The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004360	Komagataeibacter xylinus E25 chromosome, complete genome	3447725	206444	248107	3447725	plate,transposase,terminase	Acidianus_two-tailed_virus(16.67%)	42	NA	NA
WP_038507813.1|206444_207281_+|transposase	IS5-like element IS1031A family transposase	transposase	NA	NA	NA	NA
WP_025437264.1|208211_208847_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_025437265.1|208856_209978_-	gluconolactonase	NA	NA	NA	NA	NA
WP_025437266.1|210070_210607_-	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_167331441.1|210700_210847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437267.1|210879_211218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010510628.1|211268_211478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038507838.1|211657_212488_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_025437269.1|212610_214635_-	ATP-binding protein	NA	A0A1C9EG55	Acidianus_two-tailed_virus	35.0	7.3e-08
WP_025437272.1|215869_216793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437273.1|216898_217729_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_025437274.1|217692_219093_+	sugar transporter	NA	NA	NA	NA	NA
WP_025437275.1|219041_221390_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025437276.1|221563_222268_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_025437277.1|222273_223002_+	response regulator	NA	W8CYM9	Bacillus_phage	31.9	6.9e-25
WP_025437278.1|223115_223619_-	peptide deformylase	NA	NA	NA	NA	NA
WP_025437279.1|223642_224239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437280.1|224534_226130_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_025437281.1|226372_227320_-	ribokinase	NA	NA	NA	NA	NA
WP_157699223.1|227318_227477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025437282.1|227518_228370_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_038507841.1|228549_231114_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_025437284.1|231299_231749_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_025437285.1|232218_232662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437286.1|232676_233675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437287.1|233933_234134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051459932.1|234137_234539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095666505.1|234889_235375_-	hypothetical protein	NA	A0A1B2ANT4	Pseudoalteromonas_phage	34.7	2.6e-12
WP_081749353.1|235377_235680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437291.1|235782_236256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157699224.1|236252_236402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437292.1|236398_236614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437293.1|236632_237589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437294.1|237595_238192_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	37.5	4.9e-29
WP_025437295.1|238191_239304_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	31.8	3.5e-28
WP_025437296.1|239275_239755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081749486.1|239751_240228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437299.1|240972_242025_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_081749354.1|242394_244011_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_025437302.1|244117_244897_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.4	2.7e-35
WP_025437303.1|244886_246410_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_025437305.1|247537_248107_-|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
>prophage 2
NZ_CP004360	Komagataeibacter xylinus E25 chromosome, complete genome	3447725	1009167	1138494	3447725	holin,transposase,integrase	Enterobacteria_phage(10.71%)	105	1073331:1073357	1148639:1148665
WP_025437938.1|1009167_1010667_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.2	9.5e-13
WP_025437939.1|1010666_1011395_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.5	4.9e-31
WP_025437940.1|1011502_1011775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437941.1|1011849_1012311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025437942.1|1012331_1013015_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	37.6	1.2e-10
WP_025437943.1|1013612_1014635_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_025437944.1|1014634_1014988_+	TrbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_025437945.1|1014987_1015263_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_025437946.1|1015276_1017721_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_025437947.1|1017717_1018488_+	P-type conjugative transfer protein TrbJ	NA	NA	NA	NA	NA
WP_025437948.1|1018491_1019898_+	P-type conjugative transfer protein TrbL	NA	NA	NA	NA	NA
WP_025437949.1|1019897_1020581_+	conjugal transfer protein TrbF	NA	NA	NA	NA	NA
WP_025437950.1|1020577_1021585_+	P-type conjugative transfer protein TrbG	NA	NA	NA	NA	NA
WP_038507962.1|1021581_1022817_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_025437952.1|1022809_1023067_+	DUF2274 domain-containing protein	NA	NA	NA	NA	NA
WP_081749500.1|1023147_1024038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025437955.1|1024939_1025704_+	damage-inducible protein	NA	NA	NA	NA	NA
