The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006923	Klebsiella pneumoniae 30660/NJST258_1 chromosome, complete genome	5263229	445194	478452	5263229	terminase,tail,capsid,protease,tRNA,integrase,head,portal	uncultured_Caudovirales_phage(75.0%)	34	462802:462819	478797:478814
WP_002919147.1|445194_446142_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|446156_446666_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|446794_447919_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|447890_448364_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|448389_448932_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919132.1|448936_449509_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|449512_450331_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|450327_450585_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|450560_451115_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|456910_457132_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|457425_460536_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|460548_461688_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|462066_462717_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
462802:462819	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|462992_464219_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|464311_465253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|465434_465719_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|465729_466509_+	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|466960_467230_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|467222_467411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|467403_467718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|467714_468083_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|468079_468445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|468444_470580_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|470922_471258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|471306_471819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|472082_473249_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|473300_473861_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|473862_475104_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|475100_475436_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|475432_475732_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|475731_476175_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|476167_476320_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|476450_476807_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|476790_478452_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
478797:478814	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP006923	Klebsiella pneumoniae 30660/NJST258_1 chromosome, complete genome	5263229	1237947	1312169	5263229	terminase,plate,tail,capsid,tRNA,lysis,integrase,head,portal	Salmonella_phage(80.0%)	80	1236241:1236287	1272809:1272855
1236241:1236287	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1237947_1238973_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1238975_1239605_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1239727_1239970_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1240002_1240512_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1240519_1240720_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1240683_1241022_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1241089_1241323_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1241322_1241550_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1241546_1242398_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1242394_1244779_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1244941_1245130_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1245141_1245375_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1245470_1246154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1246140_1247220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1247219_1248221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1248742_1249012_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1249068_1250112_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_025403951.1|1250111_1251875_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.6	0.0e+00
WP_004151004.1|1252015_1252849_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1252865_1253918_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1253921_1254575_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1254670_1255135_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1255134_1255338_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1255341_1255557_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1255537_1256047_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1256051_1256435_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1256431_1256860_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1256834_1256993_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1256955_1257378_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1257370_1257817_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1257839_1258706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1258800_1259373_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1259369_1259732_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1259718_1260627_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1260619_1261291_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1261292_1263242_+	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1263251_1264370_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1264421_1265495_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1265643_1266816_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1266825_1267341_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1267393_1267693_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1267707_1267827_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150983.1|1270447_1270933_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1270929_1272024_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1272090_1272309_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1272336_1272714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1273317_1273800_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1272809:1272855	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1273910_1274387_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1274376_1274667_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1274733_1275075_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1275222_1276884_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1276970_1277849_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1277973_1278564_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1278683_1279970_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1279989_1280781_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1280944_1282309_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1282568_1282817_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1282835_1283384_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1283415_1284183_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1284222_1284570_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914119.1|1284689_1285148_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_002914118.1|1285204_1286575_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914117.1|1286583_1287066_-	OmpA family protein	NA	NA	NA	NA	NA
WP_002914116.1|1287079_1288303_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_004174804.1|1288295_1288805_-	YfiR family protein	NA	NA	NA	NA	NA
WP_002914114.1|1289147_1290218_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_002914113.1|1290227_1291349_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914112.1|1291411_1292284_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004150975.1|1292280_1293441_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100250063.1|1293541_1293589_-	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_002914111.1|1293695_1294031_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_004145664.1|1294301_1295039_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914110.1|1295170_1296151_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_002914109.1|1296147_1296879_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_004150973.1|1297008_1299582_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914097.1|1305632_1306931_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_002914095.1|1306934_1307258_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914094.1|1307299_1308655_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004151994.1|1308775_1311436_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914092.1|1311470_1312169_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP006923	Klebsiella pneumoniae 30660/NJST258_1 chromosome, complete genome	5263229	1388993	1433836	5263229	terminase,integrase,holin,tail	Salmonella_phage(38.0%)	56	1391557:1391571	1402737:1402751
