The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007230	Yersinia similis strain Y_sim_228 chromosome, complete genome	4903722	422587	483183	4903722	protease,integrase,tRNA,transposase	Paramecium_bursaria_Chlorella_virus(14.29%)	49	416570:416585	487206:487221
416570:416585	attL	AATGATTGCACTGAGC	NA	NA	NA	NA
WP_038402335.1|422587_423100_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_025381128.1|423197_423905_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_025381129.1|424124_424856_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_025381130.1|424881_425841_+	glutathione synthase	NA	NA	NA	NA	NA
WP_025381131.1|425957_426521_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_025381132.1|426520_426943_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_025381133.1|427123_428008_+	N-carbamoylputrescine amidase	NA	A7IVZ1	Paramecium_bursaria_Chlorella_virus	50.7	7.0e-80
WP_025381134.1|428011_429127_+	agmatine deiminase	NA	M1I1E2	Acanthocystis_turfacea_Chlorella_virus	51.3	9.4e-98
WP_025381135.1|429240_430365_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_025381136.1|430384_431083_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_025381137.1|431164_431986_+	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_025381138.1|432273_432828_+	YggT family protein	NA	NA	NA	NA	NA
WP_038401986.1|432824_433115_+	YggU family protein	NA	NA	NA	NA	NA
WP_025381140.1|433211_433805_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_025381141.1|433797_434928_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_025381142.1|435074_444350_-	VCBS repeat-containing protein	NA	NA	NA	NA	NA
WP_025381143.1|444761_445496_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_025381144.1|445608_446535_-	glutaminase B	NA	NA	NA	NA	NA
WP_025381145.1|446645_446972_-	YggL family protein	NA	NA	NA	NA	NA
WP_025381146.1|446971_447691_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_038402337.1|448251_449340_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002230648.1|449559_449832_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_025381147.1|450510_451587_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_025381148.1|451795_452896_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038402338.1|452984_455018_+	TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	26.1	3.4e-05
WP_025381150.1|455158_456142_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025381151.1|456153_457674_-	sugar ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.5	1.1e-08
WP_025381152.1|457719_458679_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025381153.1|459279_461439_-	ornithine decarboxylase SpeF	NA	NA	NA	NA	NA
WP_012105761.1|462436_463405_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_025381154.1|463446_464643_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_038402341.1|464855_465413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025381155.1|465495_466401_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_012105765.1|466510_467482_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.7	2.5e-46
WP_012105766.1|468149_468581_+	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_025381156.1|468611_472868_+	PAAR domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.3	7.6e-31
WP_025381157.1|472881_473496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025381158.1|473840_474731_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_025381159.1|474899_475097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025381160.1|475867_477127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025381161.1|477194_477458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025381162.1|477516_479037_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_012105775.1|479036_480443_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_025381163.1|480463_481417_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_025381164.1|481413_481818_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_071825425.1|482213_482363_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_072081502.1|482378_482546_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_025381165.1|482612_482843_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144236043.1|482916_483183_+|transposase	transposase	transposase	A0A218MNE7	uncultured_virus	45.0	4.1e-12
487206:487221	attR	GCTCAGTGCAATCATT	NA	NA	NA	NA
>prophage 2
NZ_CP007230	Yersinia similis strain Y_sim_228 chromosome, complete genome	4903722	505236	545802	4903722	integrase,transposase	Sodalis_phage(37.5%)	45	531343:531357	539130:539144
WP_048677776.1|505236_506157_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.2	2.3e-73
WP_049870173.1|506559_507504_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.5	1.8e-73
WP_025381185.1|507597_508875_-	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_025381186.1|508878_509547_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_025381187.1|509543_510131_-	pilus assembly protein PilX	NA	NA	NA	NA	NA
WP_080984345.1|510145_511246_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_025381189.1|511247_512801_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_012105809.1|512810_513305_-	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_025381190.1|513291_514629_-	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_012105812.1|516237_516675_-	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_025381191.1|516676_517747_-	TcpQ domain-containing protein	NA	NA	NA	NA	NA
WP_012105814.1|517884_518271_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_012105815.1|518267_518501_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_025381192.1|518671_519103_-	DUF29 domain-containing protein	NA	NA	NA	NA	NA
WP_048677710.1|519305_519800_-	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_012105819.1|520148_520907_-	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_025381193.1|521066_522266_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025381194.1|522501_522732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025381195.1|522731_523313_-	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_025381196.1|523309_524992_-	ParB family protein	NA	NA	NA	NA	NA
WP_025381197.1|524984_526346_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	53.7	4.0e-119
WP_025381198.1|526338_527220_-	ParA family protein	NA	NA	NA	NA	NA
WP_025381199.1|527570_528533_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_080357484.1|528638_528866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071825427.1|528852_529038_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_144236045.1|529218_529392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038401990.1|529846_531079_-	TraI domain-containing protein	NA	NA	NA	NA	NA