WP_167331461.1|1025618_1027142_+	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_025437957.1|1027138_1030306_+	DNA polymerase III subunit alpha	NA	R4TPF1	Streptomyces_phage	27.1	1.0e-88
WP_025437958.1|1030674_1031274_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_025437959.1|1031434_1033525_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	31.7	7.3e-35
WP_025437960.1|1033616_1034117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025437961.1|1034106_1034469_+	hypothetical protein	NA	A0A1B1IUL8	uncultured_Mediterranean_phage	61.4	3.5e-30
WP_025437962.1|1034618_1035806_+	DUF932 domain-containing protein	NA	A0A1V0DX75	Synechococcus_virus	40.9	1.7e-73
WP_025437963.1|1035886_1036297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025437964.1|1036289_1036934_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	35.7	1.7e-27
WP_081749386.1|1036946_1037561_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_025437966.1|1037561_1038116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437967.1|1038382_1038658_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	43.8	3.3e-12
WP_025437968.1|1043164_1044226_+	DNA primase	NA	A0A2I7R8M6	Vibrio_phage	29.5	1.9e-07
WP_025437302.1|1045023_1045803_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	38.4	2.7e-35
WP_025437303.1|1045792_1047316_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_157699237.1|1047439_1047661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025437971.1|1049153_1050035_-	dihydropteroate synthase	NA	S4VNV0	Pandoravirus	32.3	3.3e-21
WP_025437972.1|1050060_1051023_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_095666486.1|1051384_1052555_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.0	3.3e-37
WP_025437975.1|1053136_1056310_-	error-prone DNA polymerase	NA	R4TPF1	Streptomyces_phage	27.5	8.9e-93
WP_167331462.1|1056306_1057830_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_025437977.1|1057744_1058509_-	damage-inducible protein	NA	NA	NA	NA	NA
WP_025437978.1|1058794_1059556_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_025437979.1|1059555_1060203_+	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	45.0	4.1e-37
WP_025437980.1|1060328_1062074_+	oleate hydratase	NA	NA	NA	NA	NA
WP_095666487.1|1062296_1063050_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.5	3.9e-23
WP_025437982.1|1063446_1064226_+	DUF5131 family protein	NA	A0A2P1A0W3	Gordonia_phage	42.6	2.4e-52
WP_081749387.1|1064341_1064968_+	three-Cys-motif partner protein TcmP	NA	NA	NA	NA	NA
WP_095666488.1|1065021_1066162_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.2e-87
WP_081749388.1|1066254_1067724_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	28.4	3.0e-19
WP_038507967.1|1068071_1068317_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_025437987.1|1068317_1068623_+	CcdB family protein	NA	NA	NA	NA	NA
WP_147318810.1|1068898_1069138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147318809.1|1069130_1069574_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025437990.1|1069790_1072391_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_081749390.1|1072391_1073330_-	site-specific DNA-methyltransferase	NA	A0A0K1LNZ9	Escherichia_phage	60.0	8.9e-25
1073331:1073357	attL	TGAATAGCCCCTAGTTTTCTAGACGCC	NA	NA	NA	NA
WP_095666488.1|1073348_1074490_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	61.1	1.2e-87
WP_025437992.1|1074557_1074956_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	60.2	4.6e-39
WP_025437993.1|1075496_1076150_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_025437994.1|1076137_1079014_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_025437995.1|1079010_1080381_+	polysulfide reductase NrfD	NA	NA	NA	NA	NA
WP_025437996.1|1080377_1080866_+	DUF3341 domain-containing protein	NA	NA	NA	NA	NA
WP_025437997.1|1080862_1081366_+	cytochrome c	NA	NA	NA	NA	NA
WP_025437998.1|1081362_1082412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025437999.1|1082473_1082782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025438000.1|1082778_1083588_+	SCO family protein	NA	NA	NA	NA	NA
WP_025438001.1|1083584_1084583_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_051459947.1|1084614_1086237_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_025438003.1|1086229_1086862_+	cytochrome c oxidase subunit III	NA	NA	NA	NA	NA
WP_025438004.1|1086858_1087176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025438005.1|1087288_1090453_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	3.4e-60
WP_025438006.1|1090445_1091618_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_025438007.1|1091607_1093026_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_095666489.1|1093210_1094160_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	26.0	3.4e-16
WP_095666490.1|1094251_1095200_-|transposase	IS630 family transposase	transposase	A0A1V0SCG6	Indivirus	26.2	1.9e-11
WP_025438012.1|1095654_1096410_+	anti-sigma factor	NA	NA	NA	NA	NA
WP_025437151.1|1096505_1097285_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.6	1.3e-34
