The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009706	Hafnia alvei FB1 chromosome, complete genome	4712721	182258	246064	4712721	plate,portal,tail,holin,lysis,terminase,head,capsid,tRNA,integrase	Escherichia_phage(34.78%)	77	209971:209990	239988:240007
WP_025797298.1|182258_184328_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_004094047.1|184335_185268_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_025797296.1|185431_185953_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_038501811.1|186174_186753_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_025797293.1|186756_187209_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_025797291.1|187418_188078_+	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_025797289.1|188198_189218_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_025797287.1|189218_189470_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	88.9	5.6e-11
WP_025797284.1|189702_190368_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	57.8	7.1e-61
WP_025797282.1|190444_190903_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025797280.1|190997_191573_+	DcrB family lipoprotein	NA	NA	NA	NA	NA
WP_025797278.1|191614_193291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025797276.1|193426_194836_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	85.1	4.1e-58
WP_025797274.1|195069_196284_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_025797272.1|196351_198433_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_025797270.1|198435_199128_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_025797268.1|199132_201232_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_004094076.1|201251_201527_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_025797264.1|201581_202205_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.3	9.1e-18
WP_025797262.1|202477_204208_+	NAD-dependent DNA ligase LigB	NA	G3M9X7	Bacillus_virus	20.8	7.1e-20
WP_025797260.1|204134_204752_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_025797258.1|204952_205885_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025797256.1|206020_206896_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_038502586.1|207167_207608_+	DMT family transporter	NA	NA	NA	NA	NA
WP_038501822.1|207610_208078_+	DMT family transporter	NA	NA	NA	NA	NA
WP_025797250.1|208154_209018_-	YicC family protein	NA	NA	NA	NA	NA
WP_025797248.1|209244_209961_+	ribonuclease PH	NA	NA	NA	NA	NA
209971:209990	attL	GCGACTTGTTAGTCGCCTTT	NA	NA	NA	NA
WP_071842597.1|210090_210309_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	69.4	8.6e-24
WP_025797246.1|210386_211559_-	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	72.5	3.8e-158
WP_038501825.1|211555_212041_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	61.6	2.5e-47
WP_038501828.1|212053_214498_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	58.2	2.5e-220
WP_071842598.1|214487_214610_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	82.1	5.5e-12
WP_025801640.1|214642_214951_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	76.1	3.5e-31
WP_025801639.1|215013_215532_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.7	1.3e-78
WP_025801638.1|215544_216732_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	80.8	3.7e-185
WP_080737024.1|216870_217419_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	38.6	3.2e-27
WP_025801636.1|217394_219311_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	70.0	1.7e-75
WP_025801635.1|219315_219855_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	81.1	7.7e-82
WP_025801634.1|219847_220756_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	79.5	3.2e-128
WP_025801633.1|220759_221107_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	72.8	3.6e-40
WP_025801632.1|221103_221742_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	65.7	7.8e-73
WP_025801631.1|221811_222261_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	65.1	8.5e-50
WP_025801630.1|222253_222721_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	70.3	2.0e-57
WP_025801629.1|222816_223242_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	42.3	3.0e-20
WP_038501836.1|223238_223739_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	76.4	4.4e-71
WP_025802856.1|223738_224035_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	76.1	2.9e-30
WP_025802854.1|224038_224242_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	77.6	8.9e-23
WP_025802852.1|224241_224739_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	55.6	4.5e-44
WP_025802850.1|224848_225595_-|terminase	terminase	terminase	Q94MJ2	Enterobacteria_phage	58.6	4.4e-59
WP_025802849.1|225598_226861_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	66.2	1.3e-127
WP_025802847.1|226912_227773_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	62.6	1.3e-91
WP_025802845.1|227916_229689_+|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	79.6	5.2e-276
WP_025802843.1|229689_230439_+	hypothetical protein	NA	O80303	Escherichia_phage	49.6	1.8e-65
WP_025802841.1|230435_231461_+|portal	phage portal protein	portal	A0A0M4S6E8	Salmonella_phage	76.0	2.4e-140
WP_025802837.1|231785_232028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144318843.1|232421_232631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052122994.1|232639_233011_-	hypothetical protein	NA	Q2P9X4	Enterobacteria_phage	57.8	8.6e-16
WP_144318851.1|233022_235314_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	61.1	6.3e-266
