The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	347438	443802	4722762	capsid,tail,portal,integrase,head,holin,transposase,tRNA,plate,terminase	Cronobacter_phage(30.0%)	96	350015:350031	381469:381485
WP_025376663.1|347438_348386_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	32.5	3.5e-05
WP_025376664.1|348410_348923_-	peptide deformylase	NA	NA	NA	NA	NA
WP_100273806.1|349056_350055_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
350015:350031	attL	TGACACCCGTTGATGTC	NA	NA	NA	NA
WP_025376665.1|350852_352547_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	49.7	3.8e-127
WP_100274005.1|352543_353089_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	47.8	5.7e-32
WP_025376667.1|353090_353798_-	hypothetical protein	NA	Q94MX8	Haemophilus_virus	29.3	3.8e-12
WP_025376668.1|353787_354273_-|tail	tail fiber assembly protein	tail	F1BUP0	Erwinia_phage	51.3	2.2e-43
WP_100273807.1|354288_355956_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	63.3	2.5e-118
WP_025376671.1|355955_356546_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	61.3	1.8e-63
WP_025376672.1|356538_357723_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	59.3	1.6e-132
WP_025376673.1|357719_358049_-	DUF2590 family protein	NA	Q94MY3	Haemophilus_virus	61.3	7.9e-29
WP_100273808.1|358045_360106_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	40.8	3.8e-137
WP_025376674.1|360302_360578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376675.1|360638_361022_-	hypothetical protein	NA	A0A192Y658	Salmonella_phage	43.9	3.6e-17
WP_100273809.1|361011_361242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376676.1|361135_361507_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	41.4	4.0e-13
WP_025376677.1|361506_361839_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	79.2	6.3e-42
WP_100273810.1|361835_362156_-|holin	holin	holin	C7BGD7	Burkholderia_phage	44.8	1.2e-13
WP_025376679.1|362159_362618_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	55.3	3.3e-41
WP_025376680.1|362620_363790_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	55.3	6.1e-108
WP_050917223.1|363786_364482_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	43.9	4.8e-44
WP_025376682.1|364471_364990_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_100273811.1|364986_365439_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	47.3	4.0e-31
WP_025376683.1|365560_366304_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	51.1	3.6e-61
WP_025376684.1|366318_367485_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	50.3	7.3e-85
WP_100273812.1|367567_368524_-|capsid	GPO family capsid scaffolding protein	capsid	A5X9H4	Aeromonas_virus	55.0	2.1e-37
WP_072085979.1|370559_371657_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	61.8	1.3e-123
WP_025376688.1|371660_371990_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_025376689.1|372030_372261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376690.1|372295_374701_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	52.1	1.5e-206
WP_100273813.1|374697_375693_-	DNA cytosine methyltransferase	NA	W0LM09	Edwardsiella_phage	52.4	1.5e-91
WP_100274006.1|375689_376034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376693.1|376194_376863_-	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	59.7	3.6e-12
WP_025376694.1|376862_377099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376695.1|377170_377527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376696.1|377540_377777_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_025376697.1|377923_378157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376698.1|378335_378629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273814.1|378625_378877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376700.1|378873_379134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376701.1|379236_379536_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	57.1	6.7e-19
WP_025376702.1|379581_380274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273815.1|380285_381257_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	52.5	1.4e-94
WP_025376703.1|381603_382077_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
381469:381485	attR	TGACACCCGTTGATGTC	NA	NA	NA	NA
WP_025376704.1|382118_382655_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_025376705.1|382662_383235_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	32.8	3.8e-10
WP_025376706.1|383243_384065_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_025376707.1|384122_384665_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_087769555.1|390873_391803_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_025376708.1|392208_393807_+	malate synthase A	NA	NA	NA	NA	NA
WP_025376709.1|393856_395164_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_025376710.1|395240_396968_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_025376711.1|397069_397909_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_087769556.1|398163_401859_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	82.5	2.7e-24
WP_025376712.1|401955_403341_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_025376713.1|403955_405602_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_025376714.1|405731_406139_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_025376715.1|406268_407159_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_025376716.1|407172_408750_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_025376717.1|408956_410168_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_100273816.1|410737_410878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376718.1|410865_411975_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	4.0e-16
WP_025376719.1|412046_413333_+	maltoporin	NA	NA	NA	NA	NA
WP_087769558.1|413527_414457_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_025376721.1|414675_417666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376722.1|417812_418319_+	chorismate lyase	NA	NA	NA	NA	NA
WP_025376723.1|418368_419238_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_025376724.1|419328_421803_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_025376725.1|421929_422298_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_025376726.1|422425_423034_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.9	1.7e-13
WP_004391853.1|423483_423693_+	CsbD family protein	NA	NA	NA	NA	NA
WP_025378469.1|423758_424967_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
WP_087769069.1|425285_425795_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_025376729.1|426245_426503_-	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	57.8	1.1e-20
WP_025376731.1|427026_427782_-	hypothetical protein	NA	H6WRY1	Salmonella_phage	78.9	8.2e-122
WP_025376732.1|427781_428141_-	hypothetical protein	NA	A0A0H4ISY5	Shigella_phage	53.3	2.8e-11
WP_025376734.1|428805_429129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273817.1|429306_430203_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	42.7	4.7e-23
WP_100273818.1|430199_430379_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_025376735.1|430375_430906_-	hypothetical protein	NA	A0A291AX04	Escherichia_phage	58.7	3.1e-51
WP_025376736.1|430999_431821_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	59.6	2.1e-86
WP_025376737.1|431868_432225_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	65.2	2.9e-37
WP_025376738.1|432550_432784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004390449.1|433029_433752_-	helix-turn-helix domain-containing protein	NA	A0A0N7KZF6	Stx2-converting_phage	36.1	1.2e-24
WP_004390451.1|433825_434074_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	40.3	1.2e-08
WP_019083784.1|434118_434646_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	29.7	6.3e-12
WP_025376739.1|434811_435009_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_025376740.1|435005_436022_+	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	73.4	4.0e-31
WP_025376741.1|436018_436906_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	57.4	2.2e-94
WP_025376742.1|436902_438762_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	59.5	1.4e-236
WP_100274007.1|438785_439430_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	56.8	6.4e-59
WP_025376744.1|439426_440428_+	DUF968 domain-containing protein	NA	S5FV02	Shigella_phage	50.0	1.4e-92
WP_100273819.1|440318_441107_+	antitermination protein	NA	NA	NA	NA	NA
WP_025376746.1|441864_442911_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	62.8	1.8e-127
WP_005174491.1|443056_443272_+	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	54.0	2.0e-12
WP_025376747.1|443271_443802_+	lysozyme	NA	H9C184	Pectobacterium_phage	72.6	1.1e-72
>prophage 2
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	446885	471567	4722762	capsid,tail,portal,integrase,head,transposase,tRNA,plate,terminase	Salmonella_phage(20.0%)	27	450865:450879	470870:470884
WP_100273820.1|446885_448994_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	36.5	1.0e-97
WP_025376754.1|449002_449266_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_100273821.1|449334_450918_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.3	3.0e-97
450865:450879	attL	TTTGCACCCGATCAG	NA	NA	NA	NA
WP_025376756.1|450914_451772_+	S49 family peptidase	NA	K7P7A7	Enterobacteria_phage	41.0	7.8e-52
WP_025376757.1|451771_452359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376758.1|452358_452760_+|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	37.2	2.4e-11
WP_025376759.1|452868_453915_+|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	30.7	2.9e-40
WP_025376760.1|453916_454372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376761.1|454371_454716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376762.1|454712_455258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376763.1|455263_455455_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_025376764.1|455454_456945_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	44.0	9.9e-103
WP_025376765.1|456957_457332_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_025376766.1|457333_457636_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_100273822.1|457753_459628_+	hypothetical protein	NA	Q858G0	Salmonella_phage	30.5	2.0e-20
WP_025376767.1|459685_461092_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	28.4	6.6e-24
WP_025376768.1|461088_462162_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.6	1.0e-40
WP_025376769.1|462158_462752_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	41.1	8.7e-10
WP_025376770.1|462748_463186_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	45.4	5.2e-20
WP_025376771.1|463189_464326_+|plate	baseplate J/gp47 family protein	plate	J9QE72	Clostridium_phage	28.3	4.9e-09
WP_025376772.1|464322_464919_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	39.3	2.3e-34
WP_100273823.1|465770_466403_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_025376775.1|466435_467425_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_100273824.1|467432_467903_-	acyltransferase	NA	NA	NA	NA	NA
WP_087769681.1|467912_469062_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.8	3.7e-49
WP_025376777.1|469345_470434_-|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	69.6	5.1e-149
WP_025376778.1|470523_471567_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
470870:470884	attR	CTGATCGGGTGCAAA	NA	NA	NA	NA
>prophage 3
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	500233	541175	4722762	protease,capsid,tail,portal,integrase,head,tRNA,terminase	uncultured_Caudovirales_phage(68.75%)	42	490392:490406	527559:527573
490392:490406	attL	CAGTGCCAGCAAAAT	NA	NA	NA	NA
WP_025376802.1|500233_501793_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.8	2.1e-18
WP_025376803.1|502049_503279_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	59.0	8.3e-140
WP_025376804.1|503375_504338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100274008.1|504572_504809_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	47.2	1.0e-09
WP_025376806.1|504823_505717_+	transporter	NA	Q8W644	Enterobacteria_phage	55.7	1.9e-80
WP_175020569.1|506543_506738_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_025376808.1|506730_507051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376809.1|507043_507346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376810.1|507342_507681_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	52.1	2.3e-23
WP_025376811.1|507677_509057_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	61.9	6.9e-151
WP_025376812.1|509258_509597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050919653.1|509642_510116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376813.1|510404_511577_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	73.5	1.0e-158
