The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004350	Corynebacterium casei LMG S-19264 chromosome, complete genome	3113488	31378	140939	3113488	transposase,protease	Salmonella_phage(15.79%)	110	NA	NA
WP_025386817.1|31378_32563_-|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_025386818.1|32733_33540_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_006822318.1|33623_34847_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_025386819.1|35022_35661_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_025386820.1|35663_37319_-	amidohydrolase	NA	NA	NA	NA	NA
WP_025386821.1|37319_38669_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025386822.1|38728_40216_-	APC family permease	NA	NA	NA	NA	NA
WP_025386823.1|40432_41023_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081748444.1|41081_41864_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_081748445.1|43299_43740_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038574285.1|43958_45029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025386826.1|45018_45624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006821241.1|45870_46890_+	formamidase	NA	NA	NA	NA	NA
WP_050808088.1|48017_48380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143341350.1|48743_49148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139017134.1|49244_49409_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025386828.1|49512_49917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822415.1|50067_50763_+	LppP/LprE family lipoprotein	NA	NA	NA	NA	NA
WP_025386829.1|50838_51393_+	hypothetical protein	NA	A0A222ZQH1	Mycobacterium_phage	61.0	7.7e-61
WP_006821236.1|52788_52956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159461462.1|53054_54452_+	DUF2029 domain-containing protein	NA	NA	NA	NA	NA
WP_169731168.1|54989_55142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025386831.1|55241_55739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051461173.1|56360_56960_-	DUF2461 domain-containing protein	NA	NA	NA	NA	NA
WP_006822438.1|56956_57304_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_025386832.1|57318_57678_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_006822436.1|57719_58154_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_025386833.1|58146_58482_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025386834.1|59019_59424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822433.1|59875_60211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822432.1|60215_60473_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006822449.1|60851_61790_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_139017138.1|61786_62845_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_006822451.1|63296_64247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822452.1|64638_65082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822453.1|65099_65438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822454.1|65449_65899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822455.1|66135_66792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822456.1|67007_67520_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_025386838.1|67768_68167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025386839.1|68465_69092_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	57.5	1.8e-29
WP_139017140.1|69551_70076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155894796.1|70558_70708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025386841.1|71114_73958_+	GcrY protein	NA	Q6NE04	Leptospira_phage	36.9	4.3e-163
WP_025386842.1|74011_74338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822403.1|74873_75401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822404.1|75407_75662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155894797.1|75790_75940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035094836.1|76178_76655_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	55.3	1.8e-29
WP_081466630.1|76991_77189_+	recombinase family protein	NA	NA	NA	NA	NA
WP_050808087.1|77237_77480_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	60.5	1.1e-16
WP_006822408.1|79459_79861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155894798.1|80027_80171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038574308.1|80227_81412_-|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_025386845.1|81607_82951_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.9	1.2e-30
WP_155894799.1|83049_84250_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.6	1.0e-25
WP_025386847.1|84663_84963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025386849.1|85753_87346_+	transporter	NA	NA	NA	NA	NA
WP_006821391.1|87441_88152_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	58.5	1.2e-77
WP_025386850.1|88128_88473_+|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	41.2	1.6e-16
WP_006821390.1|88758_90066_-	cytosine permease	NA	NA	NA	NA	NA
WP_006821389.1|90062_90521_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_025386851.1|90721_90925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025386852.1|91315_92551_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	40.8	7.5e-80
