The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007436	Bacillus pumilus strain B6033 chromosome, complete genome	3763493	22160	31034	3763493	tRNA	uncultured_Mediterranean_phage(16.67%)	8	NA	NA
WP_025206590.1|22160_23435_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.1	1.3e-95
WP_025206591.1|23536_24364_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.4	7.1e-10
WP_017366699.1|24833_25493_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	33.2	8.4e-22
WP_017366700.1|25489_26113_-	deoxynucleoside kinase	NA	A0A1G5SAJ8	Enterococcus_phage	28.8	2.0e-12
WP_025206592.1|26192_27494_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A2P1CIG4	Microbacterium_phage	34.8	1.4e-07
WP_025206593.1|27539_28094_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_007496052.1|28173_28650_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_017359011.1|29321_31034_+	DNA polymerase III subunit gamma/tau	NA	D9ZNI9	Clostridium_phage	34.1	2.0e-54
>prophage 2
NZ_CP007436	Bacillus pumilus strain B6033 chromosome, complete genome	3763493	646972	656868	3763493		Synechococcus_phage(50.0%)	9	NA	NA
WP_025206861.1|646972_648268_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	26.9	2.9e-18
WP_025206862.1|648340_649063_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3G7P8	Synechococcus_phage	43.7	2.4e-46
WP_003214349.1|649055_649310_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FKD5	Synechococcus_phage	33.3	1.2e-05
WP_017359821.1|649306_649990_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_025206863.1|649973_652205_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	42.0	2.9e-159
WP_017359819.1|652180_653611_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.9	1.3e-51
WP_017366751.1|653707_654748_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	43.8	1.1e-65
WP_008344288.1|654744_655314_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.5	2.9e-31
WP_012009147.1|655329_656868_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	4.8e-76
>prophage 3
NZ_CP007436	Bacillus pumilus strain B6033 chromosome, complete genome	3763493	1024877	1057872	3763493	portal,terminase,capsid,head,integrase,tail	uncultured_Caudovirales_phage(50.0%)	43	1026541:1026560	1068112:1068131
WP_017366957.1|1024877_1025738_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	44.6	1.7e-54
WP_008348804.1|1025796_1026033_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_017360296.1|1026321_1026573_+	hypothetical protein	NA	NA	NA	NA	NA
1026541:1026560	attL	GGTATTTCCCACAAGCCTCC	NA	NA	NA	NA
WP_025207049.1|1026642_1027836_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	42.1	9.7e-85
WP_025207050.1|1027849_1028353_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	94.0	2.0e-87
WP_025207051.1|1028428_1029007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207052.1|1029216_1029594_-	helix-turn-helix domain-containing protein	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	84.4	1.5e-47
WP_025207053.1|1029757_1029982_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J4N8	uncultured_Caudovirales_phage	81.1	6.5e-27
WP_007497216.1|1030217_1030523_+	hypothetical protein	NA	A0A2H4JDL0	uncultured_Caudovirales_phage	41.0	2.1e-15
WP_025207054.1|1030519_1030750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025207055.1|1030733_1030967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207056.1|1031039_1031732_+	antirepressor	NA	A0A0C5AEJ9	Bacteriophage	48.2	2.7e-39
WP_025207057.1|1031796_1032366_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J884	uncultured_Caudovirales_phage	81.0	1.3e-84
WP_025207058.1|1032362_1032641_+	hypothetical protein	NA	A0A2H4J4M9	uncultured_Caudovirales_phage	92.4	5.4e-39
WP_025207059.1|1032844_1033024_+	hypothetical protein	NA	A0A2H4JCC7	uncultured_Caudovirales_phage	98.3	1.4e-27
WP_025207060.1|1033026_1033977_+	hypothetical protein	NA	S6C475	Thermus_phage	61.4	4.2e-107
WP_017360282.1|1033969_1034845_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	62.2	8.1e-89
WP_080688155.1|1034940_1035714_+	DnaD domain protein	NA	A0A2H4J6G9	uncultured_Caudovirales_phage	85.6	8.7e-111
WP_025207063.1|1035703_1036489_+	ATP-binding protein	NA	A0A2H4J4P8	uncultured_Caudovirales_phage	93.6	1.1e-134
WP_025207064.1|1036770_1037205_+	RusA family crossover junction endodeoxyribonuclease	NA	S6B1L9	Thermus_phage	63.5	2.2e-42
WP_025207065.1|1037448_1037658_+	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	92.4	4.2e-28
WP_025207066.1|1037675_1037924_+	hypothetical protein	NA	A0A2H4JA61	uncultured_Caudovirales_phage	87.7	1.7e-31
WP_025207067.1|1038144_1039218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025207068.1|1039244_1039427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144205346.1|1039430_1040159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025207071.1|1041236_1041692_+	hypothetical protein	NA	A0A2H4J4R7	uncultured_Caudovirales_phage	98.0	9.4e-81
