The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP006942	Mannheimia sp. USDA-ARS-USMARC-1261 chromosome, complete genome	2393449	787983	879564	2393449	holin,transposase,portal,integrase,terminase,tail,head,tRNA,capsid,protease	Mannheimia_phage(32.08%)	99	836244:836290	875252:875298
WP_025235642.1|787983_788769_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_038643896.1|788821_790969_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	36.5	1.5e-107
WP_025235643.1|790968_791169_-	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	50.0	9.7e-06
WP_025235644.1|791243_791633_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_025235645.1|791730_793644_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.8e-91
WP_025235646.1|793714_794320_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_025235647.1|794389_794746_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_025235648.1|794742_795645_+	DMT family transporter	NA	NA	NA	NA	NA
WP_025235649.1|795659_796559_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_025235650.1|796730_798122_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_025235651.1|798170_799313_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	70.7	4.5e-164
WP_025235652.1|799490_802058_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	34.2	6.4e-126
WP_025235653.1|802323_802980_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_025235654.1|803172_805020_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_158497206.1|805275_805437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025235655.1|805467_810126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025235656.1|810240_811530_-	MFS transporter	NA	NA	NA	NA	NA
WP_051411624.1|811736_812060_-	RnfH family protein	NA	NA	NA	NA	NA
WP_025235658.1|812049_812484_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_025235659.1|812538_813594_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.5	2.6e-25
WP_025235660.1|813580_814273_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025235661.1|814272_815031_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025235662.1|815040_815802_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_025235663.1|815803_816712_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.4	3.3e-24
WP_025235664.1|816716_818756_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	37.5	2.8e-47
WP_025235665.1|818903_819443_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	40.5	1.9e-24
WP_025216984.1|819526_819877_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	54.7	9.6e-25
WP_025216985.1|819905_820571_-	BAX inhibitor protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	55.2	3.0e-51
WP_025216986.1|820768_821317_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_025235666.1|821392_823228_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_025235667.1|823471_824782_+	purine permease	NA	Q9KX94	Enterobacteria_phage	27.4	5.2e-23
WP_025235668.1|824911_825241_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	47.8	6.9e-17
WP_025235669.1|825451_826717_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_025235670.1|826719_827607_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_025235671.1|827780_829079_+	adenylosuccinate synthase	NA	A0A285PX35	Cedratvirus	36.4	3.9e-71
WP_081732093.1|829668_829950_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	43.0	3.8e-16
WP_144084216.1|830014_830167_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_025235672.1|830216_831542_-	GntP family permease	NA	NA	NA	NA	NA
WP_025235673.1|831653_832412_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_025235674.1|832441_833623_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_025235675.1|833710_834370_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_025235676.1|834386_835034_-	acetate CoA-transferase subunit alpha	NA	NA	NA	NA	NA
WP_025235677.1|835314_836214_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
836244:836290	attL	AATGGCACGCCCTAAAGGATTCGAACCTTTGACCCACGCCTTAGAAG	NA	NA	NA	NA
WP_025235678.1|836530_836872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025235679.1|836934_842604_-	DUF1983 domain-containing protein	NA	A0A0M3LQ61	Mannheimia_phage	39.0	2.8e-246
WP_025235680.1|842675_843188_-|tail	tail assembly protein	tail	A0A0M3LQC4	Mannheimia_phage	50.0	9.1e-32
WP_025235681.1|843205_843985_-	C40 family peptidase	NA	A0A0M3LP75	Mannheimia_phage	47.4	1.7e-61
WP_025235682.1|843986_844718_-|tail	phage minor tail protein L	tail	A0A0M3LPR8	Mannheimia_phage	53.3	3.2e-70