WP_025437150.1|1097274_1098798_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_025438013.1|1099060_1100035_+	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_025438014.1|1100031_1101138_+	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_025438015.1|1101137_1101701_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025438016.1|1101697_1101883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025437150.1|1101972_1103496_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_025437151.1|1103485_1104265_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	37.6	1.3e-34
WP_025438017.1|1104525_1104933_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_025438018.1|1104949_1106593_-|holin	choline dehydrogenase	holin	A0A1V0S9J5	Catovirus	30.6	1.5e-59
WP_025438019.1|1106730_1107597_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_157699238.1|1108748_1109636_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051459888.1|1109645_1111127_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_117126013.1|1111548_1112619_+	MFS transporter	NA	NA	NA	NA	NA
WP_081749502.1|1112741_1115009_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_157699239.1|1115064_1115211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051459889.1|1115522_1116743_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_038507972.1|1116795_1117014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025438025.1|1118760_1120353_-	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_025438026.1|1120419_1120863_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_038508687.1|1120921_1122181_-	MFS transporter	NA	NA	NA	NA	NA
WP_025438028.1|1123186_1123942_-	Asp/Glu racemase	NA	NA	NA	NA	NA
WP_038507974.1|1123941_1124604_-	isochorismatase family protein	NA	NA	NA	NA	NA
WP_025438030.1|1124656_1125688_-	2,5-dihydroxypyridine 5,6-dioxygenase	NA	NA	NA	NA	NA
WP_025438031.1|1125785_1126913_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_038507976.1|1127505_1129860_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_157699240.1|1130137_1130335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085948209.1|1130407_1131464_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081749503.1|1133574_1134192_+	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_025438035.1|1134262_1134844_+	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_081749393.1|1136787_1137729_+	Plug domain-containing protein	NA	NA	NA	NA	NA
WP_038507806.1|1137657_1138494_-|transposase	IS5-like element IS1031A family transposase	transposase	NA	NA	NA	NA
1148639:1148665	attR	GGCGTCTAGAAAACTAGGGGCTATTCA	NA	NA	NA	NA
>prophage 3
NZ_CP004360	Komagataeibacter xylinus E25 chromosome, complete genome	3447725	2918893	2957419	3447725	transposase,integrase	uncultured_Mediterranean_phage(16.67%)	32	2912300:2912323	2942801:2942824
2912300:2912323	attL	TTTTTTCAAAAAGGCGGCGTTCTT	NA	NA	NA	NA
WP_025439495.1|2918893_2919121_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_167331473.1|2919528_2919705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025439496.1|2919928_2921389_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	31.4	3.5e-36
WP_025439497.1|2921385_2922516_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_025439498.1|2922611_2923070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025439499.1|2923066_2924800_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	31.4	6.9e-15
WP_038508290.1|2924923_2927161_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_025439501.1|2927314_2928445_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_025439502.1|2928676_2929870_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_025439503.1|2929860_2930586_-	CbtA family protein	NA	NA	NA	NA	NA
WP_025439504.1|2930967_2931582_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_038508931.1|2931617_2932700_-	transglycosylase SLT domain-containing protein	NA	A0A0S2SXN2	Bacillus_phage	35.6	3.0e-08
WP_025439506.1|2933005_2933842_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.4	6.9e-53
WP_081749454.1|2933999_2935082_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_025439508.1|2935162_2936461_+	adenosylhomocysteinase	NA	S4W1G4	Pandoravirus	33.8	2.8e-53
WP_025439509.1|2936538_2936934_+	DUF3597 domain-containing protein	NA	NA	NA	NA	NA
WP_025439510.1|2937053_2938115_+	magnesium transporter	NA	NA	NA	NA	NA
WP_025439511.1|2938368_2939391_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	35.5	1.8e-50
WP_025439512.1|2940277_2941513_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_081749456.1|2941541_2942717_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_081749457.1|2944077_2944332_-	hypothetical protein	NA	NA	NA	NA	NA
2942801:2942824	attR	TTTTTTCAAAAAGGCGGCGTTCTT	NA	NA	NA	NA
WP_095666500.1|2944344_2945531_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051459924.1|2946313_2947513_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_147318807.1|2947644_2948790_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_157699272.1|2948859_2949162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051459926.1|2949139_2949673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038507806.1|2950164_2951001_+|transposase	IS5-like element IS1031A family transposase	transposase	NA	NA	NA	NA
