The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004368	Burkholderia pseudomallei MSHR520 chromosome 1, complete sequence	4059501	181900	247087	4059501	portal,transposase,protease,tRNA	Streptococcus_phage(12.5%)	58	NA	NA
WP_020850758.1|181900_183364_+|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.3	1.2e-79
WP_004199069.1|183468_184656_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	60.7	2.2e-121
WP_004523078.1|184921_185806_+	lipid A biosynthesis lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	30.1	7.3e-29
WP_004199067.1|185846_186716_+	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_020850774.1|186763_187477_+	DUF484 family protein	NA	NA	NA	NA	NA
WP_004523080.1|187514_188447_+	tyrosine recombinase XerC	NA	G1JX48	Mycobacterium_phage	28.0	2.4e-14
WP_004542863.1|188535_189813_+	class I SAM-dependent rRNA methyltransferase	NA	NA	NA	NA	NA
WP_009972676.1|189990_191076_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_004198318.1|191625_192042_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_004203414.1|192296_192833_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_004198316.1|192842_194186_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	28.8	3.7e-40
WP_004198315.1|194612_195155_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_004198314.1|195174_196455_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_004198312.1|196472_196724_-	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_004200214.1|197048_197948_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_004198307.1|197944_198748_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_004525865.1|198714_199407_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_004198305.1|199756_200902_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_004543091.1|200898_201513_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_004523086.1|201524_202838_+	AmpG family muropeptide MFS transporter	NA	NA	NA	NA	NA
WP_004535313.1|202827_203880_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_004525862.1|204252_205197_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523088.1|205408_206473_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.8	1.3e-80
WP_004191998.1|206740_208204_-|transposase	IS1182-like element ISBma2 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	38.6	8.8e-80
WP_004190029.1|208364_209135_-	exodeoxyribonuclease III	NA	R4TWA8	Phaeocystis_globosa_virus	33.8	3.4e-30
WP_004523089.1|209167_210007_-	polyphosphate kinase	NA	NA	NA	NA	NA
WP_004523090.1|210133_211606_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_004525859.1|211608_213099_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_004189769.1|213211_213511_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_004189550.1|213876_214920_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_004189331.1|215039_216113_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_004523092.1|216109_216622_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004543095.1|216805_219217_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_004189171.1|219228_220377_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_004543106.1|220642_221419_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004189570.1|221415_222201_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_004189793.1|222625_223078_-	6-carboxytetrahydropterin synthase QueD	NA	A0A088FAL2	Vibrio_phage	30.8	7.6e-14
WP_004189241.1|223097_223730_-	7-carboxy-7-deazaguanine synthase	NA	R4TAH8	Halovirus	30.9	2.1e-06
WP_004190026.1|223823_224558_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A1B0Z0B4	Vibrio_phage	42.5	1.6e-50
WP_004189647.1|225025_225709_-	response regulator	NA	NA	NA	NA	NA
WP_004523096.1|225709_228118_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_004543101.1|228119_228710_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_020850535.1|228706_230116_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_004189409.1|230667_231525_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_004543107.1|231634_232270_-	LysE family translocator	NA	NA	NA	NA	NA
WP_004543102.1|232390_233374_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	38.0	1.3e-07
WP_004525852.1|233405_233909_-	peptide deformylase	NA	A0A067XQZ3	Caulobacter_phage	34.3	2.1e-12
WP_020850823.1|234137_235328_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	39.2	2.0e-21
WP_004190199.1|235387_235759_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_004523103.1|235969_238579_+	DNA topoisomerase III	NA	A0A2P1ELA0	Moumouvirus	25.7	7.7e-18
WP_004189230.1|238802_239858_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523104.1|240296_241313_+	D-2-hydroxyacid dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004543112.1|241433_242303_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_004200732.1|242340_242745_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_004543096.1|243618_244623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200731.1|245159_245642_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_004523107.1|245638_245923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004543108.1|245995_247087_-|portal	phage portal protein	portal	A4JWQ2	Burkholderia_virus	91.7	2.2e-192
>prophage 2
NZ_CP004368	Burkholderia pseudomallei MSHR520 chromosome 1, complete sequence	4059501	461631	472850	4059501	integrase	Shigella_phage(20.0%)	11	459044:459061	475630:475647
459044:459061	attL	CGCGGCGAGCGCGTCGAG	NA	NA	NA	NA
WP_004524472.1|461631_463719_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.8	1.9e-99
WP_004202928.1|464041_464941_-	cytochrome c	NA	NA	NA	NA	NA
