4	2.2e-14
WP_025269963.1|1421671_1422253_+	hypothetical protein	NA	E7C9S3	Salmonella_phage	49.3	7.1e-41
WP_038427667.1|1422249_1422390_+	YlcG family protein	NA	NA	NA	NA	NA
WP_025269962.1|1422386_1422887_+	antiterminator	NA	G8C7V7	Escherichia_phage	90.9	9.7e-87
WP_012542609.1|1423342_1423612_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_025269961.1|1423589_1424087_+	lysozyme	NA	K7P7Q3	Enterobacteria_phage	84.8	9.6e-79
WP_025269960.1|1424083_1424473_+	hypothetical protein	NA	Q8SBD9	Shigella_phage	47.6	1.3e-22
WP_004218030.1|1424953_1425442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021312714.1|1425392_1426793_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	9.4e-188
WP_025269958.1|1427030_1428482_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.4	5.5e-191
WP_025269957.1|1428537_1429086_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.9e-49
WP_025269956.1|1429137_1430340_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	55.1	8.0e-111
WP_025269955.1|1430343_1430838_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	63.4	1.4e-50
WP_025269954.1|1430849_1431788_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	76.9	7.8e-138
WP_000725700.1|1431827_1432109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269953.1|1432077_1432497_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	62.2	8.8e-41
WP_025269952.1|1432493_1433000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009652660.1|1432999_1433404_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
WP_025269951.1|1433396_1433948_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.9	1.5e-40
WP_025269950.1|1433949_1435101_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	2.1e-177
WP_025269949.1|1435111_1435552_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	79.5	2.1e-61
WP_025269948.1|1435555_1435975_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	64.4	4.4e-40
WP_025269947.1|1436016_1436169_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	82.0	3.2e-17
1436112:1436127	attL	CCTGAAAGCCGATAAC	NA	NA	NA	NA
WP_025269946.1|1436158_1438075_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	58.1	1.6e-198
WP_025269945.1|1438074_1438650_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.0	5.0e-63
WP_025269944.1|1438725_1438953_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	5.6e-18
WP_025269943.1|1438955_1440023_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	68.5	1.5e-137
WP_000734772.1|1440019_1440352_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	64.5	3.4e-19
WP_000506882.1|1440382_1440700_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000539208.1|1440787_1441519_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	72.8	4.7e-98
WP_025269942.1|1441518_1441872_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	2.3e-50
WP_025269941.1|1441871_1443068_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	6.6e-158
WP_025269940.1|1443064_1443838_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.1	6.3e-77
WP_025269939.1|1443837_1444707_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	63.6	6.9e-32
WP_016244718.1|1444706_1444904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038427684.1|1447114_1447918_+	hypothetical protein	NA	A0A2H4N7C5	Pectobacterium_phage	35.8	4.9e-32
WP_025269936.1|1448023_1448263_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	49.4	2.8e-15
WP_025269935.1|1448262_1448580_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	4.0e-22
WP_025269934.1|1448591_1449623_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	37.9	3.3e-12
WP_025269933.1|1449627_1450788_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	2.9e-219
WP_000368117.1|1451099_1452032_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.4	2.3e-166
1455737:1455752	attR	GTTATCGGCTTTCAGG	NA	NA	NA	NA
>prophage 3
NZ_CP007390	Escherichia coli strain ST540 chromosome, complete genome	4807977	1686223	1695664	4807977		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569356.1|1686223_1687150_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_000783120.1|1687154_1687886_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1687866_1687974_-	protein YohO	NA	NA	NA	NA	NA
WP_021570169.1|1688033_1688765_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	1.4e-110
WP_001295431.1|1688986_1690672_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1690668_1691388_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1691434_1691905_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1691944_1692406_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001774944.1|1692530_1694531_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001774943.1|1694527_1695664_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 4
NZ_CP007390	Escherichia coli strain ST540 chromosome, complete genome	4807977	1913690	1924676	4807977		Escherichia_phage(30.0%)	15	NA	NA
WP_000019588.1|1913690_1914434_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|1914474_1914870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042337314.1|1914922_1915600_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	98.2	2.9e-62
WP_016529276.1|1916299_1916584_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_025269996.1|1916591_1917563_-	hypothetical protein	NA	A0A077KCC0	Edwardsiella_phage	76.8	2.5e-38