WP_095666518.1|2951820_2951904_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_038508294.1|2952370_2953684_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_038507806.1|2953815_2954652_+|transposase	IS5-like element IS1031A family transposase	transposase	NA	NA	NA	NA
WP_157699273.1|2955811_2956945_+	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_081749459.1|2957122_2957419_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP004364	Komagataeibacter xylinus E25 plasmid pGX4, complete sequence	87176	6806	67886	87176	integrase,transposase	Acinetobacter_phage(30.77%)	58	4863:4877	40324:40338
4863:4877	attL	GCGGTGGCGACGGTC	NA	NA	NA	NA
WP_041250514.1|6806_7790_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010516180.1|7897_8527_+	AAA family ATPase	NA	A2I303	Vibrio_virus	57.6	1.4e-53
WP_070324352.1|8547_8769_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_081749530.1|8818_9847_+	replication protein RepA	NA	NA	NA	NA	NA
WP_035979553.1|10046_10826_-	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_010516174.1|10822_11407_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	46.7	4.5e-35
WP_157699281.1|15087_15720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025439948.1|16381_16651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025439949.1|16650_17058_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_025439950.1|17151_18246_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.8e-24
WP_025439951.1|18560_19229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007396299.1|19521_19914_-	PIN domain nuclease	NA	NA	NA	NA	NA
WP_010512461.1|19910_20105_-	type II toxin-antitoxin system VapB family antitoxin	NA	NA	NA	NA	NA
WP_025439952.1|20169_20592_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_025439953.1|20588_20840_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_041250516.1|20925_21189_-	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_010517487.1|21185_21608_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_025439955.1|21654_25026_-	Ti-type conjugative transfer relaxase TraA	NA	A0A1L2C8Z7	Pseudomonas_phage	27.4	5.0e-09
WP_081749532.1|25122_25452_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_025439956.1|25546_25813_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_025439957.1|25805_26309_+	transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	49.2	3.4e-23
WP_025439958.1|26611_26953_-	BrnA antitoxin family protein	NA	NA	NA	NA	NA
WP_081749534.1|26921_27218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_147318906.1|27357_27684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162838769.1|27682_27847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025439960.1|28213_29125_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_007396285.1|29357_29762_-	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_019092610.1|29745_29958_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_117126065.1|30831_31356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041247965.1|33603_34626_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_157699282.1|34903_35047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025439964.1|35090_35477_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_010518373.1|35473_35719_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_034931139.1|35739_36000_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	44.4	4.3e-06
WP_165165566.1|36072_36225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025439965.1|36254_36578_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_025439966.1|36574_36793_-	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_117125944.1|37028_37355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010518057.1|37447_37963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167331481.1|37868_38186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010518059.1|38248_38434_-	PilT protein	NA	NA	NA	NA	NA
WP_019087450.1|38430_38688_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_081749535.1|38785_39040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010518062.1|39116_39533_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	39.7	1.4e-19
WP_010518064.1|39543_39723_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	59.3	5.6e-13
WP_167331479.1|40499_41615_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
40324:40338	attR	GCGGTGGCGACGGTC	NA	NA	NA	NA
WP_025439943.1|41992_44968_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	40.0	5.2e-196
WP_010516174.1|45107_45692_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	46.7	4.5e-35
WP_035979553.1|45688_46468_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_038507813.1|57683_58520_-|transposase	IS5-like element IS1031A family transposase	transposase	A0A0M5M147	Mycobacterium_phage	27.6	1.3e-06
WP_147318802.1|58846_59326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025439973.1|59544_61560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146220231.1|61546_62170_+	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_025439974.1|62497_63415_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041250523.1|63506_64220_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_025439976.1|64216_65230_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_025439977.1|65231_66341_+	NADH:flavin oxidoreductase/NADH oxidase	NA	NA	NA	NA	NA