531343:531357	attL	ACCAAAGGGGCTGGC	NA	NA	NA	NA
WP_144236105.1|531432_531723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025381204.1|531774_532773_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	39.3	1.7e-50
WP_025381205.1|532919_533342_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	36.9	1.5e-11
WP_025381206.1|533696_534593_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_025381207.1|535902_536823_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.7	1.7e-73
WP_158499225.1|536903_537245_+	hypothetical protein	NA	A0A0M4S6F6	Salmonella_phage	57.8	8.2e-13
WP_025381209.1|537219_537564_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_025381210.1|537565_537883_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_167330747.1|537954_538125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025381211.1|538265_538472_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_025381212.1|538461_538794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025381213.1|539518_539737_+	hypothetical protein	NA	NA	NA	NA	NA
539130:539144	attR	GCCAGCCCCTTTGGT	NA	NA	NA	NA
WP_025381214.1|539775_541287_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_025381215.1|541286_541637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025381216.1|541639_543061_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_025381217.1|543084_544038_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_048677701.1|544034_544388_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_144236046.1|544636_545802_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	47.5	7.8e-71
>prophage 3
NZ_CP007230	Yersinia similis strain Y_sim_228 chromosome, complete genome	4903722	579284	611896	4903722	holin,tail,transposase	Shigella_phage(14.29%)	26	NA	NA
WP_019083256.1|579284_579593_-|transposase	transposase	transposase	Q716C1	Shigella_phage	45.0	3.4e-18
WP_025381256.1|579692_581159_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_025381257.1|581826_582477_+	acyl-homoserine-lactone synthase	NA	NA	NA	NA	NA
WP_025381258.1|582457_583201_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025381260.1|584692_585526_+	intradiol ring-cleavage dioxygenase	NA	NA	NA	NA	NA
WP_025381261.1|586077_586734_-	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	29.4	8.4e-22
WP_025381262.1|586874_587774_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_025381263.1|587778_590211_+	formate C-acetyltransferase/glycerol dehydratase family glycyl radical enzyme	NA	A0A2K8HAT8	Bacteriophage	43.9	5.2e-08
WP_025381264.1|590624_591380_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_048677769.1|591860_592145_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025381267.1|593341_595438_-	ATP-binding protein	NA	A0A1V0SHU6	Klosneuvirus	29.1	1.5e-08
WP_025381268.1|595473_596904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144236048.1|596989_597925_-|tail	tail fiber protein	tail	F2Y385	Organic_Lake_phycodnavirus	30.9	7.3e-11
WP_025381270.1|597960_600819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025381271.1|600811_603040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025381272.1|603131_603548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025381273.1|603544_603967_-	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_025381274.1|603976_605572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025381275.1|605568_606258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025381276.1|606254_606437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025381277.1|606433_606892_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_025381278.1|606908_608135_-|tail	phage tail sheath family protein	tail	A0A2I7QP51	Vibrio_phage	31.1	7.1e-06
WP_025381279.1|608205_609597_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_025381280.1|609620_610688_-|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_025381281.1|610726_611176_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_025381282.1|611578_611896_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	43.2	2.1e-15
>prophage 4
NZ_CP007230	Yersinia similis strain Y_sim_228 chromosome, complete genome	4903722	2072906	2152092	4903722	protease,integrase,tRNA,transposase	Staphylococcus_phage(10.0%)	59	2066234:2066255	2149624:2149645
2066234:2066255	attL	GTTGCCGCCTTCCTGCCACTCG	NA	NA	NA	NA
WP_025382320.1|2072906_2074079_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_025382321.1|2074084_2075668_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_025382322.1|2075660_2077670_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_025382323.1|2077662_2078139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025382324.1|2078140_2083252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025382325.1|2083875_2084190_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_144236056.1|2084410_2085522_-|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	29.7	9.9e-07
WP_025382327.1|2086629_2087454_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_025382328.1|2087466_2088723_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_025382329.1|2088719_2090177_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_025382330.1|2090175_2090397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025382331.1|2090618_2091440_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_025382332.1|2091573_2092446_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_025382333.1|2092576_2093611_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_025382334.1|2094486_2094696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025382335.1|2095991_2096519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025382336.1|2096632_2099032_+	PefC/AfrB family outer membrane usher protein	NA	NA	NA	NA	NA
WP_025382337.1|2099024_2099720_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_080984315.1|2099805_2100294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144236066.1|2100420_2101206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145479651.1|2101287_2101875_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_025382341.1|2102367_2102601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025382342.1|2102849_2103386_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	38.8	1.0e-25
WP_071825463.1|2104343_2104448_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_025382343.1|2104479_2104890_-	subtilase	NA	A0A0U2KD34	Escherichia_phage	48.2	2.9e-28
WP_025382344.1|2105345_2107907_+	enhancing factor	NA	A0A068LKB3	Peridroma_alphabaculovirus	23.0	1.2e-39
WP_025382345.1|2108958_2109534_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_025382346.1|2109953_2112017_+	formate-dependent uric acid utilization protein AegA	NA	NA	NA	NA	NA