WP_041188602.1|466123_466711_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	50.6	3.1e-44
WP_009932253.1|466762_467083_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	58.6	1.0e-12
WP_009922658.1|467090_467408_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	6.2e-15
WP_004541800.1|467407_468325_+	DUF4935 domain-containing protein	NA	A4PE40	Ralstonia_virus	40.6	8.9e-46
WP_009922654.1|468578_469121_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	56.4	3.3e-48
WP_009932249.1|469378_469831_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_004525722.1|469830_470910_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	99.0	2.2e-160
WP_004525721.1|471066_471315_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_004195754.1|472205_472850_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.4	5.7e-07
475630:475647	attR	CTCGACGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 3
NZ_CP004368	Burkholderia pseudomallei MSHR520 chromosome 1, complete sequence	4059501	717106	743668	4059501	integrase,protease,plate,tail	Burkholderia_phage(44.44%)	30	717679:717725	733156:733202
WP_004527881.1|717106_717628_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
717679:717725	attL	ATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCGGCACCAA	NA	NA	NA	NA
WP_004542707.1|717821_718868_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	38.7	3.9e-53
WP_004542657.1|720630_720885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542680.1|720898_721549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850759.1|721560_721953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542725.1|721945_722794_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_143291333.1|722853_723105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542660.1|723257_723539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542720.1|723957_726933_+	conjugative relaxase	NA	V5UQN3	Mycobacterium_phage	28.8	4.5e-06
WP_020850657.1|726958_727210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076847806.1|727684_728131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542662.1|728127_728397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850845.1|728413_729073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542700.1|729185_730100_-	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_076847687.1|730111_730954_-	phage Gp37/Gp68 family protein	NA	Q8W6R4	Burkholderia_virus	43.3	2.9e-67
WP_076847807.1|731248_731887_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_020850538.1|731901_732963_+	macro domain-containing protein	NA	B3FJ30	Pseudomonas_phage	36.5	3.1e-18
WP_004542696.1|733805_734132_+|plate	baseplate J-like protein, truncation	plate	K4NZR5	Burkholderia_phage	100.0	1.3e-52
733156:733202	attR	ATTTGTAATCATCAGGTGGCGGGTTCGAGTCCTGCAGCCGGCACCAA	NA	NA	NA	NA
WP_004542714.1|734124_734538_+|tail	phage tail protein I	tail	K4NXA0	Burkholderia_phage	99.2	1.5e-69
WP_020850622.1|734555_735038_+	DNA methylase	NA	K4NZW3	Burkholderia_phage	87.6	4.5e-73
WP_111952238.1|735431_736022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542688.1|736125_736491_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	89.3	5.1e-53
WP_004521948.1|736592_737378_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004521949.1|737374_738721_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004521950.1|738829_739444_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004531875.1|739818_740490_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521952.1|740526_741045_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004521953.1|741061_742552_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004527837.1|742624_743128_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004204912.1|743185_743668_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP004368	Burkholderia pseudomallei MSHR520 chromosome 1, complete sequence	4059501	1094946	1104191	4059501		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|1094946_1096899_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004533593.1|1097165_1098296_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	3.8e-22
WP_004541188.1|1098329_1100336_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	34.6	4.8e-52
WP_004194137.1|1100519_1101335_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|1101399_1102083_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194373.1|1102079_1102607_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004541275.1|1102643_1104191_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	30.9	1.2e-23
>prophage 5
NZ_CP004368	Burkholderia pseudomallei MSHR520 chromosome 1, complete sequence	4059501	1442944	1451759	4059501		Bacillus_phage(16.67%)	8	NA	NA
WP_004522358.1|1442944_1444345_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
WP_009921652.1|1444376_1445300_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004190173.1|1445358_1446351_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004539941.1|1446422_1446740_+	competence protein ComE	NA	NA	NA	NA	NA
WP_004532363.1|1447063_1447966_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_004539874.1|1448192_1449476_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004522362.1|1449654_1450578_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.2	2.4e-43
WP_041188594.1|1450916_1451759_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.0	7.2e-18
>prophage 6
NZ_CP004368	Burkholderia pseudomallei MSHR520 chromosome 1, complete sequence	4059501	1526920	1606158	4059501	portal,protease,terminase,holin,integrase,tail,head	Burkholderia_virus(30.3%)	82	1533466:1533483	1556256:1556273