WP_155894799.1|92666_93868_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.6	1.0e-25
WP_006823921.1|94079_95012_+|transposase	IS3 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	55.2	6.0e-90
WP_006823920.1|95132_96392_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_025386854.1|97364_97685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006823919.1|98009_98960_+	aldo/keto reductase	NA	A0A1V0SDE7	Indivirus	23.9	1.2e-08
WP_003847112.1|98969_99584_-	YdhK family protein	NA	NA	NA	NA	NA
WP_025386856.1|99641_101756_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	30.9	5.6e-67
WP_006823917.1|101912_102527_+	CueP family metal-binding protein	NA	NA	NA	NA	NA
WP_025386857.1|102531_103596_-	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_006823915.1|103644_104091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006823914.1|104954_105764_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_025386858.1|105760_106429_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_025386859.1|106437_107484_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025386860.1|107483_108266_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025386861.1|108255_109002_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.8	1.5e-14
WP_006823909.1|109003_109675_-	thiaminase II	NA	NA	NA	NA	NA
WP_025386862.1|109671_110337_-	TenA family protein	NA	NA	NA	NA	NA
WP_155894800.1|110333_111182_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_025386864.1|111376_112507_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_006823905.1|112707_114393_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_035096048.1|114649_115162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025386865.1|116143_117178_+	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_006823901.1|117290_118430_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_006823900.1|118505_119516_+	pirin family protein	NA	NA	NA	NA	NA
WP_006823899.1|119653_120292_-	RloB domain-containing protein	NA	NA	NA	NA	NA
WP_006823898.1|120284_121637_-	ATP-binding protein	NA	V9QJ85	Oenococcus_phage	26.1	5.8e-09
WP_025386866.1|121844_122753_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_025386867.1|122752_123415_-	DUF3887 domain-containing protein	NA	NA	NA	NA	NA
WP_081748506.1|123471_124893_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_025386869.1|125245_125587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155894801.1|125596_125821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025386871.1|125899_126712_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.5	2.7e-14
WP_006823891.1|126708_127368_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_006823890.1|127364_128036_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025386872.1|128109_129033_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006823888.1|129029_129524_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006823887.1|129629_130046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006823886.1|129984_131802_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	22.5	3.3e-15
WP_051461174.1|131798_133403_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_006823884.1|133501_133705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025386875.1|134094_135087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006823882.1|135396_136371_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_025386876.1|136381_138688_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_025386877.1|138748_139438_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_025386878.1|139541_140078_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	42.1	1.2e-23
WP_006823878.1|140285_140939_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP004350	Corynebacterium casei LMG S-19264 chromosome, complete genome	3113488	218863	255672	3113488	transposase,protease	Bacillus_virus(25.0%)	29	NA	NA
WP_025386910.1|218863_219850_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_025386911.1|219846_220503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025386912.1|220529_222119_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_025386913.1|222302_224246_+	peptidase M13	NA	A0A1V0SHG2	Klosneuvirus	32.0	2.3e-67
WP_025386914.1|224283_225204_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_098072810.1|225461_226622_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006823800.1|226618_227401_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025386915.1|227393_228182_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	1.1e-28
WP_155894808.1|228381_229281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051461227.1|229280_230246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155894809.1|230328_231000_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_025386920.1|231146_232154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025386921.1|232165_233524_+	serine/threonine protein kinase	NA	M1PCM5	Moumouvirus	30.5	2.7e-14
WP_025386922.1|233706_234609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025386923.1|234726_235392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025386925.1|236424_237735_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	44.2	2.5e-86