WP_025802829.1|235324_235609_-	DUF5405 family protein	NA	A0A218M4I8	Erwinia_phage	50.0	1.9e-18
WP_025802827.1|235624_235915_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_038501847.1|235914_236163_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	46.4	1.1e-06
WP_025801525.1|236228_236729_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	66.3	4.1e-61
WP_167333990.1|236725_236893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025801524.1|237041_237347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025801523.1|237333_237966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025801522.1|237980_238394_-	regulatory protein	NA	Q1JS26	Enterobacteria_phage	71.1	6.0e-34
WP_025801521.1|238499_238799_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	57.3	1.1e-24
WP_025801520.1|238901_239912_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	69.5	4.6e-136
WP_025801519.1|240090_240732_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
239988:240007	attR	GCGACTTGTTAGTCGCCTTT	NA	NA	NA	NA
WP_025801518.1|240792_241389_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_025801517.1|241487_241946_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.8	7.8e-51
WP_025801516.1|241923_243138_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.8	6.5e-44
WP_025801515.1|243316_244003_+	DNA repair protein RadC	NA	A0A1B2LRS6	Wolbachia_phage	30.0	1.8e-19
WP_008815765.1|244240_244477_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|244488_244656_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_025801514.1|244771_245581_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.4	2.0e-25
WP_025801513.1|245584_246064_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	45.7	6.7e-29
>prophage 2
NZ_CP009706	Hafnia alvei FB1 chromosome, complete genome	4712721	1026205	1036249	4712721		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_025801558.1|1026205_1026967_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	2.9e-66
WP_025801557.1|1026960_1027593_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	51.5	1.5e-36
WP_025801556.1|1028000_1028978_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.2	1.6e-05
WP_025801555.1|1029030_1030017_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.0	1.0e-31
WP_025801554.1|1030090_1032649_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	23.9	8.3e-25
WP_071842612.1|1032913_1036249_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	54.5	1.8e-99
>prophage 3
NZ_CP009706	Hafnia alvei FB1 chromosome, complete genome	4712721	1767286	1778847	4712721	tRNA	Escherichia_phage(62.5%)	10	NA	NA
WP_025800950.1|1767286_1768630_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	41.0	2.8e-80
WP_025800951.1|1768738_1770031_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	43.8	3.1e-92
WP_025800952.1|1770514_1772959_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.9e-212
WP_025800953.1|1772969_1773590_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
WP_025800954.1|1773591_1774452_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	36.3	8.7e-27
WP_025800955.1|1774565_1775180_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.2	6.6e-29
WP_025800956.1|1775179_1775767_+	ferredoxin-type protein NapF	NA	A0A077SLP0	Escherichia_phage	37.4	8.6e-26
WP_025800957.1|1775883_1777023_+	MFS transporter	NA	NA	NA	NA	NA
WP_025800958.1|1777098_1777554_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_025800959.1|1778106_1778847_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 4
NZ_CP009706	Hafnia alvei FB1 chromosome, complete genome	4712721	1849120	1929097	4712721	plate,protease	uncultured_Caudovirales_phage(40.0%)	57	NA	NA
WP_038502743.1|1849120_1850698_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_025801009.1|1851074_1851533_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_025801010.1|1851652_1852708_-	porin OmpA	NA	NA	NA	NA	NA
WP_025801011.1|1853065_1853575_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_025801012.1|1853796_1854420_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_025801013.1|1854506_1856642_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_025801014.1|1856653_1857100_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_025801015.1|1857310_1859365_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.1	1.2e-18
WP_025801016.1|1859409_1859868_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_025801017.1|1859972_1860482_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_025801018.1|1860683_1861100_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_025801019.1|1861156_1861477_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_025801020.1|1861634_1862828_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_025801021.1|1862936_1863215_+	acylphosphatase	NA	NA	NA	NA	NA
WP_025801022.1|1863215_1863545_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_008813056.1|1863719_1864382_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	48.1	8.1e-41
WP_025801023.1|1864940_1865726_-	porin	NA	NA	NA	NA	NA
WP_025801024.1|1865816_1867007_-	glycoside hydrolase family 88 protein	NA	NA	NA	NA	NA
WP_025801025.1|1867021_1868284_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_121626085.1|1868317_1870099_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_025801027.1|1870282_1871146_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_038502122.1|1871917_1880815_+	DUF4573 domain-containing protein	NA	NA	NA	NA	NA