WP_025376814.1|511619_512177_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	73.7	8.3e-71
WP_100273825.1|512178_513381_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	72.7	1.0e-174
WP_025376816.1|513377_513713_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	59.6	2.6e-27
WP_025376817.1|513709_513994_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	78.5	3.6e-38
WP_025376818.1|513993_514440_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	63.6	8.4e-50
WP_100274010.1|514565_514748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376819.1|514714_515068_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	72.6	1.6e-43
WP_025376820.1|515054_516716_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.0	3.0e-273
WP_025376821.1|516730_517348_+|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	58.5	5.1e-53
WP_100274011.1|517371_517608_+	hypothetical protein	NA	A0A1W6JPH4	Morganella_phage	53.3	1.9e-16
WP_002210061.1|517764_518061_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_087769055.1|518085_519051_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_025376824.1|519491_520373_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_025376825.1|520469_521924_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_025376826.1|521913_522156_-	YhdT family protein	NA	NA	NA	NA	NA
WP_025376827.1|522350_523700_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_025376828.1|523711_524176_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_025376829.1|524333_524786_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_025376830.1|524994_525594_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_025376831.1|525593_526628_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_025376832.1|526785_527763_-	oxidoreductase	NA	NA	NA	NA	NA
527559:527573	attR	CAGTGCCAGCAAAAT	NA	NA	NA	NA
WP_087769054.1|528049_529969_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_025376834.1|531444_532431_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_025376835.1|532427_532916_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_025376836.1|532929_533523_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_025376837.1|533512_534982_+	ribonuclease G	NA	NA	NA	NA	NA
WP_100273826.1|535020_538878_+	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_025376838.1|538874_539717_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_025376839.1|539729_541175_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 4
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	568332	624217	4722762	transposase,protease	uncultured_Mediterranean_phage(12.5%)	56	NA	NA
WP_025376861.1|568332_569067_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_025376862.1|569112_569934_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_025376863.1|569930_570857_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_025376864.1|570850_572287_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_025376865.1|572553_572940_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_025376866.1|573109_573574_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_025376867.1|573585_574521_-	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	39.9	6.1e-50
WP_005162489.1|575051_575324_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_025376869.1|575324_576176_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.8	2.4e-05
WP_087769408.1|576364_576847_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004392031.1|576939_577227_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_025376871.1|577250_578684_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004710935.1|578737_579463_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.2e-22
WP_025376872.1|579469_580015_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_025376873.1|579998_580562_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_025376874.1|580558_581122_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	78.5	9.9e-56
WP_087769411.1|581135_582113_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.0	1.5e-38
WP_025376876.1|582176_583151_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_025376877.1|583445_584255_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	31.7	3.7e-19
WP_025376878.1|584265_585048_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_025376879.1|585052_585607_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_025376880.1|585619_586246_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_025376881.1|586248_586554_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_025376882.1|586788_587043_+	BolA family iron metabolism protein IbaG	NA	NA	NA	NA	NA
WP_025376883.1|587165_588431_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_025376884.1|588516_589608_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	33.8	6.5e-11
WP_025376885.1|589696_591070_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.4	3.0e-21
WP_025376886.1|591330_591735_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_025376887.1|591957_593085_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_025376888.1|593401_593830_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005162424.1|593844_594237_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_025376889.1|594620_595262_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_025376890.1|595267_595774_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	53.7	5.6e-26
WP_025376891.1|595853_596339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376892.1|596608_598027_-	glutamate synthase small subunit	NA	NA	NA	NA	NA
WP_025376893.1|598036_602497_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_025376894.1|603193_604117_+	TIGR01212 family radical SAM protein	NA	NA	NA	NA	NA
WP_025376895.1|604357_606694_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.4	4.9e-40
WP_087769405.1|606711_606918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376896.1|606934_607588_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_025376897.1|607584_608310_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_025376898.1|608385_608961_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_004391999.1|608971_609562_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	32.5	2.4e-12
WP_025376899.1|609616_609970_-	YraN family protein	NA	NA	NA	NA	NA
WP_025376900.1|610014_611997_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_025376901.1|612059_612953_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	44.7	7.6e-50
WP_087769681.1|613899_615049_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.8	3.7e-49
WP_175020546.1|615012_615507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273802.1|616590_618103_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100273828.1|618357_618780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273829.1|618802_619000_-	hypothetical protein	NA	A0A1V0E6X6	Klebsiella_phage	60.3	4.0e-12
WP_025376910.1|619098_619512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378177.1|619561_619804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025376911.1|620435_621107_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_025376912.1|621338_621908_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.5	1.2e-24
WP_100273799.1|623042_624217_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	73.4	1.3e-134
>prophage 5
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	754513	816520	4722762	tail,integrase,holin,transposase,plate	Acinetobacter_phage(16.67%)	56	756349:756408	808830:809570
WP_025377015.1|754513_754864_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_025377016.1|755296_755749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273837.1|755978_756353_+	hypothetical protein	NA	NA	NA	NA	NA
756349:756408	attL	TGTAGTGGCATAGTTAATTTGGCCACCTGAATAGAGGTGATATCATCGCCTCATAGTCAA	NA	NA	NA	NA
WP_087769681.1|757119_758270_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.8	3.7e-49
WP_100273838.1|758762_760547_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.2	9.6e-121
WP_025377019.1|760543_760882_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	53.8	8.7e-23
WP_025377020.1|760878_761181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377021.1|761173_761353_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_025377022.1|761333_761528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273839.1|761520_762471_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_025377025.1|762460_762988_-	antirepressor protein	NA	A0A1W6JPH8	Morganella_phage	61.0	7.6e-50
WP_025377026.1|762996_763203_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025377027.1|763324_763975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377028.1|763971_765390_-|integrase	integrase family protein	integrase	NA	NA	NA	NA
WP_025377029.1|765738_767070_-	DUF1343 domain-containing protein	NA	NA	NA	NA	NA
WP_087768548.1|768226_770110_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_025377031.1|770434_771295_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_025377032.1|771523_772432_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_025377033.1|772434_773886_+	PTS N-acetylmuramic acid transporter subunit IIBC	NA	NA	NA	NA	NA
WP_025377034.1|773931_774870_-	glutaminase A	NA	NA	NA	NA	NA
WP_025377035.1|774938_776513_-	amino acid permease	NA	NA	NA	NA	NA
WP_025377036.1|776586_777987_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_025377037.1|778323_778782_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025377038.1|778890_780120_+	MFS transporter	NA	NA	NA	NA	NA
WP_025377039.1|780219_780792_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_025377040.1|780944_781838_+	EamA family transporter	NA	NA	NA	NA	NA
WP_025377041.1|782238_784260_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_025377042.1|784333_785521_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_025377043.1|785952_787704_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_025377044.1|787927_788431_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_025377045.1|788578_789568_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_025377046.1|789963_790950_+	TerC family protein	NA	A0A291LBC5	Escherichia_phage	35.2	1.1e-36
WP_025377047.1|791253_792510_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_025377048.1|792551_793103_-	YgjV family protein	NA	NA	NA	NA	NA
WP_025377049.1|793270_794761_-	altronate dehydratase	NA	NA	NA	NA	NA
WP_025377050.1|794770_796222_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_025377051.1|796401_797811_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_025377052.1|798324_799629_+	MFS transporter	NA	NA	NA	NA	NA
WP_025377053.1|799871_800687_+	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_087768558.1|800948_801464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377055.1|801656_802349_+	DedA family protein	NA	NA	NA	NA	NA
WP_025377056.1|802345_802735_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_140414427.1|802921_803308_+	DUF1090 family protein	NA	NA	NA	NA	NA
WP_025377057.1|803432_803738_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_025377058.1|803740_804136_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_087768546.1|804132_804417_+	YqjK-like family protein	NA	NA	NA	NA	NA
WP_025377060.1|804721_805117_+	DoxX family protein	NA	NA	NA	NA	NA
WP_025377061.1|805201_806188_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_025377062.1|806214_807111_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025377063.1|807288_807993_+	pirin family protein	NA	NA	NA	NA	NA
WP_100273799.1|808902_810076_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	73.4	1.3e-134
808830:809570	attR	TGTAGTGGCATAGTTAATTTGGCCACCTGAATAGAGGTGATATCATCGCCTCATAGTCAAAACAGGTGACATTATGACCGGACGTAACAAACGCAACTTTAGCCCCGAGTTTCGCCTCGAAGCTGCCCAGCTTGTACTCGATCAGCATTACACCGTTGCCGCCGCTGCCACGGCAATGAATGTCGGTAAATCCACGATGGATAAGTGGGTTCGGCAGTTGAAAGAAGAACGAGGAGGGAAATCACCCGTAGCGTCACCCATGACACCTGAGCAGATTGAAATACGCGAGCTGAAGAAAAGACTTCAACGTGTTGAAATGGAAAGAGATATATTAAAAAAGGCTACCGCGCTCTTGATGTCAGACTCCCTGAACAGTTCTCATTAGTTGAGAAACTCAGGGCGCGGTTTCCTGTTGCCGTTGTGTGCAACGTGTTTGGGGTTCATCGCAGCAGCTATAAATACTGGCGGCAGCCAAAGAAGCCTGATGCCGCACGCGTGGCATTACTCAGTCTTGTTCGTGAAAGCTATCGCGAAAGTAATGGCTCCGCAGGTGCACGTAATATTGCCGCGATGGTCACTACCAAAGGTGTAAAACTGAGCCGCTGGCGGGCAACAAAGCTAATGAAAGAACTTAATCTCATCAGTTGTCAGCAGCCTGGTCATCGATATAAAAAGGCGTCTAAGGAACACGTAGAAATCCCCAATTATCTGGAACGCCAGTTTGCAGTAACAGAGCCTAAT	NA	NA	NA	NA
WP_100273840.1|810121_811219_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_025377068.1|811262_811556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377069.1|812950_813451_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_100273841.1|813489_815043_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_025377071.1|815167_816520_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 6