WP_004151980.1|1388993_1390460_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1390527_1392105_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
1391557:1391571	attL	TCTGCCGCTTCCGCC	NA	NA	NA	NA
WP_004152549.1|1392297_1393548_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004152548.1|1393564_1393756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152546.1|1393931_1394525_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152545.1|1394521_1394680_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004153052.1|1394672_1394966_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152543.1|1395075_1395324_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004152542.1|1395375_1396398_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152541.1|1396407_1397307_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004164029.1|1397303_1397603_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|1397599_1397749_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004152539.1|1397969_1398551_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1398704_1398938_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1399084_1399294_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1399293_1400061_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|1400057_1400843_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1400962_1401310_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1401502_1401913_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1401896_1402088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1402084_1402510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1402506_1403250_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
1402737:1402751	attR	GGCGGAAGCGGCAGA	NA	NA	NA	NA
WP_004152528.1|1403249_1403420_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004141386.1|1403420_1403633_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1403629_1404298_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1404290_1404530_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1404529_1404868_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|1404942_1405200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1405277_1405862_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004154331.1|1405858_1407334_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152449.1|1407400_1407712_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004141368.1|1408513_1408720_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152447.1|1408734_1410417_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004152446.1|1410413_1410710_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152445.1|1410712_1411393_+	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_004152444.1|1411407_1412394_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.9	1.6e-178
WP_004152443.1|1412447_1412885_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_004152442.1|1412895_1413237_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152441.1|1413287_1413611_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152440.1|1413610_1414216_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152439.1|1414215_1416714_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152438.1|1416713_1417178_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152437.1|1417177_1417717_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_004152436.1|1417727_1420559_+	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
WP_004152435.1|1420558_1422469_+	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152434.1|1422468_1425234_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
WP_071531206.1|1425376_1425760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152433.1|1425845_1426535_-	Bro-N domain-containing protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_004152432.1|1426849_1427146_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004207261.1|1427302_1429669_+	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004229092.1|1429677_1429830_+	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004146394.1|1429953_1430358_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004146393.1|1430344_1430650_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004152706.1|1430639_1431269_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004152707.1|1431265_1431748_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152009.1|1431967_1433836_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP006923	Klebsiella pneumoniae 30660/NJST258_1 chromosome, complete genome	5263229	1763927	1770834	5263229	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1763927_1764791_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1764801_1765575_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004151134.1|1765817_1766714_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1766956_1768318_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1768636_1769359_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1769355_1770834_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 5
NZ_CP006923	Klebsiella pneumoniae 30660/NJST258_1 chromosome, complete genome	5263229	1807402	1815027	5263229		Enterobacteria_phage(28.57%)	7	NA	NA
WP_004152488.1|1807402_1808809_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004152487.1|1809033_1810098_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152486.1|1810124_1810994_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152485.1|1811025_1811916_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152484.1|1811930_1812485_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152483.1|1812665_1813832_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152482.1|1814025_1815027_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 6
NZ_CP006923	Klebsiella pneumoniae 30660/NJST258_1 chromosome, complete genome	5263229	2055757	2112244	5263229	transposase,plate,protease	Staphylococcus_phage(16.67%)	54	NA	NA
WP_002910830.1|2055757_2056504_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910809.1|2056942_2057929_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004151439.1|2057921_2058722_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2058708_2058882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219597.1|2059179_2059323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2059499_2060441_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2060534_2061524_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2061549_2062881_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2062908_2064117_+	propionate kinase	NA	NA	NA	NA	NA
WP_025403964.1|2064145_2066440_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	5.1e-159
WP_004225356.1|2066491_2066638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910729.1|2066927_2067986_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2068095_2069010_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2069019_2070297_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2070293_2071169_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_002910721.1|2071165_2071885_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2071890_2072784_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2073067_2074711_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2074760_2075237_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2075335_2076262_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2076565_2077861_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004899032.1|2077872_2078682_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|2078656_2079556_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2079665_2080148_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2080338_2081037_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|2081062_2081602_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2081716_2082046_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910645.1|2082614_2083955_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2083951_2084605_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152319.1|2089270_2090626_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_002910593.1|2090626_2091136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2091132_2091639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2091733_2091886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2091875_2092385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|2093990_2094959_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|2095100_2095283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2095279_2095609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2095605_2096112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093244.1|2096571_2097603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2097626_2097932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2097953_2098847_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004217423.1|2098892_2099009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|2099030_2099924_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2099949_2100078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910539.1|2100099_2100993_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2101168_2102059_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2102395_2103376_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_171815252.1|2103433_2103736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|2103996_2104182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2104479_2104746_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2104749_2105907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2105890_2109301_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2109434_2111198_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152910.1|2111227_2112244_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 7