WP_025802695.1|1880914_1881910_-	glutaminase A	NA	NA	NA	NA	NA
WP_025802699.1|1883606_1883924_-	DUF4387 domain-containing protein	NA	NA	NA	NA	NA
WP_025802701.1|1883920_1885294_-	acyclic terpene utilization AtuA family protein	NA	NA	NA	NA	NA
WP_025802703.1|1885295_1886540_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_025802707.1|1886539_1887985_-	methylaspartate mutase subunit E	NA	NA	NA	NA	NA
WP_025802709.1|1887999_1889391_-	glutamate mutase L	NA	NA	NA	NA	NA
WP_025802711.1|1889387_1889834_-	methylaspartate mutase subunit S	NA	NA	NA	NA	NA
WP_025802713.1|1890436_1891297_-	GHMP kinase	NA	NA	NA	NA	NA
WP_025802714.1|1891383_1892166_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_025802716.1|1892917_1894453_+	cobyric acid synthase	NA	NA	NA	NA	NA
WP_025802718.1|1894478_1895237_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_025802720.1|1895259_1896324_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_025802722.1|1896356_1897280_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025802724.1|1897441_1899088_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_025802726.1|1899105_1899696_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_038502125.1|1900260_1900905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025802730.1|1901871_1902372_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_038502127.1|1902397_1903951_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_025802734.1|1903969_1905319_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_025802736.1|1905315_1905975_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_025802738.1|1905987_1907697_+	OmpA family protein	NA	NA	NA	NA	NA
WP_025802740.1|1907784_1908276_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_025802742.1|1908483_1911219_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.3	5.0e-92
WP_025802744.1|1911212_1913744_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.6	8.8e-19
WP_025802746.1|1913736_1915887_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	26.4	1.4e-36
WP_052123007.1|1916769_1917249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158413855.1|1917491_1917635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025801644.1|1918679_1918934_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_025801645.1|1918934_1920323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038502752.1|1920324_1923645_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_038502131.1|1923644_1925237_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_025801648.1|1925314_1927078_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_025801649.1|1927041_1928127_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_025801650.1|1928107_1928656_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_025801651.1|1928659_1929097_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 5
NZ_CP009706	Hafnia alvei FB1 chromosome, complete genome	4712721	2294553	2308453	4712721	tRNA	Tupanvirus(33.33%)	14	NA	NA
WP_025801264.1|2294553_2296491_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	1.6e-129
WP_025801265.1|2296486_2297029_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	8.8e-17
WP_025801266.1|2297127_2297325_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_004089950.1|2297367_2297724_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_121626058.1|2297854_2297899_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_025801267.1|2298190_2299174_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.0	1.7e-34
WP_025801268.1|2299188_2301576_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	28.9	6.6e-08
WP_004089944.1|2301580_2301877_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	3.2e-13
WP_025801269.1|2301960_2302158_+	protein DsrB	NA	NA	NA	NA	NA
WP_025801270.1|2302216_2303242_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_052123047.1|2303244_2304030_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2K9L407	Tupanvirus	24.3	4.4e-09
WP_025801272.1|2304313_2305462_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	C7U074	Ostreococcus_tauri_virus	27.8	1.2e-23
WP_025801273.1|2305454_2306471_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.2	1.5e-38
WP_025801274.1|2306470_2308453_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.4	9.6e-21
>prophage 6
NZ_CP009706	Hafnia alvei FB1 chromosome, complete genome	4712721	2392905	2406833	4712721	transposase	uncultured_Caudovirales_phage(80.0%)	12	NA	NA
WP_004118541.1|2392905_2395914_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
WP_004118540.1|2396074_2396632_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_004118538.1|2396763_2397096_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|2397449_2398598_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118534.1|2398872_2399247_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|2399775_2400972_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|2401043_2401871_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.3	4.9e-51
WP_001549885.1|2401889_2403368_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|2403851_2404205_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|2404300_2405584_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|2405633_2406062_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_025801347.1|2406119_2406833_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	5.1e-97
>prophage 7