WP_025269967.1|1917812_1918010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269966.1|1918046_1918229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269997.1|1918225_1918489_+	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	73.7	1.5e-25
WP_025269998.1|1918595_1919063_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	48.7	1.3e-37
WP_001548467.1|1919150_1919291_+	YlcG family protein	NA	NA	NA	NA	NA
WP_025269999.1|1919287_1919977_+	antiterminator	NA	I6PDF8	Cronobacter_phage	54.9	6.5e-57
WP_025270001.1|1920839_1921721_+	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	61.1	4.3e-29
WP_140414703.1|1921972_1924057_+	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	47.3	7.1e-107
WP_025270003.1|1924065_1924245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025270004.1|1924358_1924676_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	5.3e-22
>prophage 5
NZ_CP007390	Escherichia coli strain ST540 chromosome, complete genome	4807977	2218621	2246012	4807977	tail,lysis,integrase	Enterobacteria_phage(33.33%)	35	2213911:2213927	2235850:2235866
2213911:2213927	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000041681.1|2218621_2221048_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	4.5e-214
WP_001300836.1|2221246_2221552_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2221659_2222370_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2222372_2222933_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2222967_2223309_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2223443_2223770_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001457992.1|2223975_2225190_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.8	1.5e-45
WP_000836066.1|2225201_2226221_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_021531328.1|2226278_2226389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2226408_2227689_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|2227723_2227960_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048324.1|2228047_2230519_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|2230612_2230804_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2230800_2230989_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001047135.1|2231604_2232357_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|2232634_2232724_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|2232778_2232991_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|2233291_2233507_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000839590.1|2234260_2234476_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000189909.1|2234480_2234795_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	93.3	1.3e-49
WP_001092965.1|2234850_2235384_+	lysozyme	NA	Q08J98	Stx2-converting_phage	92.7	9.9e-98
WP_001071777.1|2235380_2235878_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2235850:2235866	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000066495.1|2236241_2236454_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|2236464_2236653_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2236799_2236955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2237127_2237301_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_020239410.1|2237596_2237803_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_032145128.1|2238053_2238248_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	1.6e-26
WP_000453617.1|2238636_2239182_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	6.8e-94
WP_001439069.1|2240580_2241156_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	5.5e-102
WP_000078178.1|2241253_2241844_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2242160_2242394_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2242462_2242576_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000347482.1|2243179_2244463_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527806.1|2244551_2246012_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
>prophage 6
NZ_CP007390	Escherichia coli strain ST540 chromosome, complete genome	4807977	3055026	3089586	4807977	protease,holin,terminase,integrase	Enterobacteria_phage(56.52%)	52	3062282:3062297	3098956:3098971
WP_025269766.1|3055026_3056844_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	40.4	4.4e-20
WP_021518667.1|3056967_3057540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000013026.1|3057543_3057981_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	38.9	1.1e-25
WP_025269767.1|3057984_3059379_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.6	1.8e-69
WP_025269768.1|3059383_3060322_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	37.9	6.5e-52
WP_025269769.1|3060305_3060740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021518664.1|3060736_3061165_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	39.3	1.1e-22
WP_017898838.1|3061161_3061644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021518663.1|3061716_3062748_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	45.8	3.3e-73
3062282:3062297	attL	TCCGGCGGCAGGGTTT	NA	NA	NA	NA
WP_025269770.1|3062761_3063622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021518661.1|3063637_3065251_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_025269771.1|3065263_3066085_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	41.2	4.0e-53
WP_001001273.1|3066081_3067497_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	36.7	4.2e-87
WP_004884204.1|3067508_3068840_-|terminase	terminase-like family protein	terminase	A0A0U2JTW9	Escherichia_phage	59.7	3.5e-152
WP_025269772.1|3068843_3069584_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	35.1	2.0e-16
WP_139298491.1|3069682_3069889_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	97.0	8.4e-29
WP_016244744.1|3070105_3070582_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	4.9e-88
WP_000783732.1|3070565_3070889_-|holin	phage holin, lambda family	holin	K7PHK8	Enterobacteria_phage	100.0	1.0e-52
WP_001235461.1|3071251_3071875_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_025269774.1|3071871_3072537_-	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	96.8	2.0e-127
WP_025269775.1|3072533_3073139_-	recombination protein NinG	NA	K7PHP1	Enterobacterial_phage	97.5	8.1e-96
WP_000950963.1|3073131_3073308_-	protein ninF	NA	Q76H71	Enterobacteria_phage	100.0	6.7e-27
WP_000386657.1|3073307_3073667_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
WP_001254255.1|3073669_3073846_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_025269776.1|3073842_3074688_-	phosphoadenosine phosphosulfate reductase family protein	NA	I6R0S6	Salmonella_phage	57.3	8.4e-91
WP_038428102.1|3074684_3075212_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.1e-100
WP_000736903.1|3075208_3075649_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_025269777.1|3075725_3077162_-	AAA family ATPase	NA	K7P7N4	Enterobacteria_phage	99.8	1.4e-274
WP_025269778.1|3077151_3078042_-	hypothetical protein	NA	K7PJJ7	Enterobacteria_phage	98.3	4.9e-158
WP_000189606.1|3078222_3078519_-	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
WP_000437876.1|3078656_3078857_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	100.0	3.3e-30
WP_001274760.1|3078957_3079671_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_042336691.1|3080096_3080363_+	hypothetical protein	NA	K7P7N9	Enterobacteria_phage	98.9	2.3e-42
WP_015980176.1|3080350_3081001_+	hypothetical protein	NA	K7P6H4	Enterobacteria_phage	100.0	1.3e-107
WP_000198446.1|3081494_3081878_+	hypothetical protein	NA	A4KWV5	Enterobacteria_phage	100.0	3.9e-64
WP_038427836.1|3082006_3082207_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	5.5e-33
WP_025269780.1|3082381_3083350_+	hypothetical protein	NA	K7P7J7	Enterobacteria_phage	99.7	4.5e-56
WP_000638547.1|3083374_3083506_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|3083490_3083643_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_025269781.1|3083897_3084605_+	recombinase	NA	K7PKU3	Enterobacteria_phage	99.6	2.2e-137
WP_000168261.1|3084605_3085121_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	90.1	1.4e-67
WP_025269782.1|3085129_3085678_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.9	5.6e-104
WP_025269783.1|3085694_3085991_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	88.8	1.6e-41
WP_001214456.1|3086001_3086166_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_025269784.1|3086162_3086603_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	53.2	1.0e-31
WP_025269785.1|3086599_3086836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269786.1|3086832_3087150_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	92.0	6.8e-46
WP_025297252.1|3087136_3087676_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	52.6	2.9e-60
WP_025269788.1|3087675_3087954_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	98.9	7.1e-47
WP_038427596.1|3088112_3088280_+	hypothetical protein	NA	K7P728	Enterobacteria_phage	96.4	1.8e-26
WP_038427594.1|3088319_3088538_+	excisionase	NA	Q77WA4	Escherichia_phage	98.6	1.1e-34
WP_025269789.1|3088515_3089586_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.2	2.1e-200
3098956:3098971	attR	AAACCCTGCCGCCGGA	NA	NA	NA	NA
>prophage 7
NZ_CP007390	Escherichia coli strain ST540 chromosome, complete genome	4807977	3540289	3604322	4807977	tail,terminase,lysis,holin,integrase	Shigella_phage(42.86%)	65	3544663:3544677	3600714:3600728
WP_001543525.1|3540289_3542323_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.2	9.9e-21
WP_001543524.1|3542451_3543039_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089075.1|3543052_3544525_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_025269807.1|3544538_3546209_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	2.3e-60
3544663:3544677	attL	ACTTCCGCACCCAGA	NA	NA	NA	NA
WP_001209097.1|3546421_3547090_+	membrane protein	NA	NA	NA	NA	NA
WP_000370306.1|3547332_3548028_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_021570030.1|3548020_3549448_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102119.1|3549458_3550178_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3550704_3551559_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001543522.1|3551784_3553110_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_024166601.1|3553218_3553455_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|3553466_3554060_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3554649_3555501_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025269808.1|3555640_3559897_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3561011_3561113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3561476_3561740_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3561739_3561880_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3561914_3562142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301257.1|3562964_3563507_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000150118.1|3563532_3564168_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3564225_3564894_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131091.1|3564919_3567445_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001543518.1|3567434_3569078_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301243.1|3569046_3569757_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001303809.1|3570069_3570399_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3570646_3571261_-	YagU family protein	NA	NA	NA	NA	NA
WP_001543517.1|3571678_3572368_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|3572364_3573321_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_001543516.1|3573317_3575516_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	8.7e-39
WP_000121349.1|3575525_3576482_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111348.1|3576460_3576871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269809.1|3577402_3578182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016244976.1|3580133_3580685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269810.1|3580844_3581255_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	78.7	5.6e-24
WP_038428115.1|3581711_3583211_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.6	5.3e-298
WP_000929175.1|3583207_3583702_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_025269811.1|3583827_3584178_-	HNH endonuclease	NA	Q8HA82	Salmonella_phage	94.0	7.5e-62
WP_000738423.1|3584702_3584996_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_123000755.1|3585086_3585269_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	95.0	1.2e-15
WP_025269812.1|3585485_3585962_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	8.6e-85
WP_001120497.1|3585965_3586292_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	1.5e-56
WP_025269813.1|3586368_3587421_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.6	2.8e-205
WP_000917724.1|3587571_3587775_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000357056.1|3588094_3589114_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	32.5	2.4e-39
WP_080086273.1|3589128_3589509_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	90.0	6.1e-57
WP_001583194.1|3589523_3590513_-	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	99.1	1.6e-194
WP_001061445.1|3590520_3591330_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.6	4.0e-151
WP_001545197.1|3591736_3592063_-	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	2.7e-53
WP_077698505.1|3592062_3592557_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	1.6e-86
WP_000104977.1|3592553_3593495_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	2.2e-140
WP_001250269.1|3593484_3593664_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_025269815.1|3593839_3594397_-	protein YmfL	NA	S5FXP0	Shigella_phage	95.1	4.4e-96
WP_000205494.1|3594434_3594635_-	cell division protein	NA	NA	NA	NA	NA
WP_000450735.1|3594732_3595359_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000917896.1|3595544_3595841_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000135680.1|3596441_3596804_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_025269816.1|3596869_3597694_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	6.0e-150
WP_000008202.1|3597821_3598358_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001242749.1|3598348_3598711_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|3598710_3599016_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000433939.1|3599015_3599366_+	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000051893.1|3599242_3600406_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_000893278.1|3600610_3601864_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3600714:3600728	attR	ACTTCCGCACCCAGA	NA	NA	NA	NA
WP_001285288.1|3601875_3602979_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3603266_3604322_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 8
NZ_CP007390	Escherichia coli strain ST540 chromosome, complete genome	4807977	4006569	4054885	4807977	transposase,integrase	Escherichia_phage(35.0%)	37	4029294:4029310	4062009:4062025
WP_000080164.1|4006569_4008183_+|transposase	IS66-like element ISEc47 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	62.6	7.3e-176
WP_001066942.1|4010828_4011569_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361610.1|4011853_4012831_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_077698508.1|4015729_4015897_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000192349.1|4015908_4016955_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_025269838.1|4017063_4017996_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|4017982_4019386_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_012372828.1|4019593_4020610_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513661.1|4020948_4021128_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|4021132_4021513_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|4021512_4021734_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_025269840.1|4021916_4023473_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	8.4e-105