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	835587	877970	4722762	transposase,tRNA,plate	Acinetobacter_phage(10.0%)	38	NA	NA
WP_100273844.1|835587_837351_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_025377082.1|837314_838400_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_025377083.1|838374_838956_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012104646.1|838955_839405_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_025377085.1|840010_841420_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_025377086.1|841514_842147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273846.1|842183_842435_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_175020547.1|842763_842988_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273847.1|843093_843888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087769681.1|844664_845814_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.8	3.7e-49
WP_100273848.1|847348_849346_-	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	31.7	7.2e-32
WP_087769550.1|849377_849896_-	general secretion pathway protein GspC	NA	NA	NA	NA	NA
WP_025377093.1|849952_850375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377094.1|851064_851823_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_025377095.1|851972_852344_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025377096.1|852446_853196_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.9	5.4e-17
WP_025377097.1|853308_854277_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_025377098.1|854325_854631_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_025377099.1|854637_855582_-	curved DNA-binding protein	NA	A0A2L0UZR4	Agrobacterium_phage	30.3	2.6e-24
WP_025377100.1|855954_857037_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_025377101.1|857409_858717_+	MFS transporter	NA	NA	NA	NA	NA
WP_025377102.1|858740_861116_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_025377103.1|861204_861621_-	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
WP_025377104.1|861754_862225_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_175020548.1|862407_862656_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	55.1	2.6e-16
WP_100273799.1|862859_864034_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	73.4	1.3e-134
WP_025377106.1|865527_867045_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	37.8	7.7e-87
WP_100273850.1|867054_868153_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	5.4e-05
WP_025377108.1|868312_870046_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	30.5	7.3e-65
WP_025377109.1|870052_870769_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_025377110.1|870817_871717_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.8	6.1e-31
WP_025377111.1|871822_872341_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_025377112.1|872390_873812_-	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_025377113.1|873904_875332_-	two-component system sensor histidine kinase CreC	NA	NA	NA	NA	NA
WP_025377114.1|875342_876041_-	two-component system response regulator CreB	NA	NA	NA	NA	NA
WP_025377115.1|876037_876466_-	protein YgfX	NA	NA	NA	NA	NA
WP_025377116.1|876446_876713_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_025377117.1|876977_877970_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	912160	957670	4722762	transposase,protease,tRNA,integrase	Paramecium_bursaria_Chlorella_virus(40.0%)	42	950532:950548	954239:954255
WP_087769423.1|912160_912673_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_025377147.1|912770_913478_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_025377148.1|913524_914256_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_025377149.1|914281_915235_+	glutathione synthase	NA	NA	NA	NA	NA
WP_025377150.1|915621_916185_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_025377151.1|916184_916607_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_025377152.1|916788_917673_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	50.7	4.8e-81
WP_025377153.1|917676_918801_+	agmatine deiminase	NA	A7RCL2	Paramecium_bursaria_Chlorella_virus	50.3	1.7e-99
WP_025377154.1|918840_919980_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_025377155.1|919999_920695_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_087769425.1|920739_921561_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_005157142.1|921695_922250_+	YggT family protein	NA	NA	NA	NA	NA
WP_025377157.1|922246_922537_+	YggU family protein	NA	NA	NA	NA	NA
WP_025377158.1|922599_923193_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_025377159.1|923185_924316_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_025377160.1|924385_925126_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_087769428.1|925236_926178_-	glutaminase B	NA	NA	NA	NA	NA
WP_025377162.1|926273_926600_-	YggL family protein	NA	NA	NA	NA	NA
WP_025377163.1|926748_927126_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_025377164.1|927122_928505_-	MFS transporter	NA	NA	NA	NA	NA
WP_025377165.1|928613_929510_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025377166.1|929560_930280_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_100274014.1|930760_931819_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_004391023.1|931884_932157_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_025377168.1|932268_933345_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_025377169.1|933518_934268_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_025377170.1|934320_936483_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_100273851.1|937478_938441_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_025377171.1|938479_939973_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_100273852.1|944254_944506_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_100273802.1|944566_946080_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100273853.1|946124_946349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377173.1|947506_947791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377174.1|947802_948804_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.3	6.3e-45
WP_025377175.1|948881_949478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377176.1|949555_949885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377177.1|950034_950388_-	hypothetical protein	NA	NA	NA	NA	NA
950532:950548	attL	GTTTTCAAAGGTTAAAC	NA	NA	NA	NA
WP_025378469.1|951021_952230_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
WP_025377178.1|952614_953538_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_025377179.1|954404_954614_+	hypothetical protein	NA	NA	NA	NA	NA
954239:954255	attR	GTTTTCAAAGGTTAAAC	NA	NA	NA	NA
WP_100273854.1|954975_956061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273799.1|956495_957670_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	73.4	1.3e-134
>prophage 8
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	989434	1090779	4722762	protease,capsid,tail,head,transposase,tRNA,plate,terminase	Pseudomonas_phage(26.09%)	105	NA	NA
WP_025378469.1|989434_990643_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
WP_025377210.1|990740_991208_+	YgdB family protein	NA	NA	NA	NA	NA
WP_087769539.1|991243_991597_+	peptidase	NA	NA	NA	NA	NA
WP_025377212.1|991747_995137_+	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_025377213.1|995228_998120_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	26.4	4.8e-69
WP_100273856.1|998116_1001746_+	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	22.8	5.2e-12
WP_025377214.1|1001742_1003626_+	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.3	1.2e-20
WP_025377215.1|1003673_1004999_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_025377216.1|1005234_1006485_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	29.0	1.1e-14
WP_025377218.1|1007207_1008380_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_025377219.1|1008486_1009296_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	30.8	7.2e-15
WP_025377220.1|1009342_1009780_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_087768835.1|1009832_1011080_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.0	1.9e-75
WP_025377222.1|1011220_1011442_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_025377223.1|1011902_1012820_+	transcriptional regulator GcvA	NA	NA	NA	NA	NA
WP_025377224.1|1012862_1013258_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_025377225.1|1013250_1014357_+	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_025377226.1|1014410_1015166_-	flap endonuclease Xni	NA	A0A0N7ACJ6	Bacillus_phage	31.4	2.9e-18
WP_087768836.1|1015311_1016676_-	LOG family protein	NA	NA	NA	NA	NA
WP_025377227.1|1016891_1017737_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	38.8	3.5e-44
WP_025377228.1|1017866_1018418_+	SecY-interacting protein	NA	NA	NA	NA	NA
WP_025377230.1|1019282_1019807_-	hypothetical protein	NA	A0A0C4UQZ2	Shigella_phage	28.0	4.8e-12
WP_025377231.1|1020051_1020273_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	73.9	4.5e-20
WP_100273857.1|1020269_1022321_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	48.9	1.9e-176
WP_025377233.1|1022363_1023254_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	51.9	3.1e-80
WP_012303416.1|1023264_1023498_+	hypothetical protein	NA	A0A2D1GNI5	Pseudomonas_phage	55.3	1.5e-18
WP_025377234.1|1023504_1023705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377235.1|1023694_1024333_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	58.0	8.9e-61
WP_025377236.1|1024334_1024526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057628194.1|1024609_1025323_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	33.8	4.4e-24
WP_025377238.1|1025322_1025820_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025377239.1|1025816_1026038_+	hypothetical protein	NA	A0A2D1GNI2	Pseudomonas_phage	57.6	5.7e-15
WP_025377240.1|1026034_1026580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377241.1|1026569_1026782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377242.1|1026771_1027131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377243.1|1027111_1027504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100274015.1|1027505_1027970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377245.1|1027954_1028356_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	51.9	7.4e-29
WP_025377246.1|1028355_1028790_+	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	48.5	1.2e-27
WP_050151276.1|1028808_1029285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080994240.1|1029354_1029993_+	glycoside hydrolase family 19 protein	NA	F1C5D2	Cronobacter_phage	61.8	8.3e-67
WP_025377249.1|1029983_1030241_+	hypothetical protein	NA	A0A2D1GNW8	Pseudomonas_phage	47.6	6.8e-12
WP_100274016.1|1030266_1030806_+	hypothetical protein	NA	A0A2D1GNR2	Pseudomonas_phage	42.7	1.0e-17
WP_025377250.1|1030802_1031045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377251.1|1031041_1031329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377252.1|1031331_1031832_+	DUF1804 family protein	NA	L7P7Y5	Pseudomonas_phage	60.1	3.8e-51
WP_025377253.1|1031824_1032022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377254.1|1032026_1033682_+|terminase	phage terminase large subunit	terminase	H6V8N6	Pseudomonas_phage	64.1	1.2e-205
WP_100273858.1|1033683_1035264_+	DUF935 domain-containing protein	NA	A0A0M5MS00	Ralstonia_phage	46.5	2.3e-126
WP_100274017.1|1035283_1036513_+|capsid	minor capsid protein	capsid	A0A0M4UTA3	Ralstonia_phage	39.8	2.3e-65
WP_100273859.1|1036512_1037064_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	35.0	1.7e-20
WP_025377257.1|1037297_1038404_+|protease	phage protease	protease	A0A2D1GNS3	Pseudomonas_phage	41.9	4.1e-61
WP_025377258.1|1038400_1038796_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	44.3	1.3e-17
WP_025377259.1|1038807_1039716_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	65.2	6.0e-111
WP_025377260.1|1039715_1040180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377261.1|1040191_1040620_+	DUF1320 family protein	NA	A0A1B0T6F3	Thiobacimonas_phage	33.1	3.1e-09
WP_100273860.1|1040619_1041273_+	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	37.2	1.9e-21
WP_100273861.1|1041253_1041514_+	DUF2635 domain-containing protein	NA	B7SDP7	Haemophilus_phage	46.2	2.2e-05
WP_025377264.1|1041500_1042922_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	48.6	2.4e-106
WP_025377265.1|1042934_1043312_+	hypothetical protein	NA	F6MIK8	Haemophilus_phage	58.9	1.3e-32
WP_025377266.1|1043311_1043698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377267.1|1043835_1046010_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	44.7	8.8e-100