NZ_CP009706	Hafnia alvei FB1 chromosome, complete genome	4712721	2482336	2550902	4712721	plate,portal,tail,holin,lysis,protease,terminase,head,capsid,tRNA,integrase	Escherichia_phage(25.64%)	75	2518987:2519016	2551009:2551038
WP_025801054.1|2482336_2483611_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1L2CUL7	Pectobacterium_phage	43.1	1.2e-85
WP_025801055.1|2483740_2484394_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_025801056.1|2484695_2485004_-	MliC family protein	NA	NA	NA	NA	NA
WP_025801057.1|2485043_2486159_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_025801058.1|2486531_2487002_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_025801059.1|2487094_2487526_-	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_025801060.1|2487701_2487938_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_025801061.1|2487944_2488805_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_038502230.1|2488817_2490836_+	FUSC family protein	NA	NA	NA	NA	NA
WP_025801062.1|2490840_2491080_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_025801063.1|2491146_2492055_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025801064.1|2492190_2492832_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025801065.1|2493086_2494184_+	alkene reductase	NA	NA	NA	NA	NA
WP_025801066.1|2494380_2494788_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_155397562.1|2494776_2494938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025801067.1|2494959_2495619_+	ribonuclease T	NA	NA	NA	NA	NA
WP_025801068.1|2495740_2496085_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_165490655.1|2496773_2497430_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	36.2	2.4e-16
WP_025801070.1|2497781_2498360_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_020303734.1|2498453_2498543_-	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_025801071.1|2498897_2499923_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	32.1	2.6e-30
WP_025801072.1|2499926_2501573_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025801073.1|2501569_2502196_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_025801074.1|2502198_2503107_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025801075.1|2503247_2504474_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.6	1.0e-12
WP_025801076.1|2504794_2505946_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	48.2	7.4e-90
WP_008813588.1|2506033_2506915_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_025801077.1|2507238_2509269_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.0	6.7e-86
WP_025801078.1|2509288_2509996_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_025801079.1|2510097_2510589_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_025801080.1|2510819_2512064_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_025801081.1|2512032_2514663_+	PqiB family protein	NA	NA	NA	NA	NA
WP_025801082.1|2515164_2515506_-	DHCW motif cupin fold protein	NA	NA	NA	NA	NA
WP_038502234.1|2516259_2517423_+	porin	NA	NA	NA	NA	NA
WP_025801084.1|2517496_2517964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025801085.1|2518117_2518555_-	peptidoglycan-binding protein LysM	NA	NA	NA	NA	NA
2518987:2519016	attL	TCAAGGCCTCATTCGAGGCCTTGATTTTTT	NA	NA	NA	NA
WP_071842597.1|2519112_2519331_-	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	69.4	8.6e-24
WP_025801086.1|2519408_2520578_-	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	72.8	1.2e-151
WP_025801087.1|2520574_2521060_-|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	60.9	3.6e-46
WP_038502236.1|2521072_2523517_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	58.1	2.8e-219
WP_071842628.1|2523506_2523629_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	81.6	1.6e-11
WP_025802769.1|2523661_2523976_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	70.5	1.1e-27
WP_025802767.1|2524032_2524551_-|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	78.5	2.9e-78
WP_025802765.1|2524563_2525751_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	80.8	2.8e-185
WP_025802764.1|2525890_2526412_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	50.0	5.4e-40
WP_025802763.1|2526416_2528411_-|tail	phage tail protein	tail	S4TP62	Salmonella_phage	38.1	1.0e-78
WP_025802762.1|2528415_2528955_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	79.4	4.2e-80
WP_025802761.1|2528947_2529856_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	78.8	4.6e-127
WP_025802760.1|2529859_2530207_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	71.9	3.6e-40
WP_025802759.1|2530203_2530842_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	72.3	6.3e-83
WP_025802758.1|2531230_2532280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025802756.1|2532958_2533408_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	64.6	2.7e-48
WP_025802754.1|2533400_2533868_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	70.3	3.3e-57
WP_025802752.1|2533963_2534389_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	48.2	7.6e-24
WP_038502241.1|2534385_2534886_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	75.8	2.6e-71
WP_025802617.1|2534885_2535182_-|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	71.1	9.3e-29
WP_025802615.1|2535185_2535389_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	3.4e-22
WP_025802613.1|2535388_2535895_-|head	head completion/stabilization protein	head	Q858W4	Yersinia_virus	62.1	8.4e-54
WP_025802611.1|2535988_2536768_-	hypothetical protein	NA	A0A218M4L0	Erwinia_phage	65.1	4.9e-69