WP_089179083.1|66700_67886_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.1	1.6e-23
>prophage 1
NZ_CP004365	Komagataeibacter xylinus E25 plasmid pGX5, complete sequence	336138	3641	112129	336138	integrase,transposase	uncultured_Caudovirales_phage(13.89%)	97	2257:2271	26364:26378
2257:2271	attL	GCAGTGCCGTGGTCA	NA	NA	NA	NA
WP_038507806.1|3641_4478_-|transposase	IS5-like element IS1031A family transposase	transposase	A0A0M5M147	Mycobacterium_phage	27.6	1.3e-06
WP_081749536.1|4508_5108_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	57.3	3.5e-51
WP_014457492.1|5104_5428_-|transposase	transposase	transposase	B6ETC4	Enterobacteria_phage	51.4	5.4e-22
WP_051459975.1|5426_6662_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_006560376.1|7098_8010_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	27.4	5.2e-22
WP_025439991.1|8029_9220_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025439993.1|10007_11087_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_081749537.1|11193_11349_-	DUF1275 family protein	NA	NA	NA	NA	NA
WP_025439994.1|11348_12518_-	oxalate decarboxylase family bicupin	NA	NA	NA	NA	NA
WP_157699283.1|13353_13818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038507926.1|14103_15126_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.3	1.0e-21
WP_025439996.1|15836_16853_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_095666522.1|17185_18371_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.2	4.7e-23
WP_157699284.1|18602_19070_+	sorbitol dehydrogenase	NA	NA	NA	NA	NA
WP_063904971.1|19093_20737_+	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_081749541.1|20741_22169_+	cytochrome c	NA	NA	NA	NA	NA
WP_095666533.1|22220_22745_+	lipocalin-like domain-containing protein	NA	NA	NA	NA	NA
WP_095666523.1|23373_24089_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	46.3	6.3e-23
WP_025440002.1|24224_25724_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.2	5.6e-13
WP_025437939.1|25723_26452_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.5	4.9e-31
26364:26378	attR	TGACCACGGCACTGC	NA	NA	NA	NA
WP_167331483.1|26552_26693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025440003.1|27027_27474_+	hypothetical protein	NA	A0A142UM78	Mycobacterium_phage	42.1	5.2e-15
WP_025440004.1|27543_28182_-	hypothetical protein	NA	K4F6V6	Cronobacter_phage	37.6	1.3e-22
WP_025440005.1|28703_28958_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_025440006.1|28957_29386_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_110557936.1|29378_29624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081749543.1|29894_30293_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	40.0	9.9e-18
WP_095666484.1|30663_31850_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.4	3.1e-22
WP_025440008.1|32023_33796_-	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	24.1	3.8e-08
WP_025440009.1|33810_35058_-	MSMEG_0569 family flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010515873.1|35074_35362_-	MSMEG_0570 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_025440010.1|35349_36528_-	MSMEG_0565 family glycosyltransferase	NA	A0A1X9SJL4	Sulfolobus_islandicus_rod-shaped_virus	29.4	1.4e-06
WP_041250524.1|36524_37493_-	sll0787 family AIR synthase-like protein	NA	NA	NA	NA	NA
WP_025440012.1|37492_38056_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025440013.1|38052_39162_-	MSMEG_0568 family radical SAM protein	NA	NA	NA	NA	NA
WP_025440014.1|39158_40133_-	Nit6803 family nitriliase	NA	NA	NA	NA	NA
WP_025440015.1|40157_40640_-	MSMEG_0572 family nitrogen starvation response protein	NA	NA	NA	NA	NA
WP_025440016.1|40978_42382_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_025440017.1|42858_44358_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.2	5.6e-13
WP_025440018.1|44357_45086_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.5	4.9e-31
WP_039734209.1|45545_46019_+	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_003631394.1|46206_47016_+	alpha/beta hydrolase	NA	A0A2K9KZN8	Tupanvirus	29.0	3.0e-05
WP_039734207.1|47076_47361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081749545.1|48352_48667_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_025440022.1|50754_51969_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.8	4.5e-37
WP_025440024.1|53066_53558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095666524.1|53760_53955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053324230.1|54000_54390_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_061498341.1|54398_54653_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_025440025.1|55113_56484_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_025440026.1|56500_57625_-	alkene reductase	NA	NA	NA	NA	NA
WP_010510588.1|57740_58103_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025440027.1|58236_59292_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	55.5	2.3e-77
WP_025440028.1|59300_59999_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.3	7.7e-82
WP_025440029.1|60022_61318_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.3	1.1e-129
WP_010510570.1|61317_61740_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	4.0e-49