WP_025377268.1|1046006_1047335_+	DNA circularization N-terminal domain-containing protein	NA	A0A2H4JGT4	uncultured_Caudovirales_phage	30.3	1.0e-42
WP_025377269.1|1047318_1048539_+|tail	tail protein	tail	F6MIL3	Haemophilus_phage	38.9	3.3e-72
WP_025377270.1|1048528_1049179_+|plate	phage baseplate assembly protein V	plate	A0A0M3LPA3	Mannheimia_phage	49.7	1.0e-51
WP_025377271.1|1049233_1049584_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	63.5	1.2e-30
WP_025377272.1|1049583_1050645_+|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	47.8	1.2e-78
WP_025377273.1|1050641_1051211_+	DUF2313 domain-containing protein	NA	A0A0M3LQE1	Mannheimia_phage	34.8	4.6e-24
WP_025377275.1|1052381_1052849_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_025377276.1|1052987_1053743_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	66.5	2.6e-99
WP_025377277.1|1053893_1054226_+	YqcC family protein	NA	NA	NA	NA	NA
WP_025377278.1|1054225_1054999_+|tRNA	tRNA pseudouridine(65) synthase TruC	tRNA	NA	NA	NA	NA
WP_025377279.1|1055027_1055477_+	flavodoxin	NA	NA	NA	NA	NA
WP_004706707.1|1055599_1055989_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_025377280.1|1056179_1057004_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_025377281.1|1057122_1059801_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_025377282.1|1059876_1060668_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_025377283.1|1061118_1061844_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_025377284.1|1061972_1062830_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_025377285.1|1063100_1063847_+	UMP kinase	NA	NA	NA	NA	NA
WP_025377286.1|1063980_1064538_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_025377287.1|1064758_1065955_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_025377288.1|1066181_1066940_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	40.7	2.1e-24
WP_025377289.1|1066949_1067798_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_025377290.1|1067826_1069182_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_025377291.1|1069218_1071606_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_025377292.1|1071764_1072262_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_025377293.1|1072265_1073288_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_025377294.1|1073450_1073942_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_025377295.1|1073945_1074734_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_025377296.1|1074737_1075922_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_025377297.1|1075918_1076515_+	ribonuclease HII	NA	R4THQ2	Phaeocystis_globosa_virus	34.5	2.7e-19
WP_087768839.1|1076608_1080091_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	8.8e-203
WP_025377298.1|1080103_1081063_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_025377299.1|1081366_1083508_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_025377300.1|1083521_1083920_+	VOC family protein	NA	NA	NA	NA	NA
WP_025377301.1|1083921_1085307_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_025377302.1|1085329_1085644_+	cytochrome c	NA	NA	NA	NA	NA
WP_025377303.1|1085748_1086009_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_004391680.1|1085995_1086196_-	YaeP family protein	NA	NA	NA	NA	NA
WP_025377304.1|1086432_1086981_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_087768840.1|1086983_1087400_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_087768841.1|1087469_1088177_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_025377307.1|1088250_1089969_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_087768842.1|1090071_1090779_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	1518451	1595411	4722762	protease,capsid,tail,portal,integrase,head,holin,tRNA,plate,terminase	Salmonella_phage(16.67%)	89	1515672:1515685	1534181:1534194
1515672:1515685	attL	CCGCCAAAATCAGC	NA	NA	NA	NA
WP_087769240.1|1518451_1519270_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_025377630.1|1519446_1520955_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.5	1.4e-11
WP_025377631.1|1521063_1521855_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_025377633.1|1522086_1522227_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_025377634.1|1522429_1523206_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025377635.1|1523381_1524575_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	37.5	2.2e-60
WP_025377636.1|1524540_1524741_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_025377637.1|1524743_1525256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377638.1|1525252_1525591_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	55.0	4.3e-30
WP_025377639.1|1525593_1525815_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	51.4	1.1e-13
WP_025377640.1|1525804_1526395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273871.1|1526394_1526742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377643.1|1526830_1527265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377645.1|1527617_1527914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273872.1|1528068_1528353_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_025377647.1|1528349_1528541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377648.1|1528565_1528754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377649.1|1528956_1529709_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	44.1	7.3e-30
WP_025377650.1|1529826_1530036_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	52.8	1.8e-07
WP_025377651.1|1530074_1530965_+	hypothetical protein	NA	A0A067ZIA1	Vibrio_phage	40.8	8.1e-28
WP_100273873.1|1530961_1531837_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	45.7	9.0e-64
WP_025377652.1|1531833_1533195_+	helicase	NA	Q8W640	Enterobacteria_phage	50.7	5.3e-119
WP_025377653.1|1533211_1533973_+	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	47.3	3.3e-62
WP_025377654.1|1534253_1534760_-	hypothetical protein	NA	NA	NA	NA	NA
1534181:1534194	attR	CCGCCAAAATCAGC	NA	NA	NA	NA
WP_025377655.1|1535385_1536111_+	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	68.1	6.3e-87
WP_025377656.1|1536270_1536630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273874.1|1536805_1536985_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_025377657.1|1536961_1537228_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_025377658.1|1537454_1537805_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	58.3	1.8e-26
WP_025377659.1|1537808_1538435_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	65.5	4.3e-68
WP_025377660.1|1538431_1538764_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_025376749.1|1539017_1539359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376750.1|1539452_1540097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376751.1|1540110_1540737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376752.1|1541014_1541581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273820.1|1541522_1543631_+|terminase	phage terminase large subunit family protein	terminase	A0A2K9V3X4	Faecalibacterium_phage	36.5	1.0e-97
WP_025376754.1|1543639_1543903_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_100273821.1|1543971_1545555_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.3	3.0e-97
WP_025376756.1|1545551_1546409_+	S49 family peptidase	NA	K7P7A7	Enterobacteria_phage	41.0	7.8e-52
WP_025376757.1|1546408_1546996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376758.1|1546995_1547397_+|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	37.2	2.4e-11
WP_025376759.1|1547505_1548552_+|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	30.7	2.9e-40
WP_025376760.1|1548553_1549009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376761.1|1549008_1549353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376762.1|1549349_1549895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025376763.1|1549900_1550092_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_025376764.1|1550091_1551582_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	44.0	9.9e-103
WP_025376765.1|1551594_1551969_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_025376766.1|1551970_1552273_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_100273822.1|1552390_1554265_+	hypothetical protein	NA	Q858G0	Salmonella_phage	30.5	2.0e-20
WP_025376767.1|1554322_1555729_+	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	28.4	6.6e-24
WP_025376768.1|1555725_1556799_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	30.6	1.0e-40
WP_025376769.1|1556795_1557389_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	41.1	8.7e-10
WP_025376770.1|1557385_1557823_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	45.4	5.2e-20
WP_025377661.1|1557826_1558963_+|plate	baseplate J/gp47 family protein	plate	A0A1B0Z1L7	Shewanella_phage	23.2	7.0e-08
WP_025377662.1|1558959_1559562_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.3	5.1e-34
WP_025377664.1|1560733_1561210_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_025377665.1|1561397_1561934_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_025377666.1|1562027_1562234_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	50.7	2.1e-11
WP_025377667.1|1562278_1563130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175020551.1|1563538_1563784_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	52.6	6.3e-15
WP_025377669.1|1563797_1564040_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	71.4	5.1e-25
WP_025377670.1|1564293_1564992_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025377671.1|1564985_1566050_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	2.0e-20
WP_025377672.1|1566125_1566947_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_087769258.1|1567562_1570076_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	51.1	9.2e-101
WP_025377674.1|1570352_1571354_+	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_100273875.1|1571485_1572760_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	32.0	2.1e-16
WP_025377675.1|1572859_1573912_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_025377676.1|1573911_1575063_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_025377677.1|1575046_1575859_+	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_025377678.1|1575851_1576553_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_025377679.1|1576656_1577367_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	26.4	1.7e-15
WP_025377680.1|1578319_1580332_+	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_025377681.1|1580409_1580658_+	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_025377682.1|1580668_1581595_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	26.7	4.1e-22
WP_025377683.1|1582153_1583134_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_025377684.1|1583165_1583645_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_025377685.1|1583641_1583887_+	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_087769247.1|1583886_1584342_+	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_025377687.1|1584485_1585196_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_025377688.1|1585394_1586501_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025377689.1|1586529_1587705_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025377690.1|1587701_1589453_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.5	4.1e-23
WP_025377691.1|1589466_1590453_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_025377692.1|1590502_1591201_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_025377693.1|1591580_1592936_+	ATP-dependent RNA helicase RhlE	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.6	7.0e-55
WP_100273876.1|1593547_1594441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273877.1|1594472_1595411_+|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
>prophage 10
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	1864238	1876300	4722762		Herpes_simplex_virus(16.67%)	7	NA	NA
WP_025377882.1|1864238_1867391_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	62.4	0.0e+00
WP_025377883.1|1867548_1868583_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	53.9	9.0e-87
WP_002210893.1|1869061_1869274_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_087769561.1|1869451_1869718_+	protein DsrB	NA	NA	NA	NA	NA
WP_100273892.1|1869839_1871579_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	55.2	2.6e-09
WP_087769215.1|1872667_1873378_+	MgtC family protein	NA	G3MA03	Bacillus_virus	41.8	4.8e-15
WP_025377886.1|1873597_1876300_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	26.6	2.0e-45
>prophage 11
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	1965957	1990379	4722762	transposase,tail,integrase	Pectobacterium_phage(52.17%)	36	1966811:1966824	1992059:1992072