NZ_CP006923	Klebsiella pneumoniae 30660/NJST258_1 chromosome, complete genome	5263229	2936447	3009252	5263229	holin,terminase,plate,transposase,integrase	uncultured_Caudovirales_phage(35.29%)	81	3000365:3000379	3006374:3006388
WP_002902268.1|2936447_2937533_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|2937496_2939251_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|2940922_2944348_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_025403981.1|2944331_2945471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|2945467_2945725_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004151601.1|2945769_2948187_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|2948174_2948705_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|2949372_2949903_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|2951165_2951945_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|2951945_2954315_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|2954316_2956971_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|2957235_2957727_-	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_004151602.1|2957731_2959438_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|2959434_2960124_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|2960120_2961464_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|2961473_2963018_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002902144.1|2963060_2963552_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902136.1|2964397_2964646_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|2964867_2965152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|2965256_2965466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902128.1|2965462_2966194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|2966204_2966933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|2969283_2969481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152576.1|2969480_2970347_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|2970346_2971120_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|2971116_2972313_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|2972312_2972666_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|2972667_2973321_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|2973374_2973941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|2973983_2974166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|2974215_2974557_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|2974556_2975579_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|2975581_2975809_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152567.1|2975884_2976484_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|2976483_2978487_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|2978476_2978629_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|2978664_2979090_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_085955245.1|2979416_2980608_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152178.1|2980549_2980840_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_004152177.1|2980850_2981996_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|2981999_2982440_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|2982534_2982921_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|2982920_2983427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2983423_2983843_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|2983811_2984093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|2984132_2985074_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|2985085_2985580_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|2985583_2986786_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|2986837_2987386_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|2987441_2988893_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|2989130_2990531_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|2990481_2990970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|2991335_2991656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|2991890_2992280_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|2992276_2992807_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|2992809_2993058_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152167.1|2993463_2994246_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|2994242_2994719_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|2994715_2995678_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|2995679_2997338_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|2997914_2998136_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|2998233_2998902_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|2999072_2999387_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|2999379_2999568_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|2999737_3000103_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3000095_3000350_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3000321_3000540_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3000365:3000379	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3000536_3000962_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3000958_3001153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3001149_3001977_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3002081_3002600_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3002605_3003316_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3003305_3003530_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3003526_3003739_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_014343018.1|3003981_3004215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3004287_3004434_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3004393_3004636_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3004616_3005798_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3005994_3006543_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3006374:3006388	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3006741_3008274_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_025403984.1|3008490_3009252_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	4.1e-20
>prophage 8
NZ_CP006923	Klebsiella pneumoniae 30660/NJST258_1 chromosome, complete genome	5263229	3420965	3513914	5263229	terminase,plate,tail,capsid,protease,tRNA,lysis,integrase,head,portal	Salmonella_phage(58.62%)	94	3476489:3476507	3513989:3514007
WP_002898139.1|3420965_3422258_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3422348_3423692_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3423700_3424312_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_025403991.1|3424434_3428688_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_020314624.1|3428823_3429318_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3429850_3430819_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3430933_3432700_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3432700_3434422_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3434466_3435168_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3435521_3435740_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3435859_3438139_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3438169_3438487_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3438812_3439034_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3439110_3441051_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3441047_3442163_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3442309_3443968_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3444387_3445083_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3445198_3446098_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3446241_3447894_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3447904_3448873_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3449084_3449519_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3449670_3451389_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3451427_3452429_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3452439_3453882_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3453969_3454