WP_004192020.1|1526920_1528429_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	2.8e-20
WP_004539792.1|1528425_1528680_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_004527467.1|1528687_1528930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193305.1|1528921_1530715_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	2.1e-22
WP_004193513.1|1530730_1531624_+	signal peptidase I	NA	NA	NA	NA	NA
WP_004539775.1|1531774_1533178_+	ribonuclease III	NA	G8DDA3	Micromonas_pusilla_virus	30.3	4.9e-19
WP_004191678.1|1533247_1534147_+	GTPase Era	NA	NA	NA	NA	NA
1533466:1533483	attL	CAGCACCGCGCTCAACCG	NA	NA	NA	NA
WP_004524618.1|1534166_1534994_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_004192885.1|1534990_1535764_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_004191194.1|1535769_1536201_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_004539664.1|1536228_1537257_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_004192300.1|1537370_1538768_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_004193484.1|1539039_1539597_-	elongation factor P	NA	NA	NA	NA	NA
WP_004540031.1|1539786_1541007_-	elongation factor P maturation arginine rhamnosyltransferase EarP	NA	NA	NA	NA	NA
WP_004527460.1|1541230_1543474_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_004192722.1|1543601_1544195_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_004539938.1|1544959_1546159_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	34.7	7.9e-18
WP_080002859.1|1546175_1547123_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_004539756.1|1547166_1547493_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020850651.1|1547489_1547750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041188621.1|1547746_1548091_-	hypothetical protein	NA	X5I2N5	Pseudomonas_phage	71.0	6.7e-31
WP_076847822.1|1549370_1549709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539721.1|1549810_1551127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539952.1|1551126_1551573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539947.1|1551569_1551929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850499.1|1551933_1552143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539642.1|1552150_1552303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850728.1|1552305_1552521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850435.1|1553087_1553615_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004539980.1|1553708_1553915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850469.1|1553989_1554514_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	45.0	6.2e-28
WP_004540057.1|1554522_1554915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539611.1|1555069_1557808_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	43.3	1.1e-91
1556256:1556273	attR	CGGTTGAGCGCGGTGCTG	NA	NA	NA	NA
WP_076847724.1|1558087_1558885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539817.1|1559103_1559862_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	42.7	5.0e-34
WP_020850831.1|1560043_1560673_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	32.3	1.6e-06
WP_020850857.1|1560620_1562690_+|terminase	phage terminase large subunit family protein	terminase	A0A1B2LRQ2	Wolbachia_phage	34.0	1.3e-100
WP_004540003.1|1562692_1562899_+	hypothetical protein	NA	A0A2H4JA19	uncultured_Caudovirales_phage	46.8	6.5e-05
WP_004539741.1|1562900_1564424_+|portal	phage portal protein	portal	B7SYD6	Stenotrophomonas_phage	38.6	1.2e-84
WP_020850433.1|1564413_1566492_+|head,protease	caudovirus prohead protease family protein	head,protease	A0A076G7Y9	Pseudoalteromonas_phage	29.8	1.9e-67
WP_004540064.1|1566557_1566893_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_004539750.1|1566895_1567192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539916.1|1567188_1567614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850716.1|1567644_1568583_+	hypothetical protein	NA	G8CLB2	Synechococcus_phage	36.8	9.7e-48
WP_004540052.1|1568641_1568980_+	hypothetical protein	NA	F4YCS5	Synechococcus_phage	29.1	1.8e-07
WP_043944506.1|1569051_1569357_+	hypothetical protein	NA	A0A0H5ARS5	Pseudomonas_phage	44.3	7.6e-10
WP_004539854.1|1569401_1572182_+|tail	tail tape measure protein	tail	C4ML16	Xanthomonas_virus	26.1	1.3e-18
WP_076847725.1|1572171_1572510_+|tail	phage tail protein	tail	K7PHL4	Enterobacterial_phage	42.3	2.4e-17
WP_020850804.1|1572511_1573915_+|tail	tail fiber domain-containing protein	tail	Q8W6T4	Burkholderia_virus	75.9	3.0e-194
WP_004539780.1|1573911_1574604_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	65.0	2.9e-81
WP_004539701.1|1574608_1575340_+	C40 family peptidase	NA	Q8W6T2	Burkholderia_virus	50.4	1.3e-63
WP_004539859.1|1575336_1575918_+|tail	tail assembly protein	tail	Q3HQU4	Burkholderia_phage	55.7	6.9e-52
WP_004540110.1|1575914_1579286_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	48.3	2.8e-302
WP_020850420.1|1579285_1579591_+	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	73.5	1.6e-39
WP_020850642.1|1579590_1580328_+	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	68.0	2.8e-98
WP_004539903.1|1580385_1580670_+|holin	holin	holin	C7BGD7	Burkholderia_phage	90.4	4.7e-38
WP_020850783.1|1580672_1581167_+	glycoside hydrolase family 104 protein	NA	Q6J1Q5	Burkholderia_virus	79.9	6.9e-69
WP_004540004.1|1581163_1581658_+	DUF2514 family protein	NA	Q6J1Q4	Burkholderia_virus	54.5	6.7e-32
WP_004539787.1|1581825_1582614_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	90.5	6.1e-144
WP_004540087.1|1582724_1583612_+	hypothetical protein	NA	Q8W6S3	Burkholderia_virus	64.1	2.1e-92