WP_100273895.1|1965957_1966974_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	67.2	1.0e-135
1966811:1966824	attL	TTATTTATTTTTTC	NA	NA	NA	NA
WP_025377968.1|1966963_1967200_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	43.5	3.8e-09
WP_025377969.1|1967156_1967363_-	hypothetical protein	NA	H9C154	Pectobacterium_phage	48.4	7.4e-09
WP_019082908.1|1967412_1967595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377970.1|1967640_1968141_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	76.7	8.2e-62
WP_025377971.1|1968137_1970339_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	44.5	3.8e-167
WP_025377972.1|1970394_1970730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050335772.1|1971116_1971767_-	LexA family transcriptional regulator	NA	H9C160	Pectobacterium_phage	71.3	1.5e-87
WP_046051132.1|1971871_1972057_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	68.9	2.1e-18
WP_025377974.1|1972117_1972582_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	5.2e-34
WP_025377975.1|1972598_1972823_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	66.2	3.7e-22
WP_019082919.1|1972825_1973800_+	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	74.1	2.8e-37
WP_025377977.1|1973796_1975170_+	replicative DNA helicase	NA	Q8HA30	Enterobacteria_phage	48.1	2.4e-111
WP_025377978.1|1975213_1975636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377979.1|1975638_1975890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377980.1|1975886_1976111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377981.1|1976103_1976448_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	57.9	1.5e-30
WP_025377982.1|1976473_1976899_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_025377983.1|1977004_1977598_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	55.8	2.8e-61
WP_025377984.1|1977606_1977891_+	DUF1364 domain-containing protein	NA	A0A088CE53	Shigella_phage	75.5	8.9e-37
WP_100274019.1|1977911_1978286_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	72.1	8.4e-43
WP_025377986.1|1978276_1978702_-	hypothetical protein	NA	A0A1W5PTL2	Pseudoalteromonas_phage	61.4	2.2e-15
WP_032912238.1|1978949_1979144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025377987.1|1979565_1979781_+	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	54.0	6.7e-13
WP_100273896.1|1979780_1980311_+	lysozyme	NA	Q7Y3V3	Yersinia_phage	70.9	9.3e-72
WP_025377989.1|1980303_1980636_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_100273897.1|1980610_1980841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273799.1|1981102_1982276_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	73.4	1.3e-134
WP_025377990.1|1982273_1984463_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	50.5	6.8e-68
WP_025378469.1|1984524_1985733_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
WP_025378469.1|1986397_1987606_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
WP_100273899.1|1988029_1988158_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_025377993.1|1988191_1988518_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_025377994.1|1988642_1988891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273900.1|1988894_1989548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273901.1|1990211_1990379_-|integrase	integrase	integrase	H9C152	Pectobacterium_phage	74.5	1.9e-15
1992059:1992072	attR	GAAAAAATAAATAA	NA	NA	NA	NA
>prophage 12
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	2566269	2574069	4722762	tRNA	Tupanvirus(33.33%)	9	NA	NA
WP_025378414.1|2566269_2566566_+	zinc-ribbon domain and TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	68.8	1.4e-16
WP_004700314.1|2566783_2567080_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	4.2e-13
WP_087769262.1|2567084_2569472_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	25.8	1.6e-06
WP_025378416.1|2569486_2570470_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	5.8e-35
WP_152414234.1|2570781_2570829_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004393357.1|2570897_2571254_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002211834.1|2571291_2571489_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_011816226.1|2571585_2572137_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	3.4e-16
WP_025378417.1|2572140_2574069_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	7.4e-127
>prophage 13
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	2608777	2688739	4722762	protease,integrase,head,transposase,coat,terminase	Pectobacterium_phage(52.27%)	90	2640412:2640471	2688751:2690048
WP_025378445.1|2608777_2609659_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_087769274.1|2609983_2612053_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.3	2.1e-87
WP_004706516.1|2612072_2612786_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_025378447.1|2612881_2613379_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_087769275.1|2613605_2614853_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_025378448.1|2614821_2617452_+	PqiB family protein	NA	NA	NA	NA	NA
WP_025378449.1|2617465_2618386_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_100273922.1|2618515_2619940_+	MFS transporter	NA	NA	NA	NA	NA
WP_100274021.1|2620237_2620792_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_025378452.1|2620797_2621355_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_087769652.1|2621367_2621925_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_025378454.1|2621971_2622721_+	molecular chaperone	NA	NA	NA	NA	NA
WP_025378455.1|2622807_2625249_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025378456.1|2625271_2626282_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025378457.1|2626502_2628212_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_025378458.1|2628326_2628569_+	YebV family protein	NA	NA	NA	NA	NA
WP_025378459.1|2628685_2629075_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_025378460.1|2629793_2630027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378461.1|2630486_2631764_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_025378462.1|2631831_2632467_-	glutathione transferase	NA	NA	NA	NA	NA
WP_025378463.1|2632637_2632886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378464.1|2633133_2633979_+	EamA family transporter	NA	NA	NA	NA	NA
WP_025378465.1|2634085_2634280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378466.1|2634845_2636057_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_025378467.1|2636128_2637001_-	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_087769655.1|2637627_2638536_+	serine hydrolase	NA	NA	NA	NA	NA
WP_100273799.1|2638604_2639778_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	73.4	1.3e-134
WP_100273924.1|2639944_2640421_+	hypothetical protein	NA	NA	NA	NA	NA
2640412:2640471	attL	GAGACTGTAATTTAAATTGTGTAATTGCCTGTTTTTGATATGTTCACTCCAACAATGGAG	NA	NA	NA	NA
WP_025378469.1|2640482_2641691_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
WP_100273925.1|2642091_2643177_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100273802.1|2643148_2644662_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_100273926.1|2644738_2645221_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_025378471.1|2646217_2646805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087769681.1|2647458_2648608_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.8	3.7e-49
WP_100273927.1|2648571_2648790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378473.1|2649408_2650632_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_175020558.1|2651418_2651886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378476.1|2652011_2652434_-	hypothetical protein	NA	I6S1K6	Salmonella_phage	52.1	6.6e-36
WP_025378477.1|2652434_2652881_-	SocA family protein	NA	I6R0L8	Salmonella_phage	64.9	2.1e-53
WP_025378478.1|2653305_2653695_-	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	59.6	2.5e-34
WP_025378479.1|2653697_2654102_-	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	81.3	7.1e-56
WP_025378480.1|2654108_2655266_-	DUF3383 family protein	NA	H9C1A2	Pectobacterium_phage	76.4	1.5e-170
WP_025378481.1|2655249_2655810_-	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	64.6	2.6e-56
WP_025378482.1|2655809_2656229_-	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	73.6	3.2e-59
WP_025378483.1|2656231_2656699_-	hypothetical protein	NA	H9C199	Pectobacterium_phage	79.4	3.1e-63
WP_025378484.1|2656695_2657103_-	DUF4054 domain-containing protein	NA	H9C198	Pectobacterium_phage	72.1	1.6e-47
WP_025378485.1|2657127_2657508_-	hypothetical protein	NA	H9C197	Pectobacterium_phage	37.3	4.1e-13
WP_025378486.1|2657510_2658446_-	DUF2184 domain-containing protein	NA	H9C196	Pectobacterium_phage	83.3	4.1e-147
WP_100273928.1|2658464_2659001_-	hypothetical protein	NA	H9C195	Pectobacterium_phage	68.3	1.1e-51
WP_025378488.1|2659000_2660200_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	73.2	2.4e-123
WP_025378489.1|2660211_2660961_-|head	phage head morphogenesis protein	head	H9C193	Pectobacterium_phage	74.7	1.9e-102
WP_025378490.1|2661019_2662405_-	DUF1073 domain-containing protein	NA	H9C192	Pectobacterium_phage	69.2	6.4e-189
WP_025378491.1|2662407_2664051_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	85.2	3.7e-292
WP_012105237.1|2664176_2664416_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	63.3	5.2e-22
WP_025378492.1|2664405_2664690_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	75.5	1.4e-34
WP_025378493.1|2664700_2665717_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	42.5	3.9e-42
WP_025378494.1|2665796_2666237_+	hypothetical protein	NA	U5P096	Shigella_phage	38.4	2.0e-19
WP_042546137.1|2666438_2666693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378496.1|2666695_2667310_-	hypothetical protein	NA	C9E2P8	Enterococcus_phage	62.2	2.8e-67
WP_025378497.1|2667306_2667816_-	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	50.6	1.0e-35
WP_100274022.1|2668199_2668733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378499.1|2668969_2669296_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_100273929.1|2669288_2669819_-	lysozyme	NA	Q7Y3V3	Yersinia_phage	71.4	2.1e-71
WP_100273930.1|2669818_2670034_-	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	54.0	8.8e-13
WP_025378502.1|2670301_2671723_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_025378503.1|2671764_2672616_-	DNA adenine methylase	NA	A0A2H4UUI2	Bodo_saltans_virus	28.4	7.1e-13
WP_025378504.1|2672744_2673110_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	69.9	6.2e-43
WP_025378505.1|2673151_2673430_-	DUF1364 domain-containing protein	NA	H9C174	Pectobacterium_phage	80.3	4.0e-26
WP_100273802.1|2673430_2674943_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_025378506.1|2675060_2675654_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	57.9	1.3e-61
WP_072098758.1|2675601_2675817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378507.1|2675727_2675910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273931.1|2676057_2678118_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.1	2.0e-234
WP_025378509.1|2678114_2678615_-	hypothetical protein	NA	H9C166	Pectobacterium_phage	43.1	9.5e-18
WP_025378510.1|2678629_2679037_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	45.7	1.4e-30
WP_025378511.1|2679080_2680094_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	54.3	7.3e-41
WP_025378512.1|2680106_2680295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378513.1|2680287_2680539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378514.1|2680552_2680993_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.6	3.7e-34
WP_042546153.1|2681033_2681231_-	helix-turn-helix domain-containing protein	NA	H9C161	Pectobacterium_phage	47.5	1.6e-08
WP_025378515.1|2681313_2681706_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	54.5	1.5e-29
WP_025378516.1|2681878_2682097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273932.1|2682118_2682292_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_025378517.1|2682305_2682638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378518.1|2682826_2683141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378519.1|2683154_2685308_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	36.0	7.1e-102
WP_025378520.1|2685304_2685817_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	46.5	3.3e-34
WP_025378521.1|2685889_2686156_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	42.9	1.1e-09
WP_025378522.1|2686130_2687213_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.4	2.0e-105
WP_025378469.1|2687530_2688739_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