WP_025382347.1|2112039_2112597_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_025382348.1|2112619_2114767_+	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_025382349.1|2114818_2116642_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_025382350.1|2116617_2116977_-	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_025382351.1|2118581_2120018_-	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_038402513.1|2120465_2121035_+	membrane protein FxsA	NA	NA	NA	NA	NA
WP_025382353.1|2121291_2121585_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	35.8	4.3e-10
WP_025382354.1|2121631_2123278_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	66.7	2.1e-183
WP_025382355.1|2123894_2124278_+	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_025382356.1|2124427_2125456_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_025382357.1|2125491_2126058_+	elongation factor P	NA	NA	NA	NA	NA
WP_002228124.1|2126505_2126820_+	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_025382358.1|2126982_2127339_-	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_025382359.1|2127355_2127748_-	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_025382360.1|2127764_2128499_-	succinate dehydrogenase/fumarate reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_025382361.1|2128491_2130306_-	fumarate reductase (quinol) flavoprotein subunit	NA	A0A2P0ZL82	Lactobacillus_phage	28.3	1.6e-17
WP_025382362.1|2130764_2131742_+	elongation factor P--(R)-beta-lysine ligase	NA	NA	NA	NA	NA
WP_025382363.1|2131849_2135191_-	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_025382364.1|2135232_2136114_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_025382365.1|2136554_2137607_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_025382366.1|2137805_2138351_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.7	5.9e-29
WP_025382367.1|2139730_2140987_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_025382368.1|2140985_2142500_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_025382369.1|2142510_2142981_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_025382370.1|2142988_2144938_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	M1HNA7	Bacillus_virus	27.1	2.6e-26
WP_025382371.1|2144953_2146843_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.5e-58
WP_025382372.1|2146835_2147777_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_004392473.1|2147893_2148199_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_002209152.1|2148297_2149584_+	GTPase HflX	NA	NA	NA	NA	NA
WP_025382373.1|2149824_2151084_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
2149624:2149645	attR	CGAGTGGCAGGAAGGCGGCAAC	NA	NA	NA	NA
WP_025382374.1|2151087_2152092_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 5
NZ_CP007230	Yersinia similis strain Y_sim_228 chromosome, complete genome	4903722	2985594	3060724	4903722	terminase,capsid,portal,holin,protease,tRNA,tail,head	Enterobacterial_phage(12.77%)	75	NA	NA
WP_025382983.1|2985594_2988177_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	3.3e-186
WP_025382984.1|2988438_2988921_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_025382985.1|2989054_2989780_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	2.2e-31
WP_025382986.1|2989779_2990454_-	glutamate/aspartate ABC transporter permease GltK	NA	NA	NA	NA	NA
WP_025382987.1|2990453_2991194_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_025382988.1|2991366_2992284_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025382989.1|2992946_2994494_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_002210342.1|2994501_2995380_-	CNNM family magnesium/cobalt transport protein CorC	NA	NA	NA	NA	NA
WP_011191934.1|2995497_2995971_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_025382990.1|2995967_2997041_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	2.5e-47
WP_038402586.1|2997367_2998792_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_025382992.1|2999035_3000217_+	2-octaprenyl-3-methyl-6-methoxy-1,4-benzoquinol hydroxylase	NA	NA	NA	NA	NA
WP_025382993.1|3001656_3003321_-	asparagine synthase B	NA	H8ZJK1	Ostreococcus_tauri_virus	39.2	5.2e-84
WP_025382994.1|3003674_3004427_-	HAD-IIA family hydrolase	NA	NA	NA	NA	NA
WP_025382995.1|3004499_3005726_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_025382996.1|3005742_3006888_-	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_025382997.1|3006907_3007708_-	glucosamine-6-phosphate deaminase	NA	NA	NA	NA	NA
WP_025382998.1|3008105_3010139_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_025382999.1|3010353_3012021_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	86.9	4.0e-294
WP_025383000.1|3012697_3014119_+	outer membrane porin, OprD family	NA	NA	NA	NA	NA
WP_025383001.1|3014387_3017063_+	carbohydate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011191941.1|3017627_3018074_-	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_025383003.1|3018440_3018968_-	flavodoxin FldA	NA	NA	NA	NA	NA
WP_002212202.1|3019376_3019664_-	LexA regulated protein	NA	NA	NA	NA	NA
WP_025383004.1|3019995_3020763_-	esterase	NA	G1DB77	Mycobacterium_phage	38.4	4.0e-07
WP_025383006.1|3021745_3022936_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	66.1	8.3e-145
WP_025383007.1|3022896_3023103_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.5	4.2e-20
WP_025383008.1|3023158_3023566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155408954.1|3023555_3023726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048677856.1|3023738_3024554_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	37.9	2.0e-20
WP_025383010.1|3024635_3025166_-	hypothetical protein	NA	K7PKJ9	Enterobacteria_phage	57.6	6.5e-49
WP_025383011.1|3025258_3026086_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	60.6	1.4e-87
WP_025383012.1|3026134_3026506_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	73.3	3.4e-44
WP_025383014.1|3027568_3028216_-	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	39.6	1.8e-29
WP_025383015.1|3028318_3028528_+	cell division protein	NA	NA	NA	NA	NA
WP_025383016.1|3028562_3029108_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	46.9	1.3e-39
WP_038402157.1|3029299_3029479_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	48.0	3.2e-08
WP_025383018.1|3029475_3030585_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	58.6	8.0e-41
WP_048677854.1|3030581_3030818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383020.1|3030810_3031524_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	69.2	4.6e-90
WP_025383021.1|3031520_3031898_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	65.8	1.4e-42
WP_038402158.1|3032192_3032891_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	54.3	3.1e-59
WP_025383023.1|3032887_3033919_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.4	1.7e-93
WP_025383024.1|3033998_3034358_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	61.9	2.7e-38
WP_081009550.1|3034396_3034831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048677853.1|3034913_3035249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048677851.1|3035365_3035839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174407869.1|3036538_3036964_-	hypothetical protein	NA	E5AGG6	Erwinia_phage	45.9	2.5e-19
WP_025383026.1|3037042_3037498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383027.1|3037812_3038157_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	59.5	7.7e-27
WP_025383028.1|3038166_3038565_+	M15 family metallopeptidase	NA	D5JFH4	Klebsiella_phage	61.4	1.3e-33
WP_025383030.1|3038767_3039157_+	hypothetical protein	NA	Q8SBD9	Shigella_phage	30.8	2.2e-06
WP_025383032.1|3040397_3040595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383033.1|3040598_3040940_+	HNH endonuclease	NA	K7PM05	Enterobacterial_phage	72.7	1.5e-43
WP_025383034.1|3041128_3041614_+	hypothetical protein	NA	K7PGU7	Enterobacterial_phage	75.2	2.6e-60
WP_025383035.1|3041622_3043137_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	75.4	4.4e-223
WP_038402159.1|3043136_3044387_+|portal	phage portal protein	portal	F1C584	Cronobacter_phage	79.1	9.9e-197
WP_025383036.1|3044430_3045120_+|head,protease	HK97 family phage prohead protease	head,protease	Q9MCV5	Escherichia_phage	75.7	1.9e-93
WP_025383037.1|3045103_3046279_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	86.4	5.1e-187
WP_025383038.1|3046314_3046635_+|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	58.1	8.2e-31
WP_025383039.1|3046634_3046958_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	58.5	7.0e-30
WP_025383040.1|3046954_3047401_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	51.0	1.6e-32
WP_025383041.1|3047397_3047748_+	DUF3168 domain-containing protein	NA	A0A1P8DTJ3	Proteus_phage	50.0	6.9e-23
WP_025383042.1|3047803_3048511_+	Ig-like domain-containing protein	NA	A0A1W6JP06	Morganella_phage	66.2	5.8e-45
WP_025383043.1|3048513_3048894_+	hypothetical protein	NA	A0A1P8DTJ2	Proteus_phage	51.6	1.2e-23
WP_038402595.1|3048917_3049193_+	DUF4035 domain-containing protein	NA	K7PLY6	Enterobacterial_phage	51.7	3.2e-15
WP_025383045.1|3049231_3049645_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	57.7	7.1e-43
WP_158499217.1|3049726_3053080_+	tape measure protein	NA	A0A1P8DTH2	Proteus_phage	27.6	8.6e-62
WP_025383047.1|3053084_3053681_+	hypothetical protein	NA	Q7Y3Z8	Yersinia_phage	78.8	9.4e-89
WP_025383048.1|3053680_3054265_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	78.4	1.5e-86
WP_025383049.1|3054276_3054678_+	hypothetical protein	NA	Q7Y3Z5	Yersinia_phage	80.5	6.8e-59
WP_025383050.1|3054670_3057217_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	89.7	0.0e+00
WP_025383051.1|3057221_3058250_+	hypothetical protein	NA	Q7Y3Z1	Yersinia_phage	81.6	8.5e-162
WP_025383052.1|3058262_3060254_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q7Y3Z0	Yersinia_phage	51.7	6.6e-86
WP_174407870.1|3060262_3060724_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	36.3	1.8e-07
>prophage 6
NZ_CP007230	Yersinia similis strain Y_sim_228 chromosome, complete genome	4903722	3195249	3240989	4903722	protease,tail,plate	Pseudomonas_phage(25.0%)	39	NA	NA
WP_025383158.1|3195249_3195759_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_025383159.1|3195792_3196050_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	54.2	1.2e-19
WP_025383160.1|3196053_3197184_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.3	1.3e-171
WP_025383161.1|3197375_3199664_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	64.9	1.1e-286
WP_025383162.1|3200157_3200886_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_025383163.1|3201187_3203863_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	A0A172JHV7	Bacillus_phage	30.9	1.1e-104
WP_072081306.1|3204047_3206921_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	28.0	3.8e-42
WP_002210824.1|3206988_3207642_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_025383165.1|3207644_3210338_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_025383166.1|3210361_3211516_-	MFS transporter	NA	NA	NA	NA	NA
WP_025383168.1|3212617_3213745_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.9	6.3e-110
WP_080984310.1|3213781_3214393_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025383170.1|3214516_3214978_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_025383171.1|3215608_3216775_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	NA	NA	NA	NA
WP_025383172.1|3217066_3218593_-	MFS transporter	NA	NA	NA	NA	NA
WP_025383173.1|3219018_3220047_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_025383174.1|3220120_3221908_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.7	2.6e-09
WP_025383175.1|3222273_3223209_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_025383176.1|3223379_3223622_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	66.2	1.8e-22
WP_002208864.1|3223827_3224550_-	LexA family transcriptional regulator	NA	F1C599	Cronobacter_phage	51.9	2.2e-63
WP_025383177.1|3224824_3225304_+	antitermination protein Q	NA	S5M7R9	Escherichia_phage	61.0	2.3e-37
WP_025383178.1|3225510_3226797_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	46.6	9.5e-94
WP_038402609.1|3226904_3227534_+	aldolase	NA	A0A077SK32	Escherichia_phage	54.5	5.0e-56
WP_025383180.1|3227536_3228349_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_038402170.1|3228324_3229098_+	hydroxypyruvate isomerase family protein	NA	NA	NA	NA	NA
WP_025383182.1|3229778_3230069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038402612.1|3230163_3230715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383183.1|3230719_3230914_+	DUF2635 domain-containing protein	NA	B5TK66	Pseudomonas_phage	58.3	1.0e-07
WP_025383184.1|3230910_3232419_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.4	6.3e-105
WP_025383185.1|3232470_3232839_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_025383186.1|3232840_3233140_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_025383187.1|3233260_3234757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383188.1|3234863_3236270_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	34.2	7.1e-18
WP_025383189.1|3236266_3237322_+|tail	tail protein	tail	M1PVV2	Vibrio_phage	27.2	6.7e-37
WP_025383190.1|3237337_3237934_+|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_025383191.1|3237930_3238386_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	43.8	1.5e-17
WP_025383192.1|3238389_3239526_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	29.0	1.3e-30