WP_004539830.1|1583718_1584108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041188619.1|1584145_1584406_-	hypothetical protein	NA	C7BGE3	Burkholderia_phage	83.7	2.8e-37
WP_144084165.1|1584370_1584874_+	DUF159 family protein	NA	A0A1S5NTJ1	Burkholderia_phage	85.8	8.3e-70
WP_004539946.1|1584914_1585856_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_158332260.1|1586000_1586063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193834.1|1587318_1587831_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004197652.1|1587995_1588904_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004191946.1|1589030_1589897_+	pirin family protein	NA	NA	NA	NA	NA
WP_004554230.1|1590138_1590642_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004191283.1|1590776_1591649_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_004192175.1|1591659_1592106_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_020850745.1|1592132_1592792_-	SCO family protein	NA	NA	NA	NA	NA
WP_076847727.1|1592997_1593219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004550148.1|1593208_1593961_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_004203013.1|1593957_1595334_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_004539709.1|1595395_1597267_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	3.7e-38
WP_004192961.1|1597833_1598898_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_004535747.1|1599164_1600136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004204640.1|1600191_1600653_+	DUF2214 family protein	NA	NA	NA	NA	NA
WP_004524631.1|1600802_1601975_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_004191212.1|1602073_1603222_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004191603.1|1604055_1606158_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
>prophage 7
NZ_CP004368	Burkholderia pseudomallei MSHR520 chromosome 1, complete sequence	4059501	1756736	1849117	4059501	plate,portal,protease,capsid,terminase,tail,integrase,tRNA,head	uncultured_Caudovirales_phage(22.73%)	102	1765508:1765526	1823689:1823707
WP_004192783.1|1756736_1758263_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	35.6	2.8e-84
WP_004199566.1|1758356_1759461_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.1	2.2e-06
WP_004191649.1|1759800_1761495_-	single-stranded-DNA-specific exonuclease RecJ	NA	A0A0K2FM92	Brevibacillus_phage	27.3	1.1e-28
WP_004193226.1|1761510_1762587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540060.1|1763154_1764408_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_004195923.1|1764400_1765150_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.3	2.2e-34
WP_004192516.1|1765154_1765943_+	TatD family hydrolase	NA	NA	NA	NA	NA
1765508:1765526	attL	GCTGCGGCTCGCGCGCGAG	NA	NA	NA	NA
WP_020850592.1|1765995_1768524_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_004540067.1|1768560_1769388_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004192790.1|1769644_1771306_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	52.0	1.9e-150
WP_004539923.1|1771302_1772157_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.9	8.9e-48
WP_004192585.1|1772260_1773544_+	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	62.6	6.4e-151
WP_004191789.1|1773635_1774067_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_004532146.1|1774292_1774640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004191092.1|1774723_1775674_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_004524734.1|1775712_1776237_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_004191514.1|1776446_1777265_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004192762.1|1777419_1778310_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_004193008.1|1778577_1779408_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_004192132.1|1779472_1780102_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_004192745.1|1780200_1780866_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_004191887.1|1780874_1782077_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_004192474.1|1782073_1782691_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_004191516.1|1782735_1783638_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_004524737.1|1783748_1784891_+	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_004193059.1|1784895_1785672_+	MBL fold metallo-hydrolase	NA	U5PVD0	Bacillus_phage	26.6	3.3e-09
WP_004539920.1|1786398_1787586_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004524740.1|1787654_1788200_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_004540138.1|1788179_1789478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539925.1|1789464_1792149_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.3e-27
WP_004539636.1|1792308_1793610_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.9	1.8e-148
WP_009890227.1|1793560_1793803_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_004539932.1|1793811_1794285_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	2.3e-05
WP_004555250.1|1794293_1794623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540046.1|1794736_1796053_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004539832.1|1796052_1796502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004534172.1|1796498_1797104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539634.1|1797100_1797436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128972336.1|1797487_1797676_-	NlpBDapX lipoprotein	NA	NA	NA	NA	NA
WP_004555253.1|1797810_1798299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004555254.1|1798252_1798753_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024430958.1|1798869_1799079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009944042.1|1799165_1799696_+	hypothetical protein	NA	C7BGG0	Burkholderia_phage	46.8	4.4e-29
WP_024464805.1|1799709_1800063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539945.1|1800369_1800840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004540079.1|1800959_1803452_+	virulence protein E	NA	A0A2D1GN57	Marinobacter_phage	41.8	3.6e-97
WP_020850498.1|1803661_1804249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041188588.1|1804596_1804971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850524.1|1805337_1805907_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004552756.1|1805869_1807855_+|terminase	phage terminase large subunit family protein	terminase	A0A2D1GMT1	Marinobacter_phage	53.4	2.1e-180
WP_004533700.1|1807865_1808072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850457.1|1808068_1809562_+|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	51.2	4.4e-135
WP_004540078.1|1809558_1810638_+|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	37.1	1.6e-46
WP_004539732.1|1810664_1811009_+|head	head decoration protein	head	NA	NA	NA	NA
WP_080002857.1|1811043_1812069_+|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	58.8	8.3e-109
WP_004539695.1|1812072_1812363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539763.1|1812364_1812895_+|tail	phage tail protein	tail	A0A2H4JBV1	uncultured_Caudovirales_phage	28.0	9.2e-11
WP_020850797.1|1812884_1813418_+	hypothetical protein	NA	Q9JML9	Wolbachia_phage	39.5	1.4e-22
WP_004539840.1|1813420_1814101_+|plate	phage baseplate assembly protein V	plate	A0A1B2LRU5	Wolbachia_phage	34.4	1.2e-18
WP_004539700.1|1814165_1814372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539881.1|1814368_1814713_+	hypothetical protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	50.0	3.0e-23
WP_004533630.1|1814709_1815603_+|plate	baseplate J protein	plate	D5LGZ3	Escherichia_phage	40.7	1.9e-48
WP_004539949.1|1815595_1816171_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	47.7	6.0e-32
WP_004539647.1|1816158_1817622_+	hypothetical protein	NA	A4JWL8	Burkholderia_virus	77.8	8.0e-214
WP_004539865.1|1817637_1818090_+|tail	tail assembly chaperone	tail	A4JWL9	Burkholderia_virus	76.8	1.8e-44
WP_004539720.1|1818155_1819325_+|tail	phage tail sheath family protein	tail	A0A2H4J869	uncultured_Caudovirales_phage	72.9	6.9e-160
WP_004540135.1|1819335_1819839_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	50.6	1.6e-41
WP_004533642.1|1819908_1820211_+|tail	phage tail assembly protein	tail	V5YST8	Pseudomonas_phage	37.2	1.5e-05
WP_004539677.1|1820298_1822713_+|tail	phage tail tape measure protein	tail	A0A2H4JG00	uncultured_Caudovirales_phage	34.3	6.4e-67
WP_004539752.1|1822721_1823603_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	37.4	3.9e-30
WP_004540041.1|1823577_1823784_+|tail	phage tail protein	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	61.2	4.0e-15
1823689:1823707	attR	CTCGCGCGCGAGCCGCAGC	NA	NA	NA	NA
WP_004539808.1|1823793_1824846_+	phage late control protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	44.5	1.7e-77
WP_004533694.1|1824921_1825116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539628.1|1825108_1825606_+	lysozyme	NA	A4JX20	Burkholderia_virus	78.2	2.2e-67
WP_004539940.1|1825605_1826151_+	lysozyme	NA	Q8W6S5	Burkholderia_virus	96.7	6.4e-84
WP_004540080.1|1826294_1827083_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	97.7	6.1e-152
WP_004539736.1|1827123_1827834_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	41.5	1.4e-38
WP_038732294.1|1827845_1828361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850500.1|1828332_1828806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004539924.1|1828798_1829305_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.4	5.1e-19
WP_004539640.1|1829301_1829727_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
WP_020850431.1|1830124_1830505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540114.1|1830964_1831192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_133604798.1|1831188_1831587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540053.1|1832239_1832701_+	excisionase family DNA-binding protein	NA	K4ICM4	Acidithiobacillus_phage	67.3	6.7e-50
WP_004539802.1|1832705_1833281_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	70.4	5.4e-73
WP_004540097.1|1833466_1835683_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004524743.1|1836159_1836387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191077.1|1836931_1837111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004527347.1|1837294_1837567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004191664.1|1837835_1838639_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_004524745.1|1838682_1838934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004539789.1|1838939_1839851_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_004539737.1|1840041_1840827_+	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_020850718.1|1841162_1841963_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004193779.1|1841987_1842479_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	33.3	4.2e-10
WP_004191635.1|1842559_1843135_-	peptidyl-prolyl cis-trans isomerase	NA	A0A1V0SCU1	Indivirus	39.3	5.3e-12
WP_004195907.1|1843191_1843914_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004192752.1|1844145_1845543_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	33.8	1.8e-42
WP_004205123.1|1845590_1846529_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_004193249.1|1846632_1847604_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_004538130.1|1847647_1849117_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP004368	Burkholderia pseudomallei MSHR520 chromosome 1, complete sequence	4059501	2042275	2050468	4059501		Burkholderia_virus(50.0%)	12	NA	NA
WP_004196630.1|2042275_2042539_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
WP_076839978.1|2042522_2042708_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	83.3	5.8e-21
WP_009920998.1|2042728_2043454_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	44.0	5.8e-32
WP_004539879.1|2044403_2044910_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.9	1.3e-19
WP_004539795.1|2044906_2045332_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	3.8e-15
WP_009937072.1|2045612_2046008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009919883.1|2046259_2046487_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	72.7	4.2e-21
WP_004527234.1|2046522_2046756_-	hypothetical protein	NA	A4PE26	Ralstonia_virus	60.6	4.3e-13
WP_004550288.1|2046831_2047293_-	avidin	NA	NA	NA	NA	NA
WP_004193710.1|2048231_2048414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193371.1|2048540_2049164_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_004539691.1|2049358_2050468_-	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	31.3	1.6e-36
>prophage 9
NZ_CP004368	Burkholderia pseudomallei MSHR520 chromosome 1, complete sequence	4059501	3475495	3486439	4059501	protease	Agrobacterium_phage(16.67%)	10	NA	NA
WP_004196461.1|3475495_3477796_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|3477792_3478107_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|3478639_3478843_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_004541727.1|3478972_3480583_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|3480595_3480778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|3480750_3482010_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|3482277_3482856_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|3483117_3483336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004530837.1|3483527_3484037_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|3484324_3486439_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 1
NZ_CP004369	Burkholderia pseudomallei MSHR520 chromosome 2, complete sequence	3391010	963004	1044071	3391010	transposase,protease,tRNA	Leptospira_phage(22.22%)	45	NA	NA
WP_004540193.1|963004_963982_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_024430891.1|964124_965369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158332262.1|965361_965808_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_085966798.1|967648_968748_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.3	9.1e-37
WP_144084137.1|971878_972283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071898245.1|972230_972740_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_004540177.1|974462_975722_-	DUF3443 family protein	NA	NA	NA	NA	NA
WP_020850102.1|975718_976198_-	DUF2844 domain-containing protein	NA	NA	NA	NA	NA
WP_124518502.1|978417_978519_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_004540565.1|978549_978768_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_004540443.1|979215_979929_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071898247.1|982120_982621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540369.1|983738_985160_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	28.5	1.5e-20
WP_004540191.1|985499_986342_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_004540242.1|986412_987192_-	SapC family protein	NA	NA	NA	NA	NA
WP_124518497.1|987201_989532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020849944.1|989656_1005952_-	putative bpaA	NA	NA	NA	NA	NA
WP_043944145.1|1006241_1006598_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_085966799.1|1008065_1009164_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.0	3.3e-55
WP_080002865.1|1009297_1009909_-	MepB family protein	NA	NA	NA	NA	NA
WP_020850359.1|1013634_1015107_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_004190933.1|1016539_1018582_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.0	4.2e-35
WP_004540553.1|1018640_1018979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190679.1|1019025_1020900_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.2	4.9e-67
WP_004190948.1|1020994_1021441_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	8.8e-23
WP_004190342.1|1021607_1021820_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_004540586.1|1021899_1023123_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011204325.1|1023268_1024309_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	53.1	1.7e-93
WP_004195713.1|1024705_1025515_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_004540286.1|1025665_1027570_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_004525142.1|1027653_1028538_-	(2E,6E)-farnesyl diphosphate synthase	NA	NA	NA	NA	NA
WP_004190549.1|1028534_1028828_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_004190814.1|1029097_1030204_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004190656.1|1030351_1031221_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_004190499.1|1031279_1032155_-	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_004539387.1|1032314_1032536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004529029.1|1032718_1034668_+	membrane protein	NA	NA	NA	NA	NA
WP_004190401.1|1034889_1036272_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004540200.1|1036590_1039362_-	DNA polymerase I	NA	S5M8J1	Bacillus_phage	30.0	6.4e-71
WP_004530319.1|1039363_1040113_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	37.8	5.6e-22