WP_025440030.1|61736_62090_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085948964.1|62609_63696_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.3	1.9e-42
WP_081749546.1|63679_63928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095666525.1|65232_66419_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.4	1.8e-22
WP_025440035.1|67245_67551_-	CcdB family protein	NA	NA	NA	NA	NA
WP_041250526.1|67551_67797_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_025440036.1|67938_69309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010517707.1|69665_70076_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_025440224.1|70076_70301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948209.1|72992_74049_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_025440037.1|74125_74896_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_041247965.1|75008_76031_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	32.7	5.9e-22
WP_025440038.1|76480_77488_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_157699285.1|77532_77727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025440040.1|77996_79280_+	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	30.6	1.8e-07
WP_025440041.1|79347_80670_+	ClC family H(+)/Cl(-) exchange transporter	NA	NA	NA	NA	NA
WP_025440042.1|80706_81969_-	sodium:proton antiporter	NA	A0A2H4J428	uncultured_Caudovirales_phage	32.6	3.9e-15
WP_041250527.1|82057_84640_-	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.3	4.7e-84
WP_025440044.1|84870_86148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025437299.1|87201_88254_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_081749354.1|88565_90182_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_025440045.1|90346_91126_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.8	4.0e-31
WP_025440046.1|91115_92639_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	29.9	2.9e-33
WP_025829448.1|93004_93280_+	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_025440047.1|93321_94431_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	A0A2L2DIY2	Acanthamoeba_polyphaga_mimivirus	24.2	1.6e-09
WP_003618982.1|94490_94892_+	VOC family protein	NA	NA	NA	NA	NA
WP_025440048.1|94916_95744_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_095666484.1|96255_97442_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	28.4	3.1e-22
WP_167331484.1|98589_99405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_095666527.1|99314_100019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025440051.1|100150_100957_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025440052.1|100953_101583_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	30.9	1.2e-12
WP_095666528.1|102828_103586_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	38.8	7.7e-11
WP_025440056.1|103743_104739_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_025440057.1|104858_105047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025440058.1|105267_106476_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_019092496.1|106478_106847_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_025440059.1|107169_108201_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_025440060.1|108624_109605_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.6	9.6e-14
WP_025440061.1|109818_110649_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_095666499.1|111157_112129_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP004365	Komagataeibacter xylinus E25 plasmid pGX5, complete sequence	336138	134218	179841	336138	transposase,holin	Escherichia_phage(23.08%)	36	NA	NA
WP_025440083.1|134218_135442_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	42.7	1.7e-39
WP_081749564.1|135330_136797_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.2	5.5e-13
WP_012222748.1|137641_137893_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_012222746.1|137902_138334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157699286.1|138688_139177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025440089.1|141177_142230_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_025440090.1|142577_143183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039736188.1|143188_144310_-	MFS transporter	NA	NA	NA	NA	NA
WP_041250554.1|144435_146838_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_025440093.1|146848_148381_-|holin	choline-sulfatase	holin	A0A2K9L727	Tupanvirus	25.2	2.0e-18
WP_025440094.1|148529_149429_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051459976.1|149504_150257_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	39.5	4.3e-30
WP_025440098.1|151996_152611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081749565.1|152900_153629_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041250530.1|153794_154955_+	MFS transporter	NA	NA	NA	NA	NA
WP_025440102.1|155057_155705_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_025440103.1|155808_156699_-	oxidoreductase	NA	NA	NA	NA	NA
WP_025440104.1|156748_157462_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.0	8.0e-18