WP_048677176.1|3239522_3240125_+	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.6	9.7e-33
WP_002208845.1|3240209_3240989_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	52.4	7.1e-52
>prophage 7
NZ_CP007230	Yersinia similis strain Y_sim_228 chromosome, complete genome	4903722	3453887	3512147	4903722	plate,integrase,terminase,protease,holin,head	Burkholderia_phage(27.27%)	77	3467900:3467923	3512366:3512389
WP_038402625.1|3453887_3455639_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_025383345.1|3455849_3456305_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_002213066.1|3456408_3457470_-	porin OmpA	NA	NA	NA	NA	NA
WP_025383346.1|3457827_3458334_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_025383347.1|3458562_3459216_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_025383348.1|3459281_3461417_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_025383349.1|3461446_3461893_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_025383350.1|3462086_3464141_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.5	1.3e-15
WP_025383351.1|3464203_3464662_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_025383352.1|3464840_3465521_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_025383353.1|3465834_3466251_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_025383354.1|3466370_3466688_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_025383355.1|3466748_3467939_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	W6LLI2	Streptococcus_phage	27.8	7.8e-26
3467900:3467923	attL	ATTTTTCACGTCCTTTAGCAAGAA	NA	NA	NA	NA
WP_025383356.1|3468000_3469062_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q9MCR4	Enterobacteria_phage	51.4	3.0e-101
WP_048677086.1|3469000_3469324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383358.1|3469616_3469880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383359.1|3469909_3470173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155483252.1|3470162_3470333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383360.1|3470345_3470633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383361.1|3470644_3471202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383362.1|3471201_3471540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383363.1|3471664_3471982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383364.1|3472055_3472748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383365.1|3473401_3473908_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	79.2	8.4e-54
WP_025383366.1|3473908_3474538_-	ERF family protein	NA	I6RSN3	Salmonella_phage	63.2	1.0e-64
WP_167330751.1|3474546_3474717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144236081.1|3474820_3474952_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	60.0	3.1e-05
WP_025383367.1|3474969_3475941_-	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	66.3	3.5e-48
WP_025383368.1|3476176_3476491_-	hypothetical protein	NA	A0A2I7RGU7	Vibrio_phage	41.6	2.0e-13
WP_025383369.1|3476527_3476710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383370.1|3476728_3476932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383372.1|3477652_3478600_-	hypothetical protein	NA	A9YX09	Burkholderia_phage	40.7	1.5e-59
WP_025383373.1|3478760_3479438_-	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	55.2	5.5e-61
WP_025383374.1|3479536_3479764_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	53.3	1.3e-11
WP_025383375.1|3479873_3480167_+	hypothetical protein	NA	A2SY75	Escherichia_phage	61.9	8.9e-24
WP_025383376.1|3480175_3480712_+	hypothetical protein	NA	A0A291AXH9	Shigella_phage	53.6	5.9e-50
WP_025383377.1|3480800_3481397_+	hypothetical protein	NA	R9VWB9	Serratia_phage	51.3	4.1e-52
WP_025383378.1|3481393_3482230_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	61.9	3.2e-34
WP_081761335.1|3482232_3483081_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	59.6	2.5e-82
WP_144236082.1|3483077_3483359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383381.1|3483536_3483989_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_025383382.1|3483985_3484336_+	hypothetical protein	NA	A0A077KB17	Edwardsiella_phage	34.0	1.7e-13
WP_025383383.1|3484335_3484797_+	recombination protein NinB	NA	I6R9D0	Salmonella_phage	56.0	2.1e-43
WP_025383384.1|3484870_3485476_+	recombination protein NinG	NA	K7PHP1	Enterobacterial_phage	57.9	3.2e-52
WP_025383385.1|3485472_3485961_+	antiterminator	NA	M1FPN0	Enterobacteria_phage	67.3	2.4e-58
WP_012303803.1|3486223_3486655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383386.1|3486859_3487192_+|holin	phage holin, lambda family	holin	Q2A0C6	Sodalis_phage	41.0	4.1e-17
WP_174407871.1|3487178_3487583_+	M15 family metallopeptidase	NA	D5JFH4	Klebsiella_phage	62.9	6.9e-35
WP_025383389.1|3487785_3488175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167330752.1|3488534_3489152_+|terminase	terminase small subunit	terminase	A0A2R3UAN5	Myoviridae_environmental_samples	49.5	1.8e-42
WP_025383392.1|3489475_3489652_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PGU2	Moraxella_phage	49.1	3.8e-06
WP_025383393.1|3489702_3490110_+	type II toxin-antitoxin system HicB family antitoxin	NA	F1C593	Cronobacter_phage	67.7	5.2e-46
WP_025383394.1|3490165_3491770_+	bacteriophage TerL protein	NA	A0A0M5M1R6	Salmonella_phage	73.1	2.3e-238
WP_038402629.1|3492022_3493555_+	DUF1073 domain-containing protein	NA	Q6IWU2	Burkholderia_phage	47.6	2.6e-114
WP_038402194.1|3493511_3494393_+|head	head morphogenesis protein SPP1	head	Q6IWU3	Burkholderia_phage	41.0	5.0e-54
WP_025383395.1|3494385_3495534_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	42.3	3.2e-53
WP_025383396.1|3495533_3496025_+	hypothetical protein	NA	A1Z022	Burkholderia_virus	30.0	5.0e-11
WP_025383397.1|3496038_3497172_+	DUF2184 domain-containing protein	NA	I6ZXX2	Escherichia_phage	48.4	6.6e-91
WP_144236084.1|3497200_3497599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048677239.1|3497608_3498040_+	DUF4054 domain-containing protein	NA	B7VFH0	Pseudomonas_phage	41.9	8.2e-26
WP_025383400.1|3498039_3498537_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	36.0	3.2e-13
WP_025383401.1|3498536_3498920_+	hypothetical protein	NA	Q6IWV0	Burkholderia_phage	39.8	3.4e-15
WP_025383402.1|3498909_3499449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383403.1|3499461_3500976_+	DUF3383 domain-containing protein	NA	I7B2P4	Escherichia_phage	41.5	1.2e-95
WP_012303821.1|3500987_3501428_+	hypothetical protein	NA	A0A0F6SJB3	Pseudomonas_phage	50.0	2.0e-35
WP_081761337.1|3501427_3501883_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	53.2	2.1e-32
WP_025383405.1|3501968_3503543_+	hypothetical protein	NA	Q4L1H3	Burkholderia_phage	27.8	4.3e-32