WP_025802609.1|2536770_2537865_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	72.5	3.3e-148
WP_025802607.1|2537929_2538775_-|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	63.5	9.0e-93
WP_038502244.1|2538951_2540724_+|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	80.5	2.0e-280
WP_025802603.1|2540723_2541746_+|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	76.0	2.9e-154
WP_144318846.1|2542073_2543147_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_025802599.1|2543158_2543827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025802597.1|2543823_2544531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025802595.1|2544956_2547038_-	replication endonuclease	NA	U5N0W3	Enterobacteria_phage	62.6	2.5e-245
WP_025802593.1|2547071_2547335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025802589.1|2547538_2547820_-	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	46.7	6.3e-19
WP_025802587.1|2547835_2548126_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_038501847.1|2548125_2548374_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	46.4	1.1e-06
WP_025796747.1|2548439_2548940_-	hypothetical protein	NA	U5N0V9	Enterobacteria_phage	63.9	2.5e-58
WP_025796749.1|2549121_2549397_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	72.2	4.1e-31
WP_025796751.1|2549519_2549819_+	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	65.7	7.7e-31
WP_025796753.1|2549918_2550902_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	63.0	6.5e-119
2551009:2551038	attR	TCAAGGCCTCATTCGAGGCCTTGATTTTTT	NA	NA	NA	NA
>prophage 8
NZ_CP009706	Hafnia alvei FB1 chromosome, complete genome	4712721	2835137	2882250	4712721	plate,holin,lysis,terminase,capsid	Erwinia_phage(44.44%)	67	NA	NA
WP_025796608.1|2835137_2835515_-	hypothetical protein	NA	Q6UAV9	Klebsiella_phage	48.8	7.2e-26
WP_025796609.1|2835756_2836122_+	GtrA family protein	NA	F1C5B1	Cronobacter_phage	69.2	1.3e-40
WP_025796611.1|2836118_2837042_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	84.1	6.9e-147
WP_025796613.1|2837038_2838700_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	31.1	9.8e-59
WP_025796615.1|2838727_2841106_-	hypothetical protein	NA	E5AGC7	Erwinia_phage	64.2	1.1e-44
WP_025796617.1|2841105_2841747_-	hypothetical protein	NA	E5AGC6	Erwinia_phage	43.5	1.6e-41
WP_025796619.1|2841746_2841983_-	hypothetical protein	NA	E5AGC5	Erwinia_phage	75.0	2.0e-26
WP_025796621.1|2841990_2842758_-	hypothetical protein	NA	E5AGC4	Erwinia_phage	70.0	7.4e-94
WP_025796623.1|2842735_2844154_-|plate	baseplate J/gp47 family protein	plate	E5AGC3	Erwinia_phage	77.1	1.6e-206
WP_025796624.1|2844215_2844560_-	hypothetical protein	NA	E5AGC2	Erwinia_phage	76.1	1.5e-46
WP_004094723.1|2844598_2844835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025796628.1|2844843_2845524_-|plate	baseplate assembly protein	plate	E5AGC1	Erwinia_phage	65.5	7.7e-79
WP_004094721.1|2845523_2846459_-	hypothetical protein	NA	E5AGC0	Erwinia_phage	86.7	2.7e-151
WP_004094718.1|2846433_2846775_-	hypothetical protein	NA	E5AGB9	Erwinia_phage	82.3	2.1e-53
WP_025796631.1|2846774_2847485_-	hypothetical protein	NA	E5AGB8	Erwinia_phage	69.1	4.7e-87
WP_025796635.1|2849297_2849735_-	hypothetical protein	NA	E5AGB6	Erwinia_phage	66.2	1.5e-46
WP_025796637.1|2849771_2850218_-	hypothetical protein	NA	E5AGB5	Erwinia_phage	75.7	2.6e-59
WP_025796639.1|2850220_2851561_-	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	75.6	2.1e-189
WP_025796641.1|2851579_2852119_-	hypothetical protein	NA	E5AGB3	Erwinia_phage	70.9	7.5e-69
WP_025796643.1|2852111_2852459_-	hypothetical protein	NA	E5AGB2	Erwinia_phage	78.8	6.8e-47
WP_025796645.1|2852455_2852917_-	hypothetical protein	NA	E5AGB1	Erwinia_phage	63.4	3.3e-49
WP_025796646.1|2852907_2853315_-	DUF4054 domain-containing protein	NA	E5AGB0	Erwinia_phage	76.1	5.1e-54
WP_004094691.1|2853314_2853518_-	hypothetical protein	NA	E5AGA9	Erwinia_phage	68.7	1.9e-17
WP_025796648.1|2853551_2854490_-	DUF2184 domain-containing protein	NA	E5AGA8	Erwinia_phage	74.7	3.5e-130
WP_025796650.1|2854499_2855015_-	hypothetical protein	NA	E5AGA7	Erwinia_phage	69.0	1.8e-56
WP_025796652.1|2855014_2856115_-	DUF2213 domain-containing protein	NA	E5AGA6	Erwinia_phage	61.7	1.4e-122
WP_025796654.1|2856127_2856937_-|capsid	minor capsid protein	capsid	E5AGA5	Erwinia_phage	63.2	1.2e-99
WP_025796655.1|2856926_2858186_-	DUF1073 domain-containing protein	NA	E5AGA4	Erwinia_phage	62.4	4.1e-150
WP_025796657.1|2858195_2859536_-|terminase	PBSX family phage terminase large subunit	terminase	A0A220NQL3	Acinetobacter_phage	57.0	1.5e-142
WP_080737061.1|2859522_2860098_-|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	43.8	1.8e-36
WP_025796659.1|2860560_2861265_-	phage antirepressor KilAC domain-containing protein	NA	Q5MBW0	Stx1-converting_phage	70.8	9.5e-80
WP_025796660.1|2861700_2862153_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	39.9	1.0e-18
WP_025796662.1|2862149_2862692_-	lysozyme	NA	K7PM52	Enterobacteria_phage	85.6	7.0e-91
WP_025796664.1|2862691_2862907_-|holin	class II holin family protein	holin	H9C183	Pectobacterium_phage	77.1	3.4e-25
WP_025796666.1|2863398_2864184_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	64.6	4.4e-86
WP_025796668.1|2864180_2864384_-	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	59.1	7.5e-14
WP_025796670.1|2864380_2864743_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	71.7	3.6e-43
WP_025796672.1|2864739_2865030_-	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	78.9	3.3e-39