WP_025235683.1|844717_845053_-|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	32.1	6.6e-07
WP_025235684.1|845062_848488_-	tape measure protein	NA	A0A0E3GMH8	Enterobacteria_phage	25.9	8.2e-60
WP_038644105.1|848541_848736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081732094.1|848851_849112_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_025235687.1|849126_849543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006252746.1|849600_850257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038643902.1|850261_850606_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_025235689.1|850602_851085_-	HK97 gp10 family phage protein	NA	A4JX05	Burkholderia_virus	38.0	2.6e-12
WP_025235690.1|851077_851401_-|head	phage head closure protein	head	A0A1J0GUY4	Halomonas_phage	50.6	1.6e-18
WP_025235691.1|851401_851719_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_025235692.1|851762_852959_-|capsid	phage major capsid protein	capsid	A0A0R6PI48	Moraxella_phage	65.2	4.2e-136
WP_038643905.1|852960_853620_-|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PIE4	Moraxella_phage	61.1	2.4e-69
WP_025235694.1|853609_854848_-|portal	phage portal protein	portal	A0A0R6PKP4	Moraxella_phage	64.9	4.6e-146
WP_025235695.1|854844_856356_-|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	67.3	3.0e-192
WP_025235696.1|856355_856820_-	hypothetical protein	NA	Q77WA1	Escherichia_phage	42.4	3.7e-16
WP_025235697.1|856917_857241_-	HNH endonuclease	NA	B4UTZ8	Rhizobium_phage	57.9	4.3e-19
WP_025235698.1|857365_857650_-	hypothetical protein	NA	A0A0M3LNX0	Mannheimia_phage	45.1	7.1e-10
WP_158497207.1|857555_857834_-	DUF2570 family protein	NA	NA	NA	NA	NA
WP_025235699.1|858001_858601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025235700.1|858601_858955_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	35.5	8.0e-11
WP_025235701.1|859091_859598_-	antitermination protein	NA	NA	NA	NA	NA
WP_025235702.1|859590_859956_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M3LPZ2	Mannheimia_phage	86.0	2.1e-59
WP_025235703.1|859952_860231_-	DUF1364 domain-containing protein	NA	A0A0M3LQ97	Mannheimia_phage	75.5	3.1e-34
WP_158497208.1|860332_860473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025235704.1|860513_861146_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	28.6	1.1e-18
WP_025235705.1|861115_861628_-	adenine methyltransferase	NA	Q7Y5V8	Haemophilus_phage	74.8	2.4e-72
WP_025235706.1|861624_862272_-	bacteriophage replication protein	NA	A0A0M3LS65	Mannheimia_phage	81.9	5.4e-98
WP_025235707.1|862271_863045_-	hypothetical protein	NA	A0A0M3LS90	Mannheimia_phage	88.0	4.9e-53
WP_025235708.1|863041_863752_-	antirepressor	NA	A0A2D0YGX8	Vibrio_phage	37.2	3.9e-33
WP_025235709.1|863807_864026_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	63.9	5.2e-13
WP_081732129.1|864175_864847_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	32.3	5.6e-21
WP_025235711.1|864889_865756_-	hypothetical protein	NA	A0A0R6PHP9	Moraxella_phage	43.6	6.6e-59
WP_025235712.1|865767_866118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025235713.1|867127_868066_+	hypothetical protein	NA	A0A0M3LR66	Mannheimia_phage	73.1	4.9e-108
WP_025235714.1|868075_868873_+	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	82.0	1.9e-121
WP_025235715.1|868869_869481_+	YqaJ viral recombinase family protein	NA	A0A0M3LPU0	Mannheimia_phage	80.2	1.0e-90
WP_025235716.1|869519_869723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025235717.1|869725_870610_+	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	61.8	8.1e-36
WP_025235718.1|870635_870920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038644113.1|871158_871368_+	hypothetical protein	NA	A0A0M3LQA6	Mannheimia_phage	54.2	5.0e-13
WP_158497209.1|871369_871507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025235720.1|871499_871985_+	DUF551 domain-containing protein	NA	A0A0M3LS47	Mannheimia_phage	78.9	4.4e-60
WP_025235721.1|872144_872330_+	DUF1382 family protein	NA	NA	NA	NA	NA
WP_025235722.1|872313_872790_+	hypothetical protein	NA	A0A0M3LTD8	Mannheimia_phage	55.2	9.3e-39
WP_025235723.1|872793_872982_-	hypothetical protein	NA	A0A0M3LSW7	Mannheimia_phage	79.0	5.3e-22
WP_051411639.1|873229_873970_+	DNA methyltransferase	NA	K4JU61	Streptococcus_phage	60.5	1.3e-74
WP_025235724.1|874171_875167_+|integrase	site-specific integrase	integrase	A0A077KGX2	Edwardsiella_phage	36.7	2.8e-61
WP_025235725.1|875596_876457_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	6.9e-32
875252:875298	attR	AATGGCACGCCCTAAAGGATTCGAACCTTTGACCCACGCCTTAