The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP002871	Mycobacterium tuberculosis HKBS1 chromosome, complete genome	4407929	2933155	2971427	4407929	protease,capsid,integrase,terminase,head,tRNA	Mycobacterium_phage(33.33%)	46	2961956:2961983	2971580:2971607
WP_003413486.1|2933155_2935234_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2935342_2935570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009940032.1|2935566_2936952_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2937296_2937797_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2937813_2938254_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003902320.1|2938349_2939078_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2939062_2939416_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2939428_2939854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003901438.1|2939850_2940525_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2940602_2941424_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2941559_2942453_+	universal stress protein TB31.7	NA	NA	NA	NA	NA
WP_003413594.1|2942455_2943274_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2943288_2944470_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2944528_2944960_-	hypoxic response protein Hrp1	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2945473_2946715_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_085976157.1|2947129_2947387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003902322.1|2947733_2948858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2948859_2949399_+	archease	NA	NA	NA	NA	NA
WP_003413619.1|2950875_2951157_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2951301_2951787_-	non-heme di-iron catalase	NA	NA	NA	NA	NA
WP_003413635.1|2951864_2952062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025234878.1|2952071_2954408_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2954436_2954679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2954679_2955357_+	chloramphenicol phosphotransferase CPT family protein	NA	NA	NA	NA	NA
WP_003413654.1|2955552_2956209_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2956371_2956818_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2956992_2957325_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2957444_2957804_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2957905_2958364_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2958499_2958880_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2958876_2960373_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_003912823.1|2960607_2960799_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
2961956:2961983	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2962089_2962521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2962517_2963516_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2963529_2963994_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003908028.1|2963981_2964233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003901443.1|2964403_2965843_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2965850_2966384_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003900541.1|2966536_2967028_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	9.4e-18
WP_003899414.1|2967194_2967518_-	type II toxin-antitoxin system toxin	NA	NA	NA	NA	NA
WP_003899415.1|2967597_2967843_-	type II toxin-antitoxin system antitoxin	NA	NA	NA	NA	NA
WP_003899416.1|2967839_2969267_-	DUF3631 domain-containing protein	NA	NA	NA	NA	NA
WP_003899417.1|2969268_2969661_-	DUF2742 domain-containing protein	NA	NA	NA	NA	NA
WP_003899418.1|2969657_2969918_-	helix-turn-helix domain-containing protein	NA	A0A2P1CHK7	Mycobacterium_phage	64.6	3.0e-15
WP_003900543.1|2969934_2970297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003899420.1|2970299_2971427_-|integrase	site-specific integrase	integrase	A0A1X9SFC1	Mycobacterium_phage	40.4	1.5e-66
2971580:2971607	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
