The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP002882	Mycobacterium tuberculosis BT2 chromosome, complete genome	4401899	2923385	2961657	4401899	tRNA,capsid,integrase,terminase,protease,head	Mycobacterium_phage(33.33%)	46	2952186:2952213	2961810:2961837
WP_003413486.1|2923385_2925464_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2925572_2925800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2925796_2927182_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2927526_2928027_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2928043_2928484_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003902320.1|2928579_2929308_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2929292_2929646_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2929658_2930084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025329636.1|2930080_2930755_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413589.1|2930832_2931654_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2931789_2932683_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2932685_2933504_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2933518_2934700_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2934758_2935190_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2935703_2936945_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2937359_2937617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2937963_2939088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2939089_2939629_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2941105_2941387_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2941531_2942017_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003908019.1|2942043_2942298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2942301_2944638_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2944666_2944909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2944909_2945587_+	chloramphenicol phosphotransferase CPT family protein	NA	NA	NA	NA	NA
WP_003413654.1|2945782_2946439_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2946601_2947048_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2947222_2947555_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2947674_2948034_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2948135_2948594_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2948729_2949110_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2949106_2950603_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2950837_2951029_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2952186:2952213	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2952319_2952751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2952747_2953746_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2953759_2954224_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2954211_2954463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2954633_2956073_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2956080_2956614_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2956766_2957258_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
WP_003899414.1|2957424_2957748_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2957827_2958073_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2958069_2959497_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2959498_2959891_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2959887_2960148_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2960164_2960527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2960529_2961657_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2961810:2961837	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