983_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3454979_3455810_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3455841_3456981_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3457858_3458374_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3458599_3459328_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3459348_3460080_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3460086_3460803_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3460802_3461471_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3461654_3462386_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_002896382.1|3462428_3463901_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3463897_3464614_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3464692_3465820_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3465861_3466350_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3466407_3467253_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3467249_3468203_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3468213_3469347_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3469510_3470623_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3470971_3471451_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3471539_3472442_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3473263_3473551_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3473753_3474017_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3474023_3474407_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_004179131.1|3474673_3476359_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3476489:3476507	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3476578_3476797_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3476888_3477989_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3477985_3478471_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896222.1|3478467_3481095_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	42.0	5.6e-117
WP_002896220.1|3481087_3481207_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3481221_3481521_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3481573_3482089_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3482098_3483271_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3483409_3484486_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3484515_3484719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3484715_3485447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724930.1|3485450_3486185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150856.1|3488403_3489003_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3488995_3489904_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3489890_3490253_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3490249_3490822_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3490916_3491609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3491605_3492052_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3492044_3492476_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3492438_3492585_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3492571_3493000_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3492996_3493380_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3493384_3493894_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3493874_3494090_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3494093_3494297_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3494296_3494761_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3494856_3495507_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3495510_3496569_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3496585_3497419_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3497561_3499328_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3499327_3500353_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3500414_3502157_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3502432_3503110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3503224_3503458_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3503468_3503657_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3503810_3506225_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3506221_3507079_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3507075_3507303_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3507302_3507536_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3507603_3507945_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3507908_3508109_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3508116_3508626_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3508658_3508880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3509025_3509904_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3509915_3510860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3510958_3512446_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3512933_3513914_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3513989:3514007	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
NZ_CP006923	Klebsiella pneumoniae 30660/NJST258_1 chromosome, complete genome	5263229	3958809	4005185	5263229	holin,transposase,tRNA,lysis,head	Cronobacter_phage(24.53%)	66	NA	NA
WP_004151249.1|3958809_3961287_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|3961273_3961669_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|3961665_3962136_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151252.1|3962135_3962612_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004151253.1|3962654_3966101_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|3966193_3966697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|3966824_3967610_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|3967675_3968389_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|3968378_3968549_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|3968648_3969008_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|3969024_3969495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|3969788_3970043_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|3970045_3970801_-	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|3970976_3971654_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|3971706_3972459_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|3972527_3972920_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|3972916_3973342_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|3973344_3973707_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|3973706_3973880_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|3973879_3974260_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|3974262_3974502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|3974512_3975607_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|3975618_3976047_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|3976050_3977436_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|3977508_3977985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|3978026_3979031_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|3979005_3980427_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|3980439_3981912_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|3981911_3982514_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|3982884_3983214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|3983319_3983784_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|3983780_3984311_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|3984313_3984562_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_025403995.1|3985298_3986345_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.8e-05
WP_004151283.1|3986572_3987262_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|3987258_3987789_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|3987781_3987919_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|3987915_3988551_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|3988543_3988714_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|3988713_3989169_-	YbcN family protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|3989669_3990317_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151292.1|3990313_3990490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025403996.1|3990489_3991332_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|3991438_3991945_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|3991941_3992235_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004230547.1|3992234_3993650_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004230546.1|3993654_3994506_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004151298.1|3994546_3994693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|3994778_3995000_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|3995040_3995274_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|3995401_3996091_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|3996441_3996657_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151302.1|3996653_3996764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|3996756_3996951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|3997039_3997324_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|3997339_3998185_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|3998181_3998862_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|3998858_3999017_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|3999013_3999670_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|3999666_4000434_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4000430_4000649_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4000650_4000866_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4000867_4001203_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004143017.1|4002673_4003540_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|4003541_4003754_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4003799_4005185_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
