The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP002885	Mycobacterium tuberculosis CCDC5180 chromosome, complete genome	4414346	2933966	2972239	4414346	capsid,terminase,tRNA,head,protease,integrase	Mycobacterium_phage(33.33%)	45	2962768:2962795	2972392:2972419
WP_003413486.1|2933966_2936045_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2936153_2936381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2936377_2937763_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2938107_2938608_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2938624_2939065_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003902320.1|2939160_2939889_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2939873_2940227_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2940239_2940665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2940661_2941336_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2941413_2942235_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2942370_2943264_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2943266_2944085_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2944099_2945281_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2945339_2945771_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2946284_2947526_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2947940_2948198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2948544_2949669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2949670_2950210_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2951686_2951968_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2952112_2952598_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2952624_2952879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899405.1|2955248_2955491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2955491_2956169_+	chloramphenicol phosphotransferase CPT family protein	NA	NA	NA	NA	NA
WP_003413654.1|2956364_2957021_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2957183_2957630_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2957804_2958137_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2958256_2958616_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2958717_2959176_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2959311_2959692_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2959688_2961185_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2961419_2961611_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2962768:2962795	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2962901_2963333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2963329_2964328_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2964341_2964806_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2964793_2965045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2965215_2966655_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2966662_2967196_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2967348_2967840_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
WP_003899414.1|2968006_2968330_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2968409_2968655_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2968651_2970079_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2970080_2970473_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2970469_2970730_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2970746_2971109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2971111_2972239_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2972392:2972419	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