WP_025383406.1|3503542_3504052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383407.1|3504053_3504356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383408.1|3504359_3505199_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	41.2	9.9e-52
WP_025383409.1|3505180_3505858_+	hypothetical protein	NA	Q6IWQ1	Burkholderia_phage	44.5	4.9e-41
WP_025383410.1|3505854_3506214_+	hypothetical protein	NA	Q6IWQ2	Burkholderia_phage	47.8	1.9e-20
WP_025383411.1|3506197_3507397_+|plate	baseplate J/gp47 family protein	plate	Q6IWQ3	Burkholderia_phage	46.3	1.0e-81
WP_012105508.1|3507449_3508277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383412.1|3508336_3510148_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	36.8	1.5e-33
WP_012303831.1|3510151_3510373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383413.1|3510365_3512147_+	Ig-like domain-containing protein	NA	H9C1B7	Pectobacterium_phage	59.3	4.2e-193
3512366:3512389	attR	ATTTTTCACGTCCTTTAGCAAGAA	NA	NA	NA	NA
>prophage 8
NZ_CP007230	Yersinia similis strain Y_sim_228 chromosome, complete genome	4903722	3761681	3808085	4903722	plate,integrase,capsid,terminase,transposase,holin,tail	Shigella_phage(11.63%)	60	3759839:3759855	3813021:3813037
3759839:3759855	attL	GGAATTAGCCAAGATCC	NA	NA	NA	NA
WP_025383611.1|3761681_3762704_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	69.9	2.7e-136
WP_025383613.1|3763926_3764220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383614.1|3764430_3764784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383615.1|3764776_3765040_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_025383616.1|3765023_3765890_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	37.4	3.8e-22
WP_025383617.1|3766236_3766473_-	hypothetical protein	NA	A0A248SL48	Klebsiella_phage	66.2	5.0e-17
WP_144236087.1|3766504_3766852_-	hypothetical protein	NA	A0A248SKX5	Klebsiella_phage	33.7	3.1e-07
WP_038402654.1|3766823_3767015_-	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	75.4	8.1e-18
WP_038402215.1|3767679_3768306_-	phage-like protein	NA	R9VWB9	Serratia_phage	38.9	2.0e-33
WP_025383621.1|3768308_3768737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383622.1|3768733_3769873_-	hypothetical protein	NA	M4MHC3	Vibrio_phage	26.1	2.2e-30
WP_158499219.1|3769917_3771033_-	hypothetical protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	48.5	3.0e-56
WP_048677291.1|3770993_3771314_-	hypothetical protein	NA	A0A1Y0T0V1	Pseudomonas_phage	61.0	9.4e-19
WP_144236123.1|3771300_3772104_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.4	1.3e-69
WP_144236088.1|3772369_3772771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383625.1|3772786_3773254_-	hypothetical protein	NA	G0YQE7	Erwinia_phage	61.5	1.7e-45
WP_025383627.1|3773625_3773895_-	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	43.4	1.4e-12
WP_011192248.1|3773979_3774225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383628.1|3774502_3775057_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011192250.1|3775067_3775754_-	LexA family transcriptional regulator	NA	Q8W648	Enterobacteria_phage	52.0	8.1e-60
WP_025383629.1|3775878_3776124_+	hypothetical protein	NA	Q8W647	Enterobacteria_phage	64.4	1.1e-16
WP_011192252.1|3776141_3776504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383630.1|3776500_3776680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383631.1|3776688_3777534_+	hypothetical protein	NA	H2DE83	Erwinia_phage	45.3	1.6e-41
WP_011192254.1|3777537_3778314_+	hypothetical protein	NA	H2DE84	Erwinia_phage	51.5	7.3e-49
WP_025383632.1|3778317_3779454_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.0	4.1e-93
WP_011192256.1|3779453_3779801_+	hypothetical protein	NA	A0A1I9KG94	Aeromonas_phage	43.4	3.8e-05
WP_011192257.1|3779797_3780724_+	site-specific DNA-methyltransferase	NA	A0A059VK11	Pseudomonas_phage	52.8	1.7e-108
WP_011192258.1|3780720_3781596_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	52.2	2.4e-85
WP_071825502.1|3781635_3783327_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	61.6	1.2e-232
WP_011192260.1|3783323_3783971_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	31.2	1.3e-14
WP_038402219.1|3783972_3784293_+	DUF1364 domain-containing protein	NA	A0A2K8HR56	Pseudomonas_phage	43.8	1.4e-14
WP_011192261.1|3784364_3785300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383635.1|3785296_3785743_+	VRR-NUC domain-containing protein	NA	M4SRS1	Psychrobacter_phage	31.0	3.8e-10
WP_025383636.1|3785757_3786603_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_025383637.1|3786692_3787502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011192264.1|3787674_3787887_+|holin	class II holin family protein	holin	H9C183	Pectobacterium_phage	72.9	1.1e-23
WP_025383638.1|3787892_3788375_+	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	57.6	1.2e-49
WP_025383639.1|3788506_3789025_+	hypothetical protein	NA	H9C185	Pectobacterium_phage	42.8	6.8e-19
WP_025383640.1|3789028_3789217_+	hypothetical protein	NA	A0A2I7RNR1	Vibrio_phage	79.3	7.9e-18
WP_025383641.1|3789242_3789683_+	DUF2829 domain-containing protein	NA	A0A2I7R7I1	Vibrio_phage	62.5	1.7e-26
WP_011192268.1|3789748_3790606_+	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	39.1	6.0e-44
WP_025383644.1|3790644_3792309_+|terminase	terminase	terminase	B0FEF1	Escherichia_phage	70.5	9.3e-235
WP_011192270.1|3792308_3794429_+	hypothetical protein	NA	A0A088CE71	Shigella_phage	65.6	1.2e-258
WP_025383645.1|3794698_3795748_+	hypothetical protein	NA	A0A0H4J3F0	Shigella_phage	40.8	9.8e-57
WP_011192272.1|3795807_3797031_+|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	73.6	2.2e-172
WP_025383646.1|3797108_3797492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383647.1|3797557_3798010_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	52.8	1.4e-31
WP_011192275.1|3798012_3798609_+	hypothetical protein	NA	A0A088CE76	Shigella_phage	38.9	7.6e-30
WP_011192276.1|3798608_3799262_+	hypothetical protein	NA	Q08J85	Stx2-converting_phage	59.5	1.2e-68
WP_025383648.1|3799258_3801376_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	I7K3G3	Yersinia_phage	38.4	1.8e-49
WP_144236089.1|3801384_3801846_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	38.0	1.6e-06
WP_011192279.1|3801858_3802185_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_011192280.1|3802178_3802643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025383651.1|3803868_3804225_-	GPW/gp25 family protein	NA	A0A218M4K8	Erwinia_phage	59.5	5.3e-31
WP_025383652.1|3804221_3804857_-|plate	phage baseplate assembly protein V	plate	O80314	Escherichia_phage	62.0	1.7e-64
WP_019083256.1|3805438_3805747_+|transposase	transposase	transposase	Q716C1	Shigella_phage	45.0	3.4e-18