WP_025269841.1|4023469_4024684_+	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	24.9	1.4e-17
WP_025269842.1|4024805_4027922_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_000991832.1|4028969_4029902_-	hypothetical protein	NA	NA	NA	NA	NA
4029294:4029310	attL	ATTCAGCCCGGATTTCA	NA	NA	NA	NA
WP_000246636.1|4029905_4030901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000350635.1|4031365_4033504_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044768.1|4033665_4034082_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261287.1|4034078_4034309_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_085947917.1|4036706_4037980_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_000545983.1|4039331_4040465_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000642771.1|4040484_4040769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000215657.1|4040765_4040963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639434.1|4043245_4043527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021512928.1|4044434_4045760_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	6.5e-114
WP_001505086.1|4045908_4046613_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.5e-138
WP_001707302.1|4046678_4047110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016494.1|4047106_4047898_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	9.4e-52
WP_000239529.1|4048035_4048311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633913.1|4048304_4048949_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_001103691.1|4049170_4050142_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.6	6.3e-66
WP_000340829.1|4050146_4050539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025269845.1|4050543_4051815_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	2.4e-142
WP_000109071.1|4051814_4052252_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|4052248_4052497_-	DinI-like family protein	NA	A0A1W6JP10	Morganella_phage	38.8	2.3e-12
WP_001348615.1|4052914_4053817_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|4054201_4054885_+	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	36.0	5.8e-26
4062009:4062025	attR	TGAAATCCGGGCTGAAT	NA	NA	NA	NA
>prophage 9
NZ_CP007390	Escherichia coli strain ST540 chromosome, complete genome	4807977	4106165	4127269	4807977	protease,transposase,integrase	Escherichia_phage(42.86%)	23	4114531:4114555	4127677:4127701
WP_000616807.1|4106165_4106819_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|4106911_4107169_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|4107101_4107503_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001262765.1|4107787_4109098_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000429836.1|4109930_4110365_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|4110436_4110787_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|4110800_4111076_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|4111111_4111534_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|4111585_4113280_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|4113297_4113660_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|4113656_4113893_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|4113928_4114597_+	EAL domain-containing protein	NA	NA	NA	NA	NA
4114531:4114555	attL	TGTCATTTTCAGAAGACGACTGCAC	NA	NA	NA	NA
WP_000935452.1|4114635_4115940_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001067855.1|4115986_4116691_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240537.1|4117446_4118418_+	replication protein C	NA	NA	NA	NA	NA
WP_001043265.1|4118605_4119421_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|4119481_4120285_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|4120284_4121121_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|4121181_4121886_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4122813_4123629_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001387387.1|4124569_4124971_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|4125120_4125981_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|4126564_4127269_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
4127677:4127701	attR	GTGCAGTCGTCTTCTGAAAATGACA	NA	NA	NA	NA
>prophage 10
NZ_CP007390	Escherichia coli strain ST540 chromosome, complete genome	4807977	4143427	4152462	4807977	transposase	uncultured_Caudovirales_phage(14.29%)	8	NA	NA
WP_000684856.1|4143427_4144384_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4144384_4145152_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4145709_4145967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747102.1|4147100_4147451_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4147551_4148124_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4148172_4148997_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_001299662.1|4149810_4150830_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	8.4e-45
WP_001301177.1|4150959_4152462_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	7.9e-84