WP_004190924.1|1040109_1040379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004529031.1|1040530_1040815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004540549.1|1041474_1041966_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004540321.1|1042402_1042666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540326.1|1042844_1044071_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP004369	Burkholderia pseudomallei MSHR520 chromosome 2, complete sequence	3391010	1416602	1487909	3391010	transposase,plate,integrase	Planktothrix_phage(15.38%)	45	1411230:1411249	1491508:1491527
1411230:1411249	attL	TTCGCCGCGCCGTTTGTCGC	NA	NA	NA	NA
WP_004540471.1|1416602_1418288_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_020850088.1|1418737_1423306_-	RHS repeat-associated core domain protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.3	2.4e-22
WP_004524859.1|1423319_1424588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009935223.1|1426523_1426970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153260275.1|1426948_1427539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004540568.1|1428123_1428723_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_004524853.1|1428747_1429158_-	RidA family protein	NA	NA	NA	NA	NA
WP_004524852.1|1429272_1430382_-	asparaginase	NA	NA	NA	NA	NA
WP_004557904.1|1430562_1431195_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004524850.1|1432096_1432534_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020849981.1|1433770_1434844_-	porin	NA	NA	NA	NA	NA
WP_004540527.1|1435261_1436686_-	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_011205727.1|1436901_1438086_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_020850047.1|1438096_1438984_-	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_004524844.1|1438986_1439757_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_020850130.1|1439771_1440635_-	sugar ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	25.4	1.9e-13
WP_004524842.1|1440631_1441600_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004540209.1|1441620_1442619_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004524840.1|1442656_1443859_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.9	6.9e-46
WP_004557914.1|1443869_1444583_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004540362.1|1444714_1445605_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_004540151.1|1446045_1446642_-	plasmid pRiA4b ORF-3 family protein	NA	A0A2H4PDG5	Mycobacterium_phage	38.1	6.0e-27
WP_004540399.1|1450134_1450482_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	72.9	2.1e-40
WP_004552577.1|1450478_1450886_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	37.3	2.9e-12
WP_038733539.1|1451318_1453352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038733536.1|1453592_1455764_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_004524829.1|1455768_1456620_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_004524828.1|1456620_1457544_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_004540455.1|1457605_1458847_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_020849913.1|1458882_1460127_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.8	7.1e-22
WP_041188417.1|1460169_1460808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004536893.1|1462580_1463735_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_004524822.1|1465078_1465819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024429920.1|1466247_1466403_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	75.7	1.8e-07
WP_020850165.1|1466368_1466875_+	recombinase family protein	NA	A0JC18	Ralstonia_phage	51.7	2.2e-17
WP_076847933.1|1469161_1469728_-	suppressor of fused domain protein	NA	NA	NA	NA	NA
WP_085966800.1|1472865_1474046_-|transposase	IS3-like element ISBps1 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	2.2e-60
WP_004540288.1|1474672_1475824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071811398.1|1475834_1476122_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004540427.1|1477129_1479061_-|transposase	transposase	transposase	S5WIU1	Leptospira_phage	50.4	6.9e-32
WP_041188419.1|1478990_1479701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004203275.1|1479716_1481921_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_004540478.1|1481917_1484584_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	1.8e-78
WP_004540225.1|1484562_1486041_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004524812.1|1486037_1487909_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
1491508:1491527	attR	TTCGCCGCGCCGTTTGTCGC	NA	NA	NA	NA
>prophage 3
NZ_CP004369	Burkholderia pseudomallei MSHR520 chromosome 2, complete sequence	3391010	2385183	2394509	3391010	transposase,integrase	Burkholderia_virus(57.14%)	11	2380113:2380129	2406316:2406332
2380113:2380129	attL	CGCGGCGAGCGCCTGCA	NA	NA	NA	NA
WP_004188376.1|2385183_2387166_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	44.8	1.8e-83
WP_004547951.1|2387263_2387644_+	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_004525415.1|2387637_2389653_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_004542585.1|2389948_2391148_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JX31	Burkholderia_virus	99.5	1.1e-224
WP_004542626.1|2391144_2391294_-	bacteriophage protein Gp44	NA	Q8W6Q6	Burkholderia_virus	98.0	7.4e-19
WP_004542548.1|2391549_2392131_+	hypothetical protein	NA	A9YX38	Burkholderia_phage	100.0	2.2e-21
WP_004552392.1|2392361_2392580_-	hypothetical protein	NA	Q6JIH9	Burkholderia_virus	98.6	9.8e-36
WP_004525418.1|2392627_2392849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004552388.1|2393125_2393401_-	bacteriophage protein Gp49	NA	Q6JIH4	Burkholderia_virus	96.7	2.3e-42