WP_025386927.1|238595_239939_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.6	2.0e-30
WP_025386928.1|240110_241340_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_006823800.1|242406_243189_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025386915.1|243181_243970_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.0	1.1e-28
WP_155894808.1|244169_245069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051461227.1|245068_246034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155894809.1|246116_246788_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_025386920.1|246934_247942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025386921.1|247953_249312_+	serine/threonine protein kinase	NA	M1PCM5	Moumouvirus	30.5	2.7e-14
WP_025386922.1|249494_250397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025386923.1|250514_251180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025386925.1|252212_253523_+|transposase	ISL3 family transposase	transposase	A0A2H4PDF8	Mycobacterium_phage	44.2	2.5e-86
WP_025386928.1|254442_255672_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP004350	Corynebacterium casei LMG S-19264 chromosome, complete genome	3113488	790932	812573	3113488	transposase	Pseudomonas_phage(16.67%)	21	NA	NA
WP_155894813.1|790932_791766_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	25.4	4.1e-05
WP_081748459.1|791789_792074_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081748460.1|792118_792379_-	antitoxin	NA	NA	NA	NA	NA
WP_025387182.1|792892_793792_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_143341331.1|793813_795037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143341330.1|795074_795362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006821861.1|795452_796079_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	56.1	4.0e-29
WP_155894815.1|796406_796553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006821859.1|796712_797276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006821858.1|797265_798528_-	MFS transporter	NA	NA	NA	NA	NA
WP_155894816.1|798613_799603_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	37.2	5.7e-30
WP_155894799.1|799768_800969_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.6	1.0e-25
WP_143341329.1|801096_802017_+	MFS transporter	NA	NA	NA	NA	NA
WP_006822479.1|802019_802550_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025387187.1|802955_804299_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	26.2	5.3e-31
WP_006822478.1|804496_806155_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_025387188.1|806151_808074_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_139017141.1|808135_808516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006822476.1|808642_809431_+	Abi family protein	NA	NA	NA	NA	NA
WP_025387190.1|809715_810945_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_025387191.1|811337_812573_+|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	40.6	2.4e-78
>prophage 4
NZ_CP004350	Corynebacterium casei LMG S-19264 chromosome, complete genome	3113488	959650	1058126	3113488	transposase,integrase,tRNA	Pseudomonas_phage(10.53%)	70	959619:959678	1058099:1059353
959619:959678	attL	CTGGGGTGGTCTGGATTTTAGGTCCAGTTGATTTAAGCGACTTTGCTTAAAAACTGCTTC	NA	NA	NA	NA
WP_155894813.1|959650_960484_-|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	25.4	4.1e-05
WP_081466614.1|960507_960792_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_025387268.1|961180_962620_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_006822360.1|962825_963119_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_006822361.1|963268_963676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081466629.1|963665_963896_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_025387269.1|963901_964234_+	DUF2283 domain-containing protein	NA	NA	NA	NA	NA
WP_025387270.1|964643_965162_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006822364.1|965277_965850_+	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_006822365.1|966056_966479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822366.1|966569_967568_+	GTPase Era	NA	NA	NA	NA	NA
WP_139017127.1|967452_968283_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_006822368.1|968294_969047_+	isoprenyl transferase	NA	NA	NA	NA	NA
WP_025387272.1|969121_970243_+	VIT1/CCC1 transporter family protein	NA	NA	NA	NA	NA
WP_006822370.1|970316_970745_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_025387273.1|970880_972260_+|tRNA	glycine--tRNA ligase	tRNA	A0A2I2L3K8	Orpheovirus	30.7	2.7e-46
WP_006822372.1|972423_973821_+	ATPase	NA	NA	NA	NA	NA
WP_006822373.1|973813_974497_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_025387274.1|974595_975108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025387275.1|975119_975611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025387276.1|975640_977644_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_025387277.1|977803_979207_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_155894818.1|979236_979401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025387278.1|980141_981407_+	deoxyguanosinetriphosphate triphosphohydrolase	NA	NA	NA	NA	NA
WP_025387279.1|981466_981712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025387280.1|981701_982205_-	ribonuclease	NA	NA	NA	NA	NA