NZ_CP006923	Klebsiella pneumoniae 30660/NJST258_1 chromosome, complete genome	5263229	4214738	4226392	5263229	integrase	Enterobacteria_phage(70.0%)	13	4215188:4215202	4238245:4238259
WP_004144574.1|4214738_4215842_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4215188:4215202	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4215852_4217106_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4217458_4218649_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4218636_4219587_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4219586_4220012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4220580_4221147_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4221164_4221410_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4221406_4222144_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4222685_4222952_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_024940872.1|4222948_4223506_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4223502_4223730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4223726_4224047_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4224058_4226392_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4238245:4238259	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 11
NZ_CP006923	Klebsiella pneumoniae 30660/NJST258_1 chromosome, complete genome	5263229	4695619	4701444	5263229		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4695619_4697953_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4697967_4698288_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4698284_4698512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153681.1|4698508_4699057_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4699053_4699320_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4699880_4700618_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4700614_4700860_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4700877_4701444_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP006927	Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N1, complete sequence	142788	4466	36109	142788	protease,transposase	Escherichia_phage(22.22%)	22	NA	NA
WP_004199413.1|4466_7484_+|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
WP_003846917.1|8132_9386_-	lactose permease	NA	NA	NA	NA	NA
WP_004152287.1|9437_12512_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|12633_13716_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152284.1|14176_15187_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427619.1|15590_16595_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_044117068.1|16886_17555_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_004153729.1|18410_19238_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|19234_20098_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|20106_20934_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|20942_21953_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|21946_22816_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|24024_25005_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|26206_26470_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|26484_26748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|26991_27273_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|27307_27877_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|27991_30787_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|30786_30984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|31221_31971_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152113.1|31957_32920_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|34762_36109_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP006926	Klebsiella pneumoniae 30660/NJST258_1 plasmid pNJST258N2, complete sequence	73636	48	59002	73636	transposase	Escherichia_phage(19.23%)	55	NA	NA
WP_012539983.1|48_804_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_022644883.1|891_2430_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
WP_000612626.1|2478_2826_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_007372134.1|2822_3227_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_015632469.1|4008_5214_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_022644882.1|5213_6188_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.0	9.4e-86
WP_022644881.1|6269_7541_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	1.6e-149
WP_020805749.1|7540_7972_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_001568038.1|8204_9176_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_022644880.1|9178_9850_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001568040.1|9911_10142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|10578_11280_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_022644904.1|11279_11501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644903.1|11510_11930_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_022644878.1|11983_12751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404028.1|13431_13860_+	antirestriction protein	NA	NA	NA	NA	NA
WP_022644900.1|13904_14411_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_022644899.1|14453_14645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404029.1|14838_15093_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.7	2.6e-11
WP_022644897.1|15128_15449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644896.1|16123_16666_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.4	1.7e-49
WP_022644895.1|16714_16963_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_022644894.1|17031_19032_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.5	3.2e-24
WP_015632482.1|19076_19508_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_025404030.1|19504_20233_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_015632484.1|20229_20556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087439983.1|20744_22119_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_022644891.1|22289_23330_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_162859354.1|23535_25818_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_015065592.1|26251_27784_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_004196353.1|27872_29213_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032072095.1|29468_29891_-	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196366.1|30052_31183_-	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_004196355.1|31195_31465_-	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196314.1|31570_32869_-	nickel resistance membrane nickel efflux protein NirA	NA	NA	NA	NA	NA
WP_004196325.1|33102_33861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|33914_34835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196359.1|34897_35269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|36180_37500_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|37749_38631_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|38949_39729_-	IS21-like element ISKpn7 family helper ATPase IstB	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|39725_40751_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|40857_43887_-|transposase	Tn3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|43996_45712_+	Tn3-like element Tn4401 family resolvase TnpR	NA	NA	NA	NA	NA
WP_001217881.1|46826_47384_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_014454105.1|47617_48172_+	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001206315.1|48241_49030_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|49089_49914_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|50613_51474_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000480968.1|52194_53031_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001145207.1|53030_53789_-	APH(3'') family aminoglycoside O-phosphotransferase	NA	NA	NA	NA	NA
WP_001043260.1|53893_54709_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|55038_55215_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|55396_56401_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|58297_59002_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