WP_009923450.1|2393971_2394241_+	BrnT family toxin	NA	NA	NA	NA	NA
WP_004525420.1|2394224_2394509_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
2406316:2406332	attR	CGCGGCGAGCGCCTGCA	NA	NA	NA	NA
>prophage 4
NZ_CP004369	Burkholderia pseudomallei MSHR520 chromosome 2, complete sequence	3391010	2547193	2618698	3391010	plate,holin	Vibrio_phage(25.0%)	53	NA	NA
WP_004525541.1|2547193_2547961_-|holin	phosphocholine cytidylyltransferase family protein	holin	NA	NA	NA	NA
WP_004542630.1|2547999_2549001_-	HpnL family protein	NA	NA	NA	NA	NA
WP_004542606.1|2548997_2549771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004188272.1|2549767_2550457_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_004188420.1|2550822_2552337_+	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
WP_004525545.1|2554046_2554985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004202234.1|2555018_2555567_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190846.1|2555569_2557075_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004530039.1|2557218_2557746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190879.1|2557825_2558257_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_004196180.1|2558270_2560133_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004190851.1|2560129_2561119_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004525547.1|2561121_2563992_+	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	2.4e-60
WP_004525548.1|2563982_2566274_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004190563.1|2566439_2568728_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004542632.1|2568731_2570948_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|2570947_2572018_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004530790.1|2572020_2572737_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004190606.1|2572779_2573169_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004202226.1|2573174_2573768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020850152.1|2573764_2575126_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004525553.1|2575208_2576867_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004525554.1|2576863_2580367_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004190863.1|2580425_2580785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190471.1|2580807_2581233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004536812.1|2581553_2581829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004524288.1|2582379_2583279_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004542286.1|2583320_2583611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020850331.1|2583500_2584820_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_004528658.1|2584816_2586403_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_004524284.1|2586691_2587687_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004528656.1|2587982_2589566_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004186853.1|2590058_2591312_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004543122.1|2591844_2593509_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.6	9.2e-57
WP_004186967.1|2593641_2595126_-	glycoside hydrolase 68 family protein	NA	NA	NA	NA	NA
WP_004530800.1|2595395_2596412_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|2596851_2598051_+	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004198247.1|2598228_2599254_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004543129.1|2599688_2600963_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	9.0e-105
WP_004186989.1|2601035_2602007_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004186987.1|2602157_2602691_+	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004523137.1|2602751_2604815_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186901.1|2604817_2606743_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004202150.1|2606747_2607920_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_004530055.1|2607916_2608702_+	drug:proton antiporter	NA	NA	NA	NA	NA
WP_009975601.1|2608753_2609995_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004543120.1|2610015_2611161_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004186918.1|2611270_2612134_+	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004530057.1|2612314_2613970_+	APC family permease	NA	NA	NA	NA	NA
WP_004186920.1|2614056_2614932_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_021252052.1|2615075_2615948_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004543140.1|2616110_2617664_+|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_041188444.1|2617660_2618698_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
>prophage 5
NZ_CP004369	Burkholderia pseudomallei MSHR520 chromosome 2, complete sequence	3391010	3354302	3361063	3391010		Burkholderia_virus(50.0%)	8	NA	NA
WP_006027262.1|3354302_3354599_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A4JWV2	Burkholderia_virus	99.0	5.6e-50
WP_004202809.1|3354601_3354958_+	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	100.0	3.9e-42
WP_004542845.1|3355001_3355151_-	hypothetical protein	NA	A4JWV0	Burkholderia_virus	96.3	9.1e-09
WP_020850286.1|3356147_3356630_-	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_041188525.1|3356699_3357599_-	hypothetical protein	NA	A0JC16	Ralstonia_phage	39.1	6.3e-36
WP_020850011.1|3358100_3358685_-	hypothetical protein	NA	A0A0K2QQ53	Ralstonia_phage	53.1	2.5e-09
WP_020850148.1|3358784_3360161_-	type II/III secretion system protein	NA	NA	NA	NA	NA
WP_020850003.1|3360157_3361063_-	AAA family ATPase	NA	Q6UAZ2	Ralstonia_phage	37.2	1.1e-27