WP_144236091.1|3806586_3806811_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_012413674.1|3806821_3807487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025383657.1|3807680_3808085_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	50.7	2.1e-31
3813021:3813037	attR	GGAATTAGCCAAGATCC	NA	NA	NA	NA
>prophage 9
NZ_CP007230	Yersinia similis strain Y_sim_228 chromosome, complete genome	4903722	4336916	4472846	4903722	plate,coat,transposase,protease,tRNA,tail	Escherichia_phage(29.27%)	117	NA	NA
WP_025384059.1|4336916_4339304_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_025384060.1|4339317_4340301_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	4.5e-35
WP_155408922.1|4340656_4340704_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_002211833.1|4340798_4341155_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002211834.1|4341192_4341390_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071825515.1|4341486_4342038_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	2.0e-16
WP_025384062.1|4342041_4343970_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.6e-127
WP_002216696.1|4344365_4344578_+	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	42.0	9.9e-09
WP_025384063.1|4345338_4345590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025384064.1|4345906_4346590_+	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_025384065.1|4346711_4347374_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	39.7	9.4e-05
WP_025384066.1|4347585_4348554_+	iron/manganese ABC transporter substrate-binding protein YfeA	NA	NA	NA	NA	NA
WP_025384067.1|4348550_4349441_+	iron/manganese ABC transporter ATP-binding protein YfeB	NA	A0A1V0SKJ1	Klosneuvirus	27.5	2.9e-09
WP_025384068.1|4349440_4350325_+	iron/manganese ABC transporter permease subunit YfeC	NA	NA	NA	NA	NA
WP_025384069.1|4350321_4351215_+	iron/manganese ABC transporter permease subunit YfeD	NA	NA	NA	NA	NA
WP_144236056.1|4351593_4352704_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	29.7	9.9e-07
WP_025384070.1|4352725_4353595_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_025384071.1|4353724_4354279_-	YniB family protein	NA	NA	NA	NA	NA
WP_025384072.1|4354727_4356260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081761348.1|4356992_4357469_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	53.0	6.5e-40
WP_158499221.1|4357434_4357737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025384074.1|4357763_4358081_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_025384075.1|4358137_4358335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025384076.1|4358552_4359218_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_012105016.1|4359373_4359706_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_025384077.1|4360044_4360881_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_025384078.1|4360971_4361733_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.3	1.1e-20
WP_025384079.1|4362054_4363722_+	pectate lyase	NA	NA	NA	NA	NA
WP_025384080.1|4363759_4364650_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_025384081.1|4364642_4365563_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_025384082.1|4365576_4366704_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	26.5	1.6e-12
WP_025384083.1|4366718_4368011_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025384084.1|4368309_4369017_+	porin	NA	NA	NA	NA	NA
WP_025384085.1|4369469_4370018_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.3	5.2e-09
WP_025384086.1|4370221_4371613_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_025384087.1|4371932_4372784_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	29.8	3.5e-12
WP_002210840.1|4373124_4373916_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_011192552.1|4374102_4375269_-	oligogalacturonate lyase	NA	NA	NA	NA	NA
WP_025384088.1|4375635_4377003_+	MFS transporter	NA	NA	NA	NA	NA
WP_025384089.1|4377055_4377859_-	molecular chaperone	NA	NA	NA	NA	NA
WP_025384090.1|4377855_4379019_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_025384091.1|4379015_4381613_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025384092.1|4381693_4382491_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_025384093.1|4382592_4383135_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_025384094.1|4383810_4384692_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_025384095.1|4385350_4387423_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	35.0	4.0e-86
WP_002210849.1|4387442_4388156_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_025384096.1|4388251_4388749_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_038402273.1|4388992_4390240_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_025384098.1|4390208_4392839_+	PqiB family protein	NA	NA	NA	NA	NA
WP_025384099.1|4393318_4393876_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_025384100.1|4393881_4394412_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_025384101.1|4394432_4394990_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_025384102.1|4395021_4395765_+	molecular chaperone	NA	NA	NA	NA	NA
WP_025384103.1|4395836_4398302_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025384104.1|4398471_4399461_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025384105.1|4399635_4399875_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_025384106.1|4399985_4400375_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_025384107.1|4401196_4401430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025384108.1|4401583_4402840_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_025384109.1|4402918_4403476_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025384110.1|4403651_4403900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174407873.1|4404124_4404265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025384111.1|4404408_4404603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025384112.1|4405008_4406238_+	alanine racemase	NA	NA	NA	NA	NA
WP_025384113.1|4406435_4406795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025384114.1|4406947_4407331_-	DUF4354 family protein	NA	NA	NA	NA	NA
WP_025384115.1|4407680_4408634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025384116.1|4408732_4411369_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_038402275.1|4412153_4414796_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_025384118.1|4415268_4416033_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	27.2	5.0e-10
WP_025384119.1|4416932_4417577_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_025384120.1|4417586_4417976_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.3	2.2e-06
WP_025384121.1|4418076_4419126_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.0	6.1e-06
