The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP002883	Mycobacterium tuberculosis BT1 chromosome, complete genome	4399405	2930782	2969054	4399405	head,tRNA,integrase,protease,terminase,capsid	Mycobacterium_phage(33.33%)	46	2959583:2959610	2969207:2969234
WP_003413486.1|2930782_2932861_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2932969_2933197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015575225.1|2933193_2934579_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2934923_2935424_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2935440_2935881_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003902320.1|2935976_2936705_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2936689_2937043_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2937055_2937481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2937477_2938152_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2938229_2939051_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2939186_2940080_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2940082_2940901_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2940915_2942097_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2942155_2942587_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2943100_2944342_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2944756_2945014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2945360_2946485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2946486_2947026_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2948502_2948784_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2948928_2949414_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2949440_2949695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2949698_2952035_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2952063_2952306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2952306_2952984_+	chloramphenicol phosphotransferase CPT family protein	NA	NA	NA	NA	NA
WP_003413654.1|2953179_2953836_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2953998_2954445_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2954619_2954952_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2955071_2955431_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2955532_2955991_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2956126_2956507_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2956503_2958000_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2958234_2958426_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2959583:2959610	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2959716_2960148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2960144_2961143_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2961156_2961621_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2961608_2961860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2962030_2963470_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2963477_2964011_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2964163_2964655_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
WP_003899414.1|2964821_2965145_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2965224_2965470_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2965466_2966894_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2966895_2967288_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2967284_2967545_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2967561_2967924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2967926_2969054_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2969207:2969234	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