WP_025207072.1|1041848_1042832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025207073.1|1042846_1043356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025207074.1|1043546_1044275_+	hypothetical protein	NA	A0A2H4J4R0	uncultured_Caudovirales_phage	70.6	3.5e-77
WP_025207075.1|1044261_1045464_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2H4J8B0	uncultured_Caudovirales_phage	94.4	4.7e-220
WP_038475076.1|1045484_1046945_+|portal	phage portal protein	portal	A0A1Q1PVT0	Bacillus_phage	49.0	7.1e-122
WP_025207077.1|1046925_1047840_+|head	head protein	head	A0A1Q1PVS4	Bacillus_phage	47.5	3.2e-72
WP_025207078.1|1047914_1048211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025207079.1|1048344_1048959_+	scaffolding protein	NA	I1TLE1	Bacillus_phage	48.4	1.9e-20
WP_025207080.1|1048972_1050043_+|capsid	N4-gp56 family major capsid protein	capsid	Q79S85	Temperate_phage	55.3	9.7e-76
WP_025207081.1|1050058_1050355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038475078.1|1050348_1050690_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_025207083.1|1050682_1051102_+	HK97 gp10 family phage protein	NA	O48447	Bacillus_phage	54.4	3.6e-34
WP_025207084.1|1051117_1051516_+	DUF3168 domain-containing protein	NA	A0A0H4J350	Staphylococcus_phage	36.2	3.0e-14
WP_025207085.1|1051529_1052054_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_080688197.1|1052001_1052316_+	fibronectin type III domain-containing protein	NA	Q0PDK9	Bacillus_phage	69.3	7.8e-26
WP_080688157.1|1052909_1053218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025207086.1|1053222_1057872_+	hypothetical protein	NA	M9NRJ5	Staphylococcus_phage	25.3	1.7e-36
1068112:1068131	attR	GGTATTTCCCACAAGCCTCC	NA	NA	NA	NA
>prophage 4
NZ_CP007436	Bacillus pumilus strain B6033 chromosome, complete genome	3763493	1720856	1727105	3763493		Bacillus_phage(50.0%)	6	NA	NA
WP_017359034.1|1720856_1721249_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	G3MBF1	Bacillus_virus	56.5	8.8e-27
WP_019743850.1|1721208_1723311_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	U5PY35	Bacillus_phage	82.8	0.0e+00
WP_008344010.1|1723328_1724309_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	F8WQ21	Bacillus_phage	80.6	4.2e-150
WP_025207368.1|1724393_1725011_+	hypothetical protein	NA	A0A127AYS1	Bacillus_phage	44.8	5.1e-45
WP_025207369.1|1725066_1725825_-	N-acetylmuramoyl-L-alanine amidase	NA	D6QWM7	uncultured_phage	48.5	2.2e-50
WP_008344008.1|1726145_1727105_+	stage V sporulation protein K	NA	G3MAX6	Bacillus_virus	39.6	3.9e-52
>prophage 5
NZ_CP007436	Bacillus pumilus strain B6033 chromosome, complete genome	3763493	2083630	2091338	3763493		Ostreococcus_lucimarinus_virus(16.67%)	10	NA	NA
WP_017359757.1|2083630_2084722_-	3-dehydroquinate synthase	NA	E5ERI4	Ostreococcus_lucimarinus_virus	27.2	3.1e-21
WP_007500947.1|2084721_2085894_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	35.2	5.9e-42
WP_008344547.1|2085970_2086747_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_025207549.1|2086891_2087338_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	42.3	9.1e-28
WP_007500951.1|2087467_2088430_-	heptaprenyl diphosphate synthase component II	NA	A0A1V0SE37	Indivirus	26.0	1.7e-07
WP_007500957.1|2088454_2089159_-	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_007500958.1|2089162_2089930_-	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_008344541.1|2090045_2090276_-	trp RNA-binding attenuation protein MtrB	NA	NA	NA	NA	NA
WP_003215789.1|2090299_2090869_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	57.3	1.8e-49
WP_003215863.1|2091059_2091338_-	non-specific DNA-binding protein Hbs	NA	A7KV42	Bacillus_phage	74.2	5.6e-28
>prophage 6
NZ_CP007436	Bacillus pumilus strain B6033 chromosome, complete genome	3763493	2129413	2135794	3763493		Staphylococcus_phage(50.0%)	10	NA	NA
WP_019743085.1|2129413_2130565_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	37.7	1.9e-24
WP_007501019.1|2130675_2131155_-	DUF3907 family protein	NA	NA	NA	NA	NA
WP_008344462.1|2131268_2131862_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.0	9.0e-15
WP_007501021.1|2131851_2132610_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	36.8	6.5e-10
WP_008359694.1|2132820_2132913_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_019743088.1|2133001_2133526_+	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_017359785.1|2133550_2133904_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007501031.1|2134017_2134482_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	66.0	2.1e-43
WP_080688174.1|2134508_2135132_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	56.8	2.6e-57
WP_025207562.1|2135143_2135794_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	40.8	6.1e-41
>prophage 7