2688751:2690048	attR	CTCCATTGTTGGAGTGAACATATCAAAAACAGGCAATTACACAATTTAAATTACAGTCTCGTTTTCACTTTTACCATGGTAATTATTTGTTAAATATAGACTAATACTCATAAGTGCCAGGACATCAACTATTTTTGGCACAATGTCATGGCACGTTGTTGGAAAGGTTCCAGACTCATCTTTTGGCCCGGTCTATCATTATCATCCAATAACAAAACATCTAACGGTTTTGCCAGAACATGACCAGATTTCATCTGTTCTGTTGCCGTGTCATTTAGCGGGTATTGCACCAATGTACTCGGATTTATCACAAATAAAGCACCACCTGTACGGCATTCCAGCATCACTTCTTCGCGATTAAATGCCCATTGTTTACCAAATTCAAACTTACTGACCGTAATAATCTGACCGGCAGCAATAGCGTTAACTGATAACATAAATAGCGATAATGTCAGCACAAAACCCTTCATCATAATTACCTTTAATGAACTGATTATTTTGATTTTCTCTCATACTGAGGCGCTGATGCAAGCGCTCTGGCACTCTCTGTTAAGTCTAATTTCGCGCTATACTGGGGCCATAGTTGCAAAAACACTCACCAACAGTAGTACCCCCGCGCCAAGGATAATTTCAGCACAGCTGTTTATCACTAGCCAGTCGTGGGCCTTCGTCGGCAATTGCCGCAGCATTGGCACAATGAGATAGCGGTTAATCAGTGCCACAAAGATCATTAATAACACTAGGATAACTTTGCTCAGTAAGAGTATCTGATAAGCAGAAGTCAGCGCCAGCGGGGTCTCACGTAGCATAATGATACTGTTGATAACACCGGTTGCTAACACTAAAGCTACCGCCAAATGCCCCCAGGTTGAAAAACGAATCAGCGTAGTGATAGCTTCGCGTTTGACATCACTATTCCGGGTATATGCCAGACAAATTAAAAGTGGAGCCAGACATCCCACCCAATAGCCAGAACTAAGCAAGTGTATGATTTGATTTGTTTTATGAATCCATCCCAGTACACCATCATGCATCGCCGCATGACCGGTAAAAGCCAAGCTGGCCAGTAATAGTGTTGATAATCCAGCCATTAAGCACGAATAAACGCGGCTGGGGGTGAGTAAAACCAGCCATATGCTCAACATTGATAGACCGAGATGCCATTGCCATACCTGACCAAAACGGGTATTAAATACCGCCCACCAGACACTCAATCTATAGGTATCAGACCAACCATCGCCCATCATCCCCGCCTGAATGGCGAGAAGTCCGATAGCAGAGGCGAGCGCCAAAAAGGT	NA	NA	NA	NA
>prophage 14
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	2768004	2830489	4722762	tail,integrase,head,transposase,plate,terminase	Pectobacterium_phage(50.94%)	80	2768690:2768704	2829331:2829345
WP_001310555.1|2768004_2769021_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
2768690:2768704	attL	AAGGCGCTATCCAGG	NA	NA	NA	NA
WP_175020559.1|2769065_2769902_+	acyltransferase	NA	NA	NA	NA	NA
WP_100273935.1|2769945_2770642_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	57.6	3.6e-79
WP_025378593.1|2770782_2771988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378594.1|2772099_2773224_-	LPS O-antigen chain length determinant protein WzzB	NA	NA	NA	NA	NA
WP_175020560.1|2773684_2773885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378596.1|2774293_2774599_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025378597.1|2774669_2775071_-	four helix bundle protein	NA	NA	NA	NA	NA
WP_025378598.1|2775069_2776326_+	RNA-directed DNA polymerase	NA	A0A0C5K882	ANMV-1_virus	33.7	5.7e-35
WP_025378599.1|2776670_2777138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175020561.1|2778153_2778411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378601.1|2778730_2779633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378602.1|2779784_2780705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378603.1|2780882_2783177_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_100273935.1|2783379_2784076_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	57.6	3.6e-79
WP_175020562.1|2785248_2785584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273936.1|2785620_2786109_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	53.3	6.7e-16
WP_025378607.1|2787126_2787771_-	DUF2612 domain-containing protein	NA	H9C1B4	Pectobacterium_phage	48.5	8.5e-43
WP_025378608.1|2787763_2788963_-|plate	baseplate J/gp47 family protein	plate	H9C1B3	Pectobacterium_phage	66.5	2.5e-149
WP_025378609.1|2788962_2789313_-	hypothetical protein	NA	H9C1B2	Pectobacterium_phage	65.5	2.2e-37
WP_025378610.1|2790069_2790963_-	hypothetical protein	NA	H9C1B0	Pectobacterium_phage	47.1	4.6e-79
WP_025378611.1|2790955_2791246_-	hypothetical protein	NA	H9C1A9	Pectobacterium_phage	56.2	1.0e-24
WP_019079697.1|2791245_2791914_-	hypothetical protein	NA	H9C1A8	Pectobacterium_phage	48.9	6.7e-35
WP_025378612.1|2791913_2793578_-	glycoside hydrolase family 104 protein	NA	H9C1A7	Pectobacterium_phage	50.3	5.1e-140
WP_025378613.1|2793687_2794197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378614.1|2794198_2795425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_175020563.1|2795655_2795871_-	hypothetical protein	NA	B5AX68	Iodobacteriophage	48.7	6.1e-06
WP_025378615.1|2795810_2796200_-	hypothetical protein	NA	H9C1A4	Pectobacterium_phage	60.5	1.5e-34
WP_025378479.1|2796202_2796607_-	hypothetical protein	NA	H9C1A3	Pectobacterium_phage	81.3	7.1e-56
WP_025378616.1|2796613_2797771_-	DUF3383 family protein	NA	H9C1A2	Pectobacterium_phage	75.1	4.0e-168
WP_025378617.1|2797754_2798315_-	hypothetical protein	NA	H9C1A1	Pectobacterium_phage	62.9	2.2e-55
WP_025378618.1|2798314_2798734_-	hypothetical protein	NA	H9C1A0	Pectobacterium_phage	73.6	6.5e-60
WP_025378619.1|2798736_2799204_-	hypothetical protein	NA	H9C199	Pectobacterium_phage	77.4	1.6e-62
WP_025378620.1|2799200_2799608_-	DUF4054 domain-containing protein	NA	H9C198	Pectobacterium_phage	73.5	3.8e-49
WP_025378621.1|2799632_2800013_-	hypothetical protein	NA	H9C197	Pectobacterium_phage	38.6	4.9e-14
WP_025378622.1|2800015_2800951_-	DUF2184 domain-containing protein	NA	H9C196	Pectobacterium_phage	82.6	1.6e-146
WP_025378623.1|2800969_2801494_-	hypothetical protein	NA	H9C195	Pectobacterium_phage	68.3	1.4e-51
WP_100273937.1|2801493_2802693_-	DUF2213 domain-containing protein	NA	H9C194	Pectobacterium_phage	72.7	1.3e-121
WP_050883109.1|2802704_2803454_-|head	phage head morphogenesis protein	head	H9C193	Pectobacterium_phage	77.5	9.7e-107
WP_100273938.1|2803512_2804898_-	DUF1073 domain-containing protein	NA	H9C192	Pectobacterium_phage	68.9	1.4e-188
WP_050941910.1|2804900_2806544_-|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	85.2	2.8e-292
WP_012105237.1|2806669_2806909_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	63.3	5.2e-22
WP_025378492.1|2806898_2807183_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	75.5	1.4e-34
WP_025378624.1|2807193_2808201_-|terminase	terminase small subunit	terminase	I6X6R5	Burkholderia_virus	42.5	6.6e-42
WP_025378625.1|2808280_2808721_+	hypothetical protein	NA	U5P096	Shigella_phage	38.4	2.6e-19
WP_025378495.1|2808922_2809177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378626.1|2809179_2809794_-	hypothetical protein	NA	C9E2P8	Enterococcus_phage	62.6	3.6e-67
WP_025378627.1|2809790_2810300_-	ParB N-terminal domain-containing protein	NA	M4SQC2	Psychrobacter_phage	65.8	1.0e-35
WP_025378628.1|2810535_2810772_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	53.3	3.0e-14
WP_100273939.1|2810799_2811321_-	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	79.2	6.8e-67
WP_100274024.1|2811409_2811910_-	lysozyme	NA	I6PBN2	Cronobacter_phage	58.4	6.8e-48
WP_025378631.1|2811934_2812246_-	hypothetical protein	NA	O64361	Escherichia_phage	53.1	8.0e-23
WP_100273940.1|2812402_2812585_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	50.8	4.8e-12
WP_025378632.1|2812641_2813055_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.3	7.1e-19
WP_025378633.1|2813251_2813929_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	30.5	2.0e-18
WP_025378634.1|2813928_2814216_-	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	71.6	3.2e-34
WP_025378635.1|2814224_2814818_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	57.9	9.8e-62
WP_025378636.1|2814894_2815077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273941.1|2815397_2817593_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.2	6.1e-234
WP_025378637.1|2817589_2817799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378638.1|2817791_2818001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378639.1|2817990_2818554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378641.1|2818654_2819212_-	hypothetical protein	NA	H9C166	Pectobacterium_phage	45.3	3.5e-21
WP_100273942.1|2819227_2819638_-	hypothetical protein	NA	A0A2P1JUB0	Erwinia_phage	61.5	3.9e-41
WP_100273943.1|2819627_2820035_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	48.0	1.8e-30
WP_025378644.1|2821252_2821504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378645.1|2821518_2821959_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	54.5	3.5e-32
WP_025378646.1|2821999_2822251_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025378647.1|2822354_2822762_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	31.7	3.5e-10
WP_025378648.1|2823046_2823250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378649.1|2823278_2823533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273944.1|2823573_2823747_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_025378650.1|2823760_2824093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378651.1|2824310_2824541_+	hypothetical protein	NA	A0A2H4JG91	uncultured_Caudovirales_phage	47.1	9.4e-13
WP_175020564.1|2824639_2824954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378653.1|2824967_2827115_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.1	7.1e-102
WP_100273945.1|2827111_2827681_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	43.2	4.4e-27
WP_025378655.1|2827753_2828005_+	excisionase	NA	NA	NA	NA	NA
WP_100273946.1|2827979_2829113_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.2	1.1e-151
WP_025378658.1|2829235_2830489_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	5.2e-20
2829331:2829345	attR	CCTGGATAGCGCCTT	NA	NA	NA	NA
>prophage 15
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	3313689	3322326	4722762		Escherichia_phage(71.43%)	10	NA	NA
WP_087768663.1|3313689_3316113_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	56.1	1.5e-262
WP_025379026.1|3316124_3316742_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	69.3	4.4e-89
WP_087768662.1|3316745_3317522_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	1.2e-40
WP_025379027.1|3317615_3318245_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	45.5	4.5e-41
WP_025379028.1|3318258_3318573_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_025379029.1|3318769_3319210_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	45.3	9.6e-22
WP_086017141.1|3319467_3319542_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_025379030.1|3319615_3320140_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	53.8	8.2e-28
WP_087768661.1|3320383_3321622_-	alanine transaminase	NA	NA	NA	NA	NA
WP_087768660.1|3321753_3322326_-	GNAT family N-acetyltransferase	NA	D0R097	Streptococcus_phage	27.9	1.5e-11
>prophage 16
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	3338078	3390114	4722762	protease,capsid,tail,portal,integrase,head,holin,transposase,tRNA,plate,terminase	Shigella_phage(24.44%)	68	3331103:3331118	3391189:3391204
3331103:3331118	attL	AATCACAATATCGCCG	NA	NA	NA	NA
WP_025379038.1|3338078_3339494_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_025379040.1|3340062_3340623_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_025379041.1|3340766_3341108_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_025379042.1|3341181_3341397_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_025379044.1|3343507_3344482_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_025379045.1|3344701_3345469_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_025379046.1|3345938_3346199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100274028.1|3346504_3347194_-|tail	phage tail protein	tail	A9YX14	Burkholderia_phage	50.4	1.4e-48
WP_025379049.1|3347563_3348145_-	YmfQ family protein	NA	O22003	Shigella_phage	63.4	1.5e-70
WP_025379050.1|3348135_3349194_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	62.8	3.6e-131
WP_023160382.1|3349186_3349600_-	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	59.1	1.2e-42
WP_025379051.1|3349603_3350170_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	49.7	1.1e-33
WP_025379052.1|3350169_3351243_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	64.9	7.3e-132
WP_025379053.1|3351239_3352544_-	DNA circularization N-terminal domain-containing protein	NA	S5FUX4	Shigella_phage	54.9	3.0e-132
WP_100273955.1|3352613_3352979_-	hypothetical protein	NA	R9TR46	Vibrio_phage	63.4	1.6e-22
WP_025379056.1|3353031_3354912_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	54.2	1.9e-175
WP_025379057.1|3355035_3355317_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_025379058.1|3355313_3355670_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	85.6	1.0e-53
WP_025379059.1|3355670_3357164_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	68.2	3.3e-183
WP_019081889.1|3357160_3357367_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	71.4	3.9e-10
WP_025379061.1|3357373_3357925_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	53.8	3.7e-55
WP_025379062.1|3357921_3358446_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	56.5	5.3e-43
WP_025379063.1|3358445_3358838_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_025379064.1|3358834_3359149_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	51.9	2.3e-25
WP_025379065.1|3359167_3359401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025379066.1|3359453_3360662_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	78.8	3.6e-180