WP_025440105.1|157458_157911_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_025440106.1|157942_158704_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_025440107.1|158854_159502_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025440108.1|159607_160816_+	MFS transporter	NA	NA	NA	NA	NA
WP_025440109.1|160918_161383_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_039732323.1|161432_162179_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	4.3e-06
WP_025440111.1|162330_163245_+	helix-turn-helix domain-containing protein	NA	A0A291LAM3	Bordetella_phage	28.3	1.8e-09
WP_041250531.1|163468_164188_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	28.0	6.2e-10
WP_025440113.1|164257_164656_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_167331486.1|164957_166157_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_025440115.1|166217_166496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039733983.1|167319_168306_+	AAA family ATPase	NA	A0A240F4U1	Ochrobactrum_phage	29.0	8.8e-15
WP_010517477.1|168305_169187_+	ParB/RepB/Spo0J family partition protein	NA	S5VTK0	Leptospira_phage	29.4	2.0e-10
WP_010511482.1|169277_170096_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_019087259.1|170162_170480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025440119.1|171295_176386_+	lactate dehydrogenase	NA	I6NW45	Burkholderia_virus	39.3	0.0e+00
WP_025437939.1|177613_178342_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	35.5	4.9e-31
WP_025437938.1|178341_179841_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	26.2	9.5e-13
>prophage 3
NZ_CP004365	Komagataeibacter xylinus E25 plasmid pGX5, complete sequence	336138	265320	320266	336138	transposase	uncultured_Caudovirales_phage(33.33%)	42	NA	NA
WP_095666530.1|265320_266074_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.5	1.0e-23
WP_025440175.1|266161_267457_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_039736416.1|267706_269305_-	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_025440177.1|269941_270640_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.5	3.4e-82
WP_025440178.1|270660_271956_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.5	3.0e-132
WP_025440179.1|271955_272378_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	65.0	4.1e-46
WP_025440180.1|272374_272728_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025440182.1|274026_274656_+	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	28.7	2.3e-08
WP_010509899.1|274652_275462_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_110531975.1|275558_276641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010509896.1|276684_277593_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010509894.1|277612_278497_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_095666531.1|278522_279633_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.3	1.3e-46
WP_155820074.1|281126_281519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010509887.1|282256_283675_+	phospholipase	NA	NA	NA	NA	NA
WP_025440186.1|285389_285719_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	43.0	1.4e-14
WP_010511780.1|285711_285975_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	45.0	5.5e-09
WP_048883911.1|286862_287270_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025440189.1|287266_288505_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_025440192.1|289361_290441_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_117126038.1|291337_292287_-|transposase	IS630 family transposase	transposase	A0A2P0VP61	Tetraselmis_virus	26.0	6.0e-13
WP_025440198.1|293206_294646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025440199.1|294795_296022_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.2	1.2e-40
WP_025440200.1|296202_296337_-	resolvase	NA	NA	NA	NA	NA
WP_081749557.1|296337_296577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025440202.1|296990_297590_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_041250541.1|297579_298824_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_025440204.1|298977_302145_-	error-prone DNA polymerase	NA	Q8W6C3	Saccharomonospora_phage	25.3	1.1e-82
WP_081749566.1|302141_303572_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_025440206.1|303579_304356_-	damage-inducible protein	NA	NA	NA	NA	NA
WP_025440207.1|304620_305271_+	SOS response-associated peptidase	NA	A0A291AUP1	Sinorhizobium_phage	43.0	8.8e-40
WP_025440208.1|305751_310662_+	DEAD/DEAH box helicase	NA	A0A2H4UTW8	Bodo_saltans_virus	23.6	5.1e-39
WP_081749558.1|310676_311516_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_081749559.1|311521_312196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025440210.1|312996_313455_+	class I SAM-dependent methyltransferase	NA	A0A2I7RQ20	Vibrio_phage	36.1	1.9e-12
WP_133251155.1|313530_314286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025440211.1|314533_315313_-	aromatic-ring-hydroxylating dioxygenase	NA	NA	NA	NA	NA
WP_041250561.1|315302_316442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051459978.1|317247_317439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081749560.1|317837_318107_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_025440213.1|318103_318379_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_025437224.1|318697_320266_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	45.2	1.9e-104