NZ_CP007436	Bacillus pumilus strain B6033 chromosome, complete genome	3763493	2793847	2823294	3763493	portal,terminase,plate,capsid,holin,tail	Bacillus_phage(26.09%)	41	NA	NA
WP_025207858.1|2793847_2794666_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9ZXD7	Bacillus_phage	69.3	2.1e-62
WP_019743388.1|2794685_2794949_-|holin	phage holin	holin	A0A2H4J6M0	uncultured_Caudovirales_phage	69.0	7.7e-27
WP_008344062.1|2794961_2795174_-	hypothetical protein	NA	A0A290GDY2	Caldibacillus_phage	56.5	1.0e-13
WP_079920581.1|2795230_2795377_-	XkdX family protein	NA	NA	NA	NA	NA
WP_025207859.1|2795377_2795716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207860.1|2795730_2796819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079920608.1|2797151_2797292_-	XkdX family protein	NA	NA	NA	NA	NA
WP_025207861.1|2797291_2797612_-	hypothetical protein	NA	O64053	Bacillus_phage	46.2	1.4e-19
WP_038475554.1|2797624_2799007_-	hypothetical protein	NA	A0A1P8CWR7	Bacillus_phage	30.4	2.8e-27
WP_025207863.1|2799066_2800230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207864.1|2800201_2800411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207865.1|2800407_2800737_-|portal	phage portal protein	portal	A0A2H4JCI0	uncultured_Caudovirales_phage	36.2	3.1e-09
WP_025207866.1|2800747_2801626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207867.1|2801641_2802025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207868.1|2802036_2802960_-	YmfQ family protein	NA	A0A0A7RTT8	Clostridium_phage	28.5	9.4e-11
WP_025207869.1|2802946_2803993_-|plate	baseplate J/gp47 family protein	plate	S6AVU3	Thermus_phage	44.1	6.6e-69
WP_024719684.1|2803985_2804408_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_017358996.1|2804422_2804689_-	DUF2577 family protein	NA	S6C459	Thermus_phage	37.5	4.7e-08
WP_017367933.1|2804685_2805696_-	hypothetical protein	NA	H7BV96	unidentified_phage	28.4	1.0e-34
WP_025207870.1|2805708_2806377_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0K2SUI2	Clostridium_phage	29.6	2.9e-22
WP_080688184.1|2806369_2810296_-	transglycosylase SLT domain-containing protein	NA	A0A1L2JY60	Aeribacillus_phage	42.3	8.0e-43
WP_008344097.1|2810351_2810489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008344099.1|2810530_2810971_-|portal	phage portal protein	portal	A0A0A7RTY8	Clostridium_phage	35.8	1.7e-10
WP_074041930.1|2811121_2811211_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_003213309.1|2811488_2811932_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	46.5	7.6e-27
WP_017367936.1|2811933_2813280_-	hypothetical protein	NA	A0A0A7S087	Clostridium_phage	41.4	4.3e-81
WP_008344108.1|2813283_2813496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207872.1|2813482_2813938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207873.1|2813942_2814440_-	HK97 gp10 family phage protein	NA	A0A249XXA4	Clostridium_phage	46.2	5.3e-37
WP_017367938.1|2814436_2814793_-	YqbH/XkdH family protein	NA	NA	NA	NA	NA
WP_007500574.1|2814789_2815173_-	DUF3199 family protein	NA	NA	NA	NA	NA
WP_008344119.1|2815186_2816110_-|capsid	phage major capsid protein	capsid	A0A1B1P7E3	Bacillus_phage	64.3	3.3e-109
WP_025207874.1|2816132_2817224_-|terminase	terminase	terminase	A0A1B1P7E4	Bacillus_phage	40.9	3.1e-61
WP_160758062.1|2818711_2820013_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	62.5	1.2e-152
WP_007500563.1|2820021_2820669_-|terminase	terminase small subunit	terminase	A0A2P1JTW4	Anoxybacillus_phage	44.1	1.1e-42
WP_024719695.1|2820821_2821340_-	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4J6J3	uncultured_Caudovirales_phage	46.9	2.0e-34
WP_008344129.1|2821464_2821671_-	hypothetical protein	NA	A0A2H4J4M6	uncultured_Caudovirales_phage	68.5	9.0e-15
WP_025207876.1|2821667_2822072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025207877.1|2822174_2822357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008344138.1|2822517_2822757_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_007500560.1|2822916_2823294_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	45.4	1.6e-17
>prophage 8
NZ_CP007436	Bacillus pumilus strain B6033 chromosome, complete genome	3763493	3134801	3143809	3763493		Streptococcus_phage(33.33%)	10	NA	NA
WP_144205363.1|3134801_3135782_+	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	26.8	8.4e-18
WP_017368105.1|3135962_3136451_+	ribonuclease	NA	NA	NA	NA	NA
WP_025208025.1|3136503_3137247_-	arylamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_025208026.1|3137286_3137544_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_008348125.1|3137570_3138521_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.1	4.3e-51
WP_008348128.1|3138538_3139498_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	40.4	3.2e-62
WP_008348130.1|3139498_3140422_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	26.3	4.5e-05