WP_025387281.1|982305_984225_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	33.5	4.6e-52
WP_025387282.1|984257_984527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025387283.1|985125_986331_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	1.2e-26
WP_025387284.1|986921_988223_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_038574439.1|988222_989755_+	glycosyltransferase	NA	A0A1V0SL50	Klosneuvirus	25.6	3.2e-32
WP_025387286.1|989882_990800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051461188.1|991095_992025_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025387288.1|992008_992893_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.7	3.5e-07
WP_025387289.1|992926_995092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025387290.1|995321_996665_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.6	1.2e-30
WP_006822409.1|996986_998216_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_155894819.1|998599_999403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025387292.1|1000150_1004593_+	glycosyltransferase	NA	A0A1V0SAE6	Catovirus	33.5	2.4e-35
WP_025387293.1|1004947_1005871_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	39.5	9.9e-45
WP_025387290.1|1006180_1007524_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.6	1.2e-30
WP_139017164.1|1007992_1009192_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.3	3.5e-34
WP_169731175.1|1009139_1009418_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	46.5	5.3e-10
WP_155894799.1|1009586_1010787_+|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	30.6	1.0e-25
WP_169731176.1|1010788_1011064_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081748511.1|1011409_1012387_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	37.2	1.7e-42
WP_025387297.1|1013142_1014582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025387299.1|1015290_1017471_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_025387300.1|1017984_1019223_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	40.1	4.8e-79
WP_025387301.1|1020584_1021814_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_025387302.1|1022034_1024275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025387303.1|1024721_1025975_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HFY9	Paramecium_bursaria_Chlorella_virus	24.9	2.7e-21
WP_025387304.1|1026374_1028018_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	48.1	1.9e-131
WP_025387305.1|1028120_1029662_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_025387306.1|1029661_1034314_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_025387307.1|1034424_1035861_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_155894820.1|1036437_1036992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025387309.1|1037229_1038075_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_025387310.1|1038067_1039570_-	AAA family ATPase	NA	K7PHD1	Enterobacteria_phage	35.4	1.2e-68
WP_051461189.1|1040171_1041293_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_038574448.1|1042437_1042623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025387312.1|1042738_1044181_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_025387313.1|1044234_1045392_-	ornithine cyclodeaminase	NA	NA	NA	NA	NA
WP_081748466.1|1046078_1046741_+	type I-E CRISPR-associated protein Cas6/Cse3/CasE	NA	NA	NA	NA	NA
WP_169731177.1|1046773_1048108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081748468.1|1048110_1049367_+	type I-U CRISPR-associated protein Cas5/Cas6	NA	NA	NA	NA	NA
WP_051461191.1|1049353_1052722_+	type I-U CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_025387320.1|1053689_1054370_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_081466614.1|1056984_1057269_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155894813.1|1057292_1058126_+|transposase	IS3 family transposase	transposase	A0A1B0Z042	Pseudomonas_phage	25.4	4.1e-05
1058099:1059353	attR	GAAGCAGTTTTTAAGCAAAGTCGCTTAAATCAACTGGACCTAAAATCCAGACCACCCCAGTATTCCTCCACAGTGTCATTGACATTGTCATCATTTTCCTCAAACACCATGTAGTGCAGCTGCTCAACCACGGCTGGTGCTTCAAGGCGCTCAACATCGCGCTCCATACGGGCTTCATCTTCCGCGCTCAGCACACCATCAGGATTATGAACCTCCGTGCTGAACGTATTGGTGATTTCCATGTCTGCGGTATCGGTAATCTCATAGTCCGCGCGCTGAGGAGTATCGATAGCGGCCCCGATGCCACCGACCAATGCGCCACCACCGATGGCACTAGCCAACAGCGAAACGCCCATCATCTTTCCGATGCTTGGACGTGCCTGCTTATTGACTTCCTTGAGCTCAGCCTCAGTCAGCGCCTGCTGCGCTTCAGCTTCTGGCTTCGTCTTGGCTACGTTCTTGGTGGGCTTCTTCTTCGCGCTCATGCACTCCACGGTAGTTCACACCAGGGTAATGCGGCCACAACAATTTCACAGTGGCGCAAGAATGAAACCGTGTGTTAGGGATCTCGTCGTCACTAGTTCTTTCATCTACCTAACGTTGGTGCGATGTTGTTTTGCAGTTTGTTTTAGCTTAACCCTGCCTCGATAACCTGCATCCGGCGCGGTCTCGAAGAGGACGCGTTCTTTGGTGAAACGACCGCTTCGCCAAAGGTATTGAGCAACTACATTGAGAAGAGAAAACCACATGACAACTAAATCGACTCGGCTGACAACAGCTTTAGTCGTAGCCGGTGCTGTGACCGTCAGCCACGTCGCCATGGTCGGGGTAGCCCATGGACAAGAAAACGTGCAGGCAGACCTGCTGGACATTGAAATCTCGGAATCGGGAGCAATTGATAATGCACGCGATGTGCCAGCTAAGGTCAGCGGCGATCCAAAATTTGCCGTCGACCCGACGCTCGAGGCACCCGTTGCCACCTTTGATGGCCAAGATGATGCAGTACAGTTCGATATCGGGGACCAGGATGAGGCACTGCCTGATGGCTTCGCCGTGGAATGTACTTTCAAACTCAACGGCGAATTCGCCAGTGAAAAGAGCCTGTGTGCCAACAAACAAGCCGGCGGATTTGCGCTAGCGCTCTATGAAAATGAGCTGTCTTTCATCATCAACGTTGGCTCCGGCTACCAGCAGGCACGCGTGGAAGTTGACCCTGACCGTTGGTACCACGCCGTCGGCGTATGGGACGGCAATG	NA	NA	NA	NA