WP_025379067.1|3360677_3361328_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	81.9	2.4e-101
WP_019083767.1|3361317_3362547_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	80.7	2.0e-189
WP_019083768.1|3362546_3362735_-	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	55.6	1.1e-08
WP_025379069.1|3362745_3364476_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	61.0	5.2e-212
WP_019081899.1|3364478_3364934_-|terminase	P27 family phage terminase small subunit	terminase	A0A1J0GV10	Halomonas_phage	53.7	9.6e-25
WP_025379070.1|3365128_3365479_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	66.4	2.7e-43
WP_175020565.1|3365447_3365696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025379071.1|3365907_3366240_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_025379072.1|3366236_3366863_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	63.6	3.1e-66
WP_025377658.1|3366866_3367217_-|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	58.3	1.8e-26
WP_050875046.1|3367443_3367710_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_025379073.1|3367686_3367866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025379074.1|3367996_3369043_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	60.8	5.5e-124
WP_025379075.1|3369398_3370142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025379076.1|3370287_3370710_-	antitermination protein Q	NA	S5M7R9	Escherichia_phage	57.7	2.1e-34
WP_025379077.1|3370706_3371732_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.8	2.9e-93
WP_025379078.1|3371728_3372532_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	61.5	2.0e-86
WP_025379079.1|3372791_3373154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025379080.1|3373143_3373479_-	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	46.4	2.1e-21
WP_025379081.1|3373475_3373853_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	65.0	5.5e-42
WP_025379082.1|3373849_3374563_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	71.3	4.1e-91
WP_025379083.1|3374555_3374987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025379084.1|3374983_3376000_-	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	74.0	1.3e-32
WP_025379085.1|3375996_3376194_-	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	52.0	1.2e-08
WP_025379086.1|3376359_3376887_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	29.7	4.8e-12
WP_175020566.1|3376938_3377694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025379088.1|3377743_3377941_-	regulatory protein	NA	A0A1W6JP24	Morganella_phage	63.8	1.6e-16
WP_019083786.1|3378043_3378685_+	LexA family transcriptional regulator	NA	A0A1W6JP50	Morganella_phage	62.0	2.2e-59
WP_025379089.1|3378838_3379243_+	ClpX C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_025379090.1|3379239_3379473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273956.1|3379835_3380255_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	47.1	1.7e-20
WP_087769681.1|3380300_3381450_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.8	3.7e-49
WP_100273957.1|3381497_3382022_+	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	42.6	6.2e-28
WP_025379093.1|3382099_3382630_+	hypothetical protein	NA	A0A291AX04	Escherichia_phage	58.7	1.1e-51
WP_025379094.1|3382802_3383330_+	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	79.4	5.4e-80
WP_100273958.1|3383949_3384582_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	62.7	1.9e-55
WP_100273959.1|3384571_3384988_+	polyphosphate kinase	NA	NA	NA	NA	NA
WP_025379097.1|3385044_3385287_+	excisionase	NA	NA	NA	NA	NA
WP_025379098.1|3385270_3386395_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	57.2	2.0e-116
WP_025379099.1|3386665_3387634_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.8	1.1e-73
WP_004712628.1|3388081_3388339_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_025379100.1|3388386_3390114_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	27.6	9.3e-20
3391189:3391204	attR	CGGCGATATTGTGATT	NA	NA	NA	NA
>prophage 17
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	3571503	3634522	4722762	capsid,tail,portal,integrase,head,holin,transposase,tRNA,plate,terminase	Cronobacter_phage(57.5%)	76	3577482:3577497	3641640:3641655
WP_025379230.1|3571503_3572073_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	37.1	7.3e-06
WP_025379231.1|3572204_3573254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087769375.1|3573312_3573963_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_087769369.1|3574112_3575000_-	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_025379233.1|3575201_3576044_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025379234.1|3576105_3576366_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	7.1e-17
WP_025379235.1|3576443_3577787_-	gluconate permease GntP	NA	NA	NA	NA	NA
3577482:3577497	attL	AAACTCAACATATTTA	NA	NA	NA	NA
WP_025379236.1|3578211_3578592_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_087769370.1|3578591_3579323_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_025379237.1|3579491_3580217_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_025379238.1|3580226_3581138_-	GTPase Era	NA	NA	NA	NA	NA
WP_025379239.1|3581134_3581815_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	30.8	6.9e-19
WP_025379240.1|3582120_3583119_-	signal peptidase I	NA	NA	NA	NA	NA
WP_087769372.1|3583128_3584928_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.7	2.6e-25
WP_025379241.1|3585295_3586135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087769373.1|3586146_3586608_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_025379242.1|3586604_3587561_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_025379243.1|3587560_3588217_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_005159396.1|3588241_3588817_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	27.4	8.2e-05
WP_087769374.1|3589005_3590643_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_087769376.1|3590721_3591477_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_025379246.1|3591600_3592917_+	ATP-dependent RNA helicase SrmB	NA	A0A1V0SIR5	Klosneuvirus	30.6	4.7e-48
WP_025379247.1|3592995_3593652_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_025379248.1|3593740_3594709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005188661.1|3594929_3595313_-	autonomous glycyl radical cofactor GrcA	NA	A0A1W5N098	Cronobacter_phage	69.2	6.8e-32
WP_025379249.1|3595665_3596352_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	2.1e-52
WP_025379250.1|3596422_3597001_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_025379251.1|3597124_3598006_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_087768833.1|3598074_3599754_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_025379253.1|3599867_3600209_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_025379254.1|3600362_3600647_-	RnfH family protein	NA	NA	NA	NA	NA
WP_087768832.1|3600639_3601128_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_025379256.1|3601234_3601717_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	2.0e-28
WP_025379257.1|3602246_3603017_+	TdeIII family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_025379258.1|3603054_3604422_-	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	35.1	6.6e-53
WP_025379259.1|3604651_3604864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273966.1|3604862_3605072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025379260.1|3605039_3606695_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	53.2	3.3e-168
WP_025379261.1|3606691_3607237_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	64.3	3.1e-54
WP_025379262.1|3607202_3607934_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	46.7	1.4e-41
WP_025379263.1|3607923_3608409_-|tail	tail fiber assembly protein	tail	F1BUP0	Erwinia_phage	47.4	3.9e-40
WP_100273967.1|3608424_3610095_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	65.2	2.9e-119
WP_025379266.1|3610094_3610703_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.1	7.9e-67
WP_025379267.1|3610695_3611880_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	66.5	1.4e-152
WP_025379268.1|3611872_3612205_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	68.3	2.0e-35
WP_025379269.1|3612204_3614181_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	48.4	1.6e-172
WP_025379270.1|3614368_3614635_-|tail	putative phage tail assembly chaperone	tail	A5X9I7	Aeromonas_virus	54.9	4.6e-19
WP_080358387.1|3614636_3614828_-	hypothetical protein	NA	F1BUL1	Cronobacter_phage	61.4	3.9e-12
WP_025379271.1|3614784_3615126_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	43.0	7.4e-14
WP_005171218.1|3615125_3615467_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	81.2	6.9e-44
WP_012303689.1|3615463_3615754_-|holin	holin	holin	Q6K1I2	Salmonella_virus	52.8	2.2e-14
WP_025379272.1|3615763_3616219_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	62.3	1.5e-46
WP_025379273.1|3616215_3617355_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	67.3	4.5e-140
WP_025379275.1|3618054_3618546_-|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	44.5	3.2e-34
WP_025379276.1|3618542_3618995_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	56.0	5.2e-39
WP_025379277.1|3619090_3619789_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	51.3	5.5e-64
WP_025379278.1|3619798_3620830_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	73.7	1.5e-142
WP_025379279.1|3620884_3621736_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	47.0	8.0e-65
WP_025379280.1|3621902_3623690_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	66.4	5.9e-235
WP_025379281.1|3623686_3624712_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	66.6	4.5e-139
WP_004389556.1|3624762_3625035_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	67.4	7.0e-31
WP_025379282.1|3625035_3625224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273968.1|3625331_3627419_-	replication endonuclease	NA	F1BUM9	Cronobacter_phage	61.5	7.3e-229
WP_025379284.1|3627415_3627655_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_025379285.1|3627733_3628141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025379286.1|3628150_3628525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004389549.1|3628527_3628731_-	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_025379287.1|3628738_3629254_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	51.2	1.3e-38
WP_025379288.1|3629275_3629524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100273969.1|3629626_3630217_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	44.2	1.5e-41
WP_100273970.1|3630228_3631290_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	77.4	4.8e-160
WP_025379290.1|3631626_3631941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025379291.1|3632184_3632445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087768823.1|3632453_3632699_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	51.3	7.0e-14
WP_025379293.1|3632884_3633151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100273799.1|3633348_3634522_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	73.4	1.3e-134
3641640:3641655	attR	AAACTCAACATATTTA	NA	NA	NA	NA
>prophage 18
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	3829042	3900715	4722762	transposase,protease,tRNA	uncultured_virus(21.43%)	52	NA	NA
WP_025379454.1|3829042_3830482_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	31.1	3.2e-26
WP_100273983.1|3830792_3832310_-	dGTPase	NA	NA	NA	NA	NA
WP_025379456.1|3832622_3833324_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_025379457.1|3833323_3834184_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_025379458.1|3834183_3834798_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_025379459.1|3835024_3835327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004706254.1|3835505_3835850_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.9	2.7e-27
WP_025379460.1|3835967_3837401_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_025379461.1|3837668_3838949_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_025379462.1|3839270_3841268_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_025379463.1|3841264_3842194_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_025379464.1|3842193_3842988_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	29.0	1.2e-14
WP_025379465.1|3843234_3845721_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_025379467.1|3848518_3849091_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_025379468.1|3849080_3849824_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_005156764.1|3850003_3850459_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_025379469.1|3850527_3851472_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_087768636.1|3851534_3853076_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	36.4	9.5e-24