WP_038502317.1|2865022_2865703_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	63.6	9.5e-77
WP_025796739.1|2865913_2866363_-	DUF1367 family protein	NA	A0A096XEN2	Escherichia_phage	61.1	9.4e-49
WP_038502323.1|2866366_2866621_-	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	56.0	3.6e-21
WP_025796676.1|2866620_2866905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025796678.1|2866984_2867251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025796680.1|2867247_2868630_-	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	65.9	4.6e-171
WP_025796682.1|2868629_2869439_-	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	46.5	2.9e-64
WP_025796684.1|2869612_2869906_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	63.9	1.2e-23
WP_025796686.1|2870004_2870235_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	77.6	2.7e-28
WP_025796688.1|2870341_2871034_+	helix-turn-helix transcriptional regulator	NA	K7PK07	Enterobacteria_phage	54.8	5.9e-66
WP_025796690.1|2871317_2871578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025796692.1|2871688_2872153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_130985919.1|2872513_2872786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025796695.1|2872945_2873299_+	hypothetical protein	NA	A0A2I7R1U5	Vibrio_phage	44.7	5.5e-12
WP_158413858.1|2873346_2873514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025796697.1|2873558_2873777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008813095.1|2874387_2874675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025796701.1|2874671_2875457_+	hypothetical protein	NA	A0A1B1IWT1	uncultured_Mediterranean_phage	50.0	6.3e-40
WP_004092498.1|2875446_2876151_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	55.4	3.1e-70
WP_130996244.1|2876235_2876556_+	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	36.5	3.0e-09
WP_025796707.1|2876565_2876934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038502885.1|2876971_2878003_+	hypothetical protein	NA	K4JTL7	Streptococcus_phage	55.8	1.4e-07
WP_025796711.1|2878708_2879002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025796713.1|2879001_2879268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025796715.1|2879268_2879616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025796717.1|2879682_2879922_+	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	45.1	5.9e-10
WP_025796719.1|2879918_2880461_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	63.3	8.9e-62
WP_025796721.1|2880681_2880933_+	excisionase family protein	NA	S4TND0	Salmonella_phage	51.2	9.6e-19
WP_025796723.1|2880966_2882250_+	DUF3596 domain-containing protein	NA	A0A0N7KZF5	Stx2-converting_phage	61.6	2.5e-155
>prophage 9
NZ_CP009706	Hafnia alvei FB1 chromosome, complete genome	4712721	3228197	3304538	4712721	portal,tail,holin,protease,terminase,head,capsid,tRNA,integrase	Enterobacteria_phage(18.18%)	79	3229095:3229110	3283200:3283215
WP_038502928.1|3228197_3229001_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_025797812.1|3229060_3230071_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
3229095:3229110	attL	GTTTCGATAGCCATCA	NA	NA	NA	NA
WP_025797809.1|3230316_3231444_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.2	1.3e-19
WP_025797807.1|3231562_3232339_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025797806.1|3232491_3233421_+	DMT family transporter	NA	NA	NA	NA	NA
WP_025797803.1|3234092_3234593_-	protein disulfide oxidoreductase	NA	A0A1J0GW78	Streptomyces_phage	28.1	1.9e-05
WP_167333993.1|3234589_3235357_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_025797799.1|3235361_3237389_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_025797796.1|3237441_3237819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025797794.1|3238021_3238387_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_025797792.1|3238555_3238936_+	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_025797790.1|3239614_3240013_-	glyoxalase	NA	NA	NA	NA	NA
WP_025797788.1|3240229_3240451_+	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_025797786.1|3240515_3241730_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_025797784.1|3241903_3243922_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_025797782.1|3244064_3244340_-	YfcL family protein	NA	NA	NA	NA	NA
WP_025797781.1|3244358_3244904_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_025797779.1|3245161_3245974_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_025797777.1|3246319_3247057_+	amino acid racemase	NA	NA	NA	NA	NA
WP_025797776.1|3247039_3247936_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_025797775.1|3248014_3249178_-	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_025797773.1|3249191_3249656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025797770.1|3249660_3250341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025797768.1|3250631_3251459_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_025797766.1|3251505_3252591_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	3.2e-87
WP_025797764.1|3252729_3253662_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_025797761.1|3253904_3254447_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_025797759.1|3254509_3254992_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_025797757.1|3255370_3257518_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_038502374.1|3257517_3258846_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_074399238.1|3259204_3259501_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_025797751.1|3259905_3261228_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_025797749.1|3261345_3262107_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_025797747.1|3262229_3263441_-	c-type cytochrome biogenesis protein CcmI	NA	NA	NA	NA	NA