WP_008348133.1|3140425_3140890_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_025208028.1|3141247_3142198_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.4	5.7e-88
WP_017357905.1|3142432_3143809_-	C40 family peptidase	NA	A0A0A0RVE6	Bacillus_phage	54.3	1.1e-26
>prophage 9
NZ_CP007436	Bacillus pumilus strain B6033 chromosome, complete genome	3763493	3402748	3449139	3763493	transposase,coat,protease	Escherichia_phage(25.0%)	54	NA	NA
WP_017360077.1|3402748_3403411_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_008343530.1|3403518_3403704_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_025208148.1|3403756_3404569_-	peptidase M84	NA	NA	NA	NA	NA
WP_025208149.1|3404943_3406272_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_008343536.1|3406311_3407196_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025208150.1|3407346_3407898_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_025208151.1|3407881_3408907_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025208152.1|3408906_3409161_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_008343543.1|3409195_3409759_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008343545.1|3409772_3410534_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_025208153.1|3410551_3411394_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_024719446.1|3411410_3412121_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025208154.1|3412117_3412861_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.7	1.6e-32
WP_007497715.1|3412965_3413466_-	YwgA family protein	NA	NA	NA	NA	NA
WP_007497716.1|3413496_3414798_-	HD domain-containing protein	NA	A0A1V0SGM3	Hokovirus	30.3	1.6e-24
WP_003215259.1|3414968_3415190_-	DUF1450 domain-containing protein	NA	NA	NA	NA	NA
WP_007497717.1|3415432_3416233_+	RsfA family transcriptional regulator	NA	A0A1D6X8E5	Bacillus_phage	48.0	6.0e-06
WP_008343557.1|3416268_3416502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025208155.1|3416498_3418775_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_025208156.1|3418878_3419364_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_025208157.1|3419403_3420249_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_017368244.1|3420482_3420878_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_024719453.1|3420910_3421186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024719454.1|3421251_3421524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025208158.1|3421638_3421974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025208159.1|3421988_3423695_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_008343583.1|3423706_3423985_-	YwqI/YxiC family protein	NA	NA	NA	NA	NA
WP_017360097.1|3423989_3424388_-	DUF5082 family protein	NA	NA	NA	NA	NA
WP_017360098.1|3424562_3424829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025208160.1|3424842_3426177_-	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_025208161.1|3426220_3427099_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025208162.1|3427110_3427782_-	RraA family protein	NA	NA	NA	NA	NA
WP_017368253.1|3427923_3428775_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008343597.1|3428911_3429883_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_007497744.1|3430122_3430893_+	heme-dependent peroxidase	NA	NA	NA	NA	NA
WP_025208163.1|3430960_3432121_+	MFS transporter	NA	NA	NA	NA	NA
WP_008343601.1|3432136_3432616_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_017360104.1|3432761_3433994_+	MFS transporter	NA	NA	NA	NA	NA
WP_025208164.1|3434143_3434749_+	bacilysin biosynthesis protein BacA	NA	NA	NA	NA	NA
WP_025208165.1|3434750_3435458_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_017368258.1|3435454_3436216_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	1.9e-25
WP_025208166.1|3436231_3437653_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_080688191.1|3437667_3438864_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_038475433.1|3438878_3439676_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017360110.1|3439762_3440218_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_025208169.1|3440210_3441065_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	37.4	2.5e-34
WP_017360112.1|3441068_3442034_-	dTDP-glucose 4,6-dehydratase	NA	K7QJG5	Escherichia_phage	45.6	5.5e-78
WP_017360113.1|3442030_3442771_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	41.6	1.0e-44
WP_025208170.1|3442773_3443802_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_017360114.1|3443798_3444539_-	glycosyltransferase family protein	NA	NA	NA	NA	NA
WP_025208172.1|3444528_3445653_-|coat	spore coat protein	coat	A0A1B1IVE2	uncultured_Mediterranean_phage	29.9	7.6e-23
WP_025208173.1|3445654_3446530_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017368269.1|3446526_3447705_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	NA	NA	NA	NA
WP_025208174.1|3447726_3449139_-|coat	spore coat protein	coat	NA	NA	NA	NA