WP_025379471.1|3853084_3853564_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_087768635.1|3853640_3854441_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_025379473.1|3854473_3855328_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_025379474.1|3855498_3855879_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_025379475.1|3855958_3857269_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_025379476.1|3857520_3858291_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025379477.1|3858287_3859214_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.0	3.1e-22
WP_025379478.1|3859450_3860107_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_087768634.1|3860210_3860747_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	4.3e-16
WP_025379480.1|3860861_3862463_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	52.1	8.1e-18
WP_016266377.1|3862713_3863061_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_025379481.1|3863173_3864037_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_025379482.1|3864061_3864856_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_025379483.1|3864985_3865867_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_025379484.1|3865990_3866353_-	YacL family protein	NA	NA	NA	NA	NA
WP_025379485.1|3866520_3869118_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_025379486.1|3869543_3871841_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_025379487.1|3872050_3873058_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_100273799.1|3873122_3874297_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	73.4	1.3e-134
WP_100273984.1|3874400_3875261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378469.1|3875320_3876529_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
WP_004706221.1|3876750_3878178_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.7	1.0e-40
WP_025379488.1|3878464_3880312_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_025379489.1|3880326_3882990_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_025379490.1|3883186_3883951_-	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_087769077.1|3884647_3886024_+	amino acid permease	NA	NA	NA	NA	NA
WP_175020567.1|3886109_3886343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087769681.1|3886638_3887788_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.8	3.7e-49
WP_100273986.1|3887816_3894791_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_025379493.1|3895213_3896068_-	beta-lactamase regulator AmpE	NA	NA	NA	NA	NA
WP_025379494.1|3896201_3896759_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1B0T6G1	Thiobacimonas_phage	30.6	3.3e-11
WP_025379495.1|3896872_3897781_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_100273799.1|3898041_3899215_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	73.4	1.3e-134
WP_025378469.1|3899506_3900715_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
>prophage 19
NZ_CP007448	Yersinia enterocolitica LC20, complete genome	4722762	4606984	4678525	4722762	transposase,tRNA,integrase	Enterobacteria_phage(15.79%)	57	4605939:4605953	4609919:4609933
4605939:4605953	attL	TGATCCGCAGCATGA	NA	NA	NA	NA
WP_025380022.1|4606984_4608217_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	66.0	6.4e-156
WP_100274000.1|4608213_4608921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050879328.1|4609242_4609455_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_005175974.1|4609521_4609653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380024.1|4609851_4610031_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
4609919:4609933	attR	TCATGCTGCGGATCA	NA	NA	NA	NA
WP_025380025.1|4610023_4610377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025380026.1|4610427_4610721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025380027.1|4610717_4611062_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_025380028.1|4611072_4613736_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	32.4	4.1e-107
WP_025380029.1|4614028_4614271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380030.1|4614426_4615134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100274001.1|4615130_4615352_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	53.4	4.8e-14
WP_100273802.1|4615396_4616909_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087769681.1|4617382_4618533_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.8	3.7e-49
WP_025380031.1|4618648_4620736_+	ATP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025378469.1|4620834_4622043_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
WP_100273799.1|4622107_4623282_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	73.4	1.3e-134
WP_025380034.1|4623915_4625100_+	nucleoside permease	NA	NA	NA	NA	NA
WP_025380035.1|4625198_4625663_-	DUF3574 domain-containing protein	NA	NA	NA	NA	NA
WP_005165881.1|4625973_4626591_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_025380036.1|4626605_4628300_-	NAD-dependent DNA ligase LigB	NA	A0A1Y0SVC9	Pseudomonas_phage	22.9	3.1e-20
WP_025380037.1|4628585_4629209_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	37.5	1.7e-19
WP_004392061.1|4629263_4629539_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_025380038.1|4629557_4631660_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	3.6e-10
WP_025380039.1|4631665_4632358_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_025380040.1|4632358_4634440_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_087769510.1|4634475_4635690_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_025380041.1|4635929_4637315_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	80.7	2.9e-56
WP_025380042.1|4637461_4639171_+	AsmA family protein	NA	NA	NA	NA	NA
WP_025380043.1|4639484_4640171_-	helix-turn-helix transcriptional regulator	NA	A2I306	Vibrio_virus	26.8	1.1e-16
WP_025380044.1|4640192_4640879_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025380045.1|4640897_4641143_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	58.2	1.3e-15
WP_025380046.1|4641494_4642418_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_025380047.1|4642491_4642929_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_025380048.1|4642935_4643820_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_025380049.1|4643912_4644500_-	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_025380050.1|4644785_4646609_-	ribosome-dependent GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	42.3	1.5e-20
WP_025380052.1|4647123_4648533_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_025380053.1|4648684_4649734_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.3	1.9e-07
WP_025380054.1|4649741_4651154_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	26.4	4.0e-05
WP_025380055.1|4651194_4652568_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
WP_071817881.1|4652570_4652738_-	high mobility group protein Z	NA	NA	NA	NA	NA
WP_025380056.1|4652750_4653317_-	Der GTPase-activating protein YihI	NA	NA	NA	NA	NA
WP_025380057.1|4654080_4654731_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_087769511.1|4655169_4657962_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.4	5.6e-75
WP_025380059.1|4658553_4659177_-	thiol:disulfide interchange protein DsbA	NA	NA	NA	NA	NA
WP_025380060.1|4659204_4660191_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_025380062.1|4660706_4661297_+	molybdenum cofactor guanylyltransferase MobA	NA	NA	NA	NA	NA
WP_025380063.1|4661293_4661821_+	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_025380064.1|4667658_4668348_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025380065.1|4668415_4669840_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
WP_025380066.1|4669836_4670838_-	ribose operon transcriptional repressor RbsR	NA	C6ZCU4	Enterobacteria_phage	29.8	8.6e-34
WP_025380067.1|4670840_4671767_-	ribokinase	NA	NA	NA	NA	NA
WP_025380068.1|4671858_4672749_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	25.5	3.9e-06
WP_025380070.1|4673737_4675258_-	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	5.0e-17
WP_025380071.1|4675265_4675685_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_025378208.1|4677319_4678525_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP007449	Yersinia enterocolitica LC20 plasmid plasmid1_80K, complete sequence	78924	101	51931	78924	protease,integrase,transposase	Salmonella_phage(22.22%)	51	63:75	34031:34043
63:75	attL	GCTCGCTGTCCTG	NA	NA	NA	NA
WP_100274053.1|101_881_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.8	2.5e-20
WP_100274035.1|1352_2108_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_025380114.1|2808_3588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025380115.1|3714_4653_+	DUF2971 domain-containing protein	NA	J9Q7Y9	Salmonella_phage	24.3	8.3e-07
WP_100274036.1|4705_5281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025378469.1|5314_6523_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
WP_025380119.1|6894_7173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380120.1|7255_7561_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_025380121.1|7572_7869_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A222YWE2	Escherichia_phage	50.5	3.5e-20
WP_025380122.1|8077_8365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025380124.1|9173_9410_+	hypothetical protein	NA	H2DE32	Erwinia_phage	55.9	4.8e-12
WP_025380073.1|9594_9783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025380198.1|9792_10992_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_175020571.1|11282_11498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087769708.1|11785_12784_+	Abi family protein	NA	NA	NA	NA	NA
WP_087769709.1|13221_13623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025378473.1|13980_15204_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025380126.1|15559_15934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025380127.1|15945_17169_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025380128.1|18521_19388_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_100274054.1|19380_19455_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_025380129.1|19688_19940_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_025380130.1|20077_20623_-	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	34.3	2.5e-19
WP_025380131.1|20766_21498_-	type-F conjugative transfer system pilin acetylase TraX	NA	NA	NA	NA	NA
WP_025380132.1|21494_22061_-	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_100274037.1|22078_27400_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_025378469.1|29700_30909_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.7	1.0e-49
WP_100274038.1|31100_31592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380134.1|31682_32291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380135.1|32277_35127_-	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
34031:34043	attR	CAGGACAGCGAGC	NA	NA	NA	NA
WP_025380136.1|35128_36490_-	F-type conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_025380137.1|36492_37095_-	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_025380138.1|37102_37879_-	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_025380140.1|39697_40315_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_100274039.1|40314_40689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380142.1|40700_41699_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_025380143.1|41698_42337_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_025380144.1|42333_42783_-	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_025380145.1|42779_45371_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_100274040.1|45381_45954_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_100274041.1|45972_46413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100274055.1|46412_46571_-|protease	Clp protease	protease	NA	NA	NA	NA
WP_100274042.1|46620_46818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025380149.1|46818_47043_-	TraR/DksA C4-type zinc finger protein	NA	E5G6L7	Salmonella_phage	36.6	8.3e-06
WP_025380150.1|47151_48513_-	F-type conjugal transfer pilus assembly protein TraB	NA	NA	NA	NA	NA
WP_025380151.1|48499_49240_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_025380152.1|49229_49793_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_025380153.1|49811_50117_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_025380154.1|50118_50475_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_100274043.1|50582_50717_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_087769681.1|50781_51931_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.8	3.7e-49