WP_025797745.1|3263443_3263929_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_025797743.1|3263928_3264480_-	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_025797742.1|3264476_3266450_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_025797740.1|3266446_3266953_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_025797738.1|3266949_3267189_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_025797736.1|3267188_3267944_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_025797734.1|3268152_3268812_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_025797732.1|3268808_3269429_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	31.5	5.5e-15
WP_025797730.1|3270032_3271196_+|integrase	tyrosine-type recombinase/integrase	integrase	Q716F9	Shigella_phage	81.0	4.9e-182
WP_025797728.1|3271741_3272506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025797726.1|3272492_3273374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038502931.1|3273621_3274239_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025797723.1|3274424_3275702_-	hypothetical protein	NA	K7P7M2	Enterobacteria_phage	38.4	3.5e-64
WP_025797721.1|3275747_3276401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025797718.1|3276700_3280087_-|tail	phage tail protein	tail	F1C571	Cronobacter_phage	54.0	0.0e+00
WP_025797716.1|3280137_3280758_-|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	52.7	1.1e-47
WP_004095523.1|3280798_3281323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025797713.1|3281419_3282127_-	C40 family peptidase	NA	Q9MCU3	Escherichia_phage	76.3	6.7e-110
WP_025797711.1|3282128_3282878_-|tail	phage minor tail protein L	tail	K7P7D8	Enterobacteria_phage	69.8	6.7e-100
WP_025797710.1|3282874_3283213_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	70.5	2.0e-43
WP_025797708.1|3283212_3286551_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	68.1	0.0e+00
3283200:3283215	attR	GTTTCGATAGCCATCA	NA	NA	NA	NA
WP_025797706.1|3286789_3287152_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	53.0	6.2e-27
WP_052123020.1|3287205_3287490_-	immunoglobulin domain-containing protein	NA	Q7Y402	Yersinia_phage	52.1	6.6e-16
WP_004092486.1|3287465_3287924_-	hypothetical protein	NA	Q7Y403	Yersinia_phage	75.5	1.1e-60
WP_004092483.1|3287959_3288367_-	hypothetical protein	NA	Q6UAX1	Klebsiella_phage	67.7	2.9e-41
WP_025797699.1|3288363_3288753_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	49.2	5.5e-29
WP_004092330.1|3288733_3289078_-|head	phage head closure protein	head	Q7Y406	Yersinia_phage	59.8	8.8e-31
WP_025797695.1|3289074_3289383_-|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	45.6	3.9e-14
WP_025797693.1|3289421_3290639_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	67.1	8.0e-151
WP_025797691.1|3290643_3291306_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	78.9	8.3e-94
WP_025797689.1|3291280_3292519_-|portal	phage portal protein	portal	U5P411	Shigella_phage	73.8	4.9e-180
WP_025797685.1|3292725_3294462_-|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	88.2	5.8e-304
WP_025797683.1|3294462_3294936_-|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	64.3	2.7e-54
WP_025797681.1|3295149_3295332_-	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	56.1	6.5e-09
WP_025797679.1|3295328_3295679_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	75.9	8.6e-50
WP_025797677.1|3295680_3296205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025797675.1|3296481_3296682_+	hypothetical protein	NA	H6WRV6	Salmonella_phage	73.8	3.3e-22
WP_038502382.1|3296863_3297391_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_025797671.1|3297387_3298002_-	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	82.8	2.7e-91
WP_025797669.1|3298011_3298344_-|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	42.2	7.5e-19
WP_025797666.1|3299577_3299871_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_025797664.1|3300311_3301091_-	antitermination protein	NA	F1C595	Cronobacter_phage	51.6	9.5e-73
WP_052123022.1|3301087_3301972_-	hypothetical protein	NA	F1C596	Cronobacter_phage	53.4	1.5e-77
WP_025797661.1|3301947_3302922_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	60.1	2.1e-109
WP_025797659.1|3302918_3304538_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	74.6	6.7e-230
>prophage 10
NZ_CP009706	Hafnia alvei FB1 chromosome, complete genome	4712721	3854707	3908970	4712721	plate,portal,tail,terminase,head,capsid,tRNA,integrase	Enterobacteria_phage(51.35%)	65	3877592:3877612	3909029:3909049
WP_025800274.1|3854707_3855583_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_071842640.1|3855686_3857129_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	38.2	1.1e-26
WP_025800276.1|3857125_3857605_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_025800277.1|3857826_3858621_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.8	3.4e-41
WP_025800278.1|3858688_3859549_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_008814566.1|3859676_3860057_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_025800279.1|3860267_3861587_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_025800280.1|3861839_3862694_-	tagatose bisphosphate family class II aldolase	NA	NA	NA	NA	NA