WP_025384122.1|4419125_4419998_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_025384123.1|4420205_4421816_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.2	4.2e-14
WP_025384124.1|4421999_4423673_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	1.2e-11
WP_144236126.1|4423913_4424576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011192570.1|4425413_4425911_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_038402276.1|4426073_4428224_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_038402278.1|4428240_4429326_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_025384127.1|4429322_4430210_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_025384128.1|4430413_4430995_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_011192574.1|4430998_4431349_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_025384129.1|4432891_4435591_-	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.4	2.9e-44
WP_025384130.1|4436118_4436823_-	MgtC family protein	NA	G3MA03	Bacillus_virus	39.8	1.4e-14
WP_025384131.1|4437861_4439601_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.7	7.9e-11
WP_002210892.1|4439783_4439975_-	protein DsrB	NA	NA	NA	NA	NA
WP_002210893.1|4440205_4440418_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_025384132.1|4440958_4444123_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	62.4	0.0e+00
WP_025384133.1|4444510_4445521_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_025384134.1|4445852_4446386_+	YlaC family protein	NA	NA	NA	NA	NA
WP_025384135.1|4446823_4447273_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_025384136.1|4447364_4448264_+	Kdo hydroxylase family protein	NA	NA	NA	NA	NA
WP_002210902.1|4448565_4448769_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	44.6	9.8e-06
WP_025384137.1|4449188_4450514_-	AppA family phytase/histidine-type acid phosphatase	NA	NA	NA	NA	NA
WP_025384138.1|4451206_4452481_-	bifunctional O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	A0A0B5JD48	Pandoravirus	30.2	5.2e-20
WP_025384139.1|4453418_4454999_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	51.4	6.5e-36
WP_002210908.1|4455117_4455378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025384140.1|4455789_4456833_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_025384142.1|4457873_4458065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158499223.1|4458061_4458214_+	ORF6N domain-containing protein	NA	G9L689	Escherichia_phage	78.7	5.6e-14
WP_025384143.1|4458274_4458583_+|transposase	transposase	transposase	Q716C1	Shigella_phage	43.0	2.9e-17
WP_081761350.1|4459623_4460253_-	DUF2441 domain-containing protein	NA	I6PCV9	Cronobacter_phage	28.2	5.8e-12
WP_025384145.1|4460439_4461000_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	63.4	4.6e-61
WP_025384146.1|4461007_4462462_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	51.9	2.4e-61
WP_025384147.1|4462724_4463714_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_025384148.1|4463824_4464403_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	54.5	9.6e-54
WP_025384149.1|4464402_4465740_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	59.1	4.0e-71
WP_025384150.1|4465736_4466363_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	84.2	7.1e-103
WP_071825519.1|4466346_4467573_-|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	80.4	4.1e-187
WP_025384152.1|4467631_4467979_-	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	90.3	1.2e-56
WP_025384153.1|4468223_4468937_-|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	81.0	6.6e-105
WP_025384154.1|4468946_4469951_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	74.0	7.8e-152
WP_025384155.1|4469950_4470217_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	71.6	1.8e-31
WP_025384156.1|4470213_4470876_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	88.6	1.2e-108
WP_025384157.1|4470881_4472846_-	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	72.7	1.0e-272
>prophage 10
NZ_CP007230	Yersinia similis strain Y_sim_228 chromosome, complete genome	4903722	4477114	4488363	4903722	integrase	Escherichia_phage(16.67%)	17	4479435:4479449	4487907:4487921
WP_025384163.1|4477114_4477570_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	66.9	1.5e-41
WP_025384164.1|4477569_4477863_-	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	69.2	3.7e-30
WP_025384165.1|4477859_4478459_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	54.3	6.6e-58
WP_025384166.1|4478544_4478751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025384167.1|4478762_4479002_-	DinI-like family protein	NA	A0A0M4REN2	Salmonella_phage	57.1	1.1e-16
WP_025384168.1|4479113_4479866_-	hypothetical protein	NA	A0A1B0VMD9	Pseudomonas_phage	44.1	3.9e-31
4479435:4479449	attL	CCAACATGGTGATTT	NA	NA	NA	NA
WP_025384169.1|4480795_4481053_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	43.2	1.5e-14
WP_025384170.1|4481156_4481579_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_025384171.1|4482806_4483064_-	type II toxin-antitoxin system ParD family antitoxin	NA	A0A0N7C055	Escherichia_phage	76.8	1.1e-25
WP_025384172.1|4483397_4483919_+	antA/AntB antirepressor family protein	NA	A0A0P0ZDY7	Stx2-converting_phage	75.6	2.6e-50
WP_156170211.1|4483941_4484118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167330755.1|4484114_4484285_+	hypothetical protein	NA	A0A2H4JCE0	uncultured_Caudovirales_phage	50.0	1.5e-07
WP_025384173.1|4484295_4484919_+	ERF family protein	NA	A0A1W6JP21	Morganella_phage	63.9	2.6e-65
WP_144236101.1|4484942_4485245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025384175.1|4485634_4485886_+	excisionase	NA	NA	NA	NA	NA
WP_025384176.1|4485860_4486991_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	54.1	2.3e-112
WP_025384177.1|4487109_4488363_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	88.9	8.8e-20
4487907:4487921	attR	AAATCACCATGTTGG	NA	NA	NA	NA
>prophage 11
NZ_CP007230	Yersinia similis strain Y_sim_228 chromosome, complete genome	4903722	4791906	4799285	4903722		Escherichia_phage(83.33%)	8	NA	NA
WP_025384405.1|4791906_4794330_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	55.4	2.2e-261
WP_025384406.1|4794341_4794959_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	68.3	6.3e-88
WP_025384407.1|4794960_4795737_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	39.8	1.1e-41
WP_025384408.1|4796096_4796693_+	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	49.2	3.2e-44
WP_038402310.1|4796689_4797259_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_025384409.1|4797856_4798288_+	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	48.2	1.8e-25
WP_144236130.1|4798577_4798652_+	membrane protein YpdK	NA	NA	NA	NA	NA
WP_025384410.1|4798760_4799285_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	48.1	3.2e-24