>prophage 5
NZ_CP004350	Corynebacterium casei LMG S-19264 chromosome, complete genome	3113488	2389872	2405625	3113488	transposase,protease,tRNA	Catovirus(14.29%)	11	NA	NA
WP_025388001.1|2389872_2392599_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	39.6	1.0e-137
WP_025388002.1|2392629_2393640_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_006821941.1|2393968_2394709_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025388003.1|2394792_2396094_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.4	4.0e-132
WP_025388004.1|2396404_2397907_-	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.7	1.6e-63
WP_006821939.1|2398412_2399036_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A248SJ97	Salicola_phage	38.7	3.0e-29
WP_025388005.1|2399057_2399657_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.0	4.3e-41
WP_025388006.1|2399968_2401336_-	trigger factor	NA	NA	NA	NA	NA
WP_155894838.1|2402063_2402825_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_025388007.1|2402879_2404118_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.1	1.2e-80
WP_025386927.1|2404281_2405625_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.6	2.0e-30
>prophage 6
NZ_CP004350	Corynebacterium casei LMG S-19264 chromosome, complete genome	3113488	2448501	2488384	3113488	transposase,protease	uncultured_virus(14.29%)	34	NA	NA
WP_038574308.1|2448501_2449686_-|transposase	IS1249 family transposase	transposase	NA	NA	NA	NA
WP_025388028.1|2450846_2452190_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	35.6	2.0e-30
WP_025388029.1|2452237_2453344_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_006822094.1|2453600_2453918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025388030.1|2454031_2454877_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_081748494.1|2454873_2455551_-	HAD family phosphatase	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	31.4	1.3e-12
WP_025388032.1|2455547_2456636_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	2.7e-33
WP_025388033.1|2456601_2457528_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025388034.1|2457542_2457833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025388035.1|2457946_2459185_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	41.1	1.5e-80
WP_025388036.1|2459299_2460643_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	25.9	1.6e-30
WP_025387190.1|2461034_2462264_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_174401647.1|2462279_2462771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006822100.1|2462867_2464004_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_006822101.1|2464271_2465030_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025388038.1|2465080_2466361_-	glutaminase	NA	NA	NA	NA	NA
WP_006822103.1|2466522_2466798_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_006822104.1|2466881_2467352_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_006822105.1|2467399_2468071_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038574697.1|2468155_2468620_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_025388040.1|2468631_2477682_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_155894839.1|2477879_2478095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025388041.1|2478093_2478909_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_006822110.1|2479281_2480313_+	DNA cytosine methyltransferase	NA	A0A0F7L3T9	uncultured_marine_virus	33.1	4.7e-19
WP_025388042.1|2480313_2481246_+	NaeI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_025388043.1|2481382_2482471_-	SPFH domain-containing protein	NA	NA	NA	NA	NA
WP_025388044.1|2482672_2483362_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006822113.1|2483753_2484185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006822114.1|2484256_2484610_+	DUF3817 domain-containing protein	NA	NA	NA	NA	NA
WP_006822115.1|2484691_2485306_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	A0A0N9Z738	Cassava_brown_streak_virus	28.5	7.1e-07
WP_006822116.1|2485311_2486040_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_025388045.1|2486063_2486831_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_006822118.1|2486938_2487712_-	glutamate racemase	NA	NA	NA	NA	NA
WP_006822119.1|2487712_2488384_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP004350	Corynebacterium casei LMG S-19264 chromosome, complete genome	3113488	3096916	3107220	3113488		Bacillus_phage(33.33%)	8	NA	NA
WP_025388365.1|3096916_3098650_-	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.7	1.2e-11
WP_025388366.1|3098646_3100092_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	23.7	2.0e-07
WP_025388367.1|3100296_3100731_-	VOC family protein	NA	NA	NA	NA	NA
WP_025388368.1|3100872_3103437_+	aminopeptidase N	NA	A0A2K9L1R3	Tupanvirus	30.8	1.9e-45
WP_006822276.1|3103663_3104209_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_006822278.1|3104469_3105396_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	48.7	3.8e-68
WP_006822279.1|3105403_3105727_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	42.4	2.8e-18
WP_169731187.1|3106011_3107220_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A172JII6	Bacillus_phage	34.8	8.0e-10