WP_025800281.1|3862706_3863150_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_025800282.1|3863159_3864053_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_025800283.1|3864042_3864834_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_025800284.1|3864846_3865329_-	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_025800285.1|3865346_3866525_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_025800286.1|3866521_3867838_-	D-tagatose-bisphosphate aldolase, class II, non-catalytic subunit	NA	NA	NA	NA	NA
WP_025800287.1|3867880_3868654_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_025800288.1|3869132_3869597_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	58.0	1.2e-43
WP_025800289.1|3869726_3870179_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_025800290.1|3870420_3871191_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025800291.1|3871187_3872135_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.7	2.1e-21
WP_025800292.1|3872488_3873139_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_025800293.1|3873228_3873597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025800294.1|3874017_3874323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025800295.1|3874382_3874919_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	3.0e-17
WP_025800296.1|3875139_3875745_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_025800297.1|3875849_3877472_-	multicopper oxidase CueO	NA	NA	NA	NA	NA
3877592:3877612	attL	CCAGTAAGGGGAAAGTCAAGC	NA	NA	NA	NA
WP_071842641.1|3877728_3877977_-	ogr/Delta-like zinc finger family protein	NA	Q37973	Salmonella_virus	41.2	1.2e-05
WP_025800298.1|3878015_3879149_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.7	1.5e-151
WP_025800299.1|3879302_3880493_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	72.3	6.6e-166
WP_025800300.1|3880492_3881008_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	67.6	4.8e-65
WP_025800301.1|3881058_3881370_+|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	56.1	5.7e-21
WP_071842671.1|3881390_3881531_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.0	2.6e-10
WP_025800302.1|3881517_3884613_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	48.8	6.0e-211
WP_025800303.1|3884627_3885116_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	66.7	4.1e-58
WP_025800304.1|3885566_3886490_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_025800305.1|3886501_3887092_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	53.1	2.7e-56
WP_038502441.1|3887091_3888228_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	49.1	1.9e-82
WP_025800306.1|3888217_3888832_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	57.9	6.1e-67
WP_025800307.1|3888824_3889721_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	64.1	7.5e-98
WP_038502443.1|3889725_3890076_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	59.5	1.4e-31
WP_025800308.1|3890072_3890654_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.2	1.6e-61
WP_025800309.1|3890650_3891289_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	51.5	1.2e-49
WP_025800310.1|3891285_3891741_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.3	2.5e-49
WP_038502445.1|3891849_3892071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025800312.1|3892000_3892372_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_025800313.1|3892368_3892911_-	lysozyme	NA	K9RZW8	Cronobacter_phage	39.3	1.1e-27
WP_025800314.1|3892894_3893194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025800315.1|3893184_3893385_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	64.6	7.2e-17
WP_025800316.1|3893384_3893882_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	56.4	5.2e-48
WP_025800317.1|3893978_3894776_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	53.9	2.2e-64
WP_025800318.1|3894819_3895908_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	52.0	4.8e-99
WP_025800319.1|3895927_3896767_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	62.1	3.3e-87
WP_025800320.1|3896923_3898651_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	69.3	3.1e-241
WP_025800321.1|3898650_3899706_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	72.5	2.6e-150
WP_025800322.1|3900105_3900378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025800323.1|3900459_3900699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025800324.1|3900715_3903310_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	37.7	7.2e-125
WP_025800325.1|3903306_3904308_-	phosphoadenosine phosphosulfate reductase family protein	NA	B7SYG0	Stenotrophomonas_phage	43.8	1.4e-68
WP_025800326.1|3904512_3905481_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	69.2	9.2e-118
WP_025800327.1|3905477_3906059_-	3'-5' exoribonuclease	NA	A0A2I6TCA6	Escherichia_phage	55.5	3.2e-49
WP_071842642.1|3906372_3906591_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	59.2	2.7e-17
WP_167333994.1|3906603_3906777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071842643.1|3906766_3906970_-	DUF4761 family protein	NA	A0A0M5M1I3	Salmonella_phage	64.4	2.1e-16
WP_025800328.1|3906988_3907330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025800329.1|3907578_3907878_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	57.6	3.2e-29
WP_025800330.1|3907947_3908970_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LA05	Escherichia_phage	49.5	6.4e-93
3909029:3909049	attR	CCAGTAAGGGGAAAGTCAAGC	NA	NA	NA	NA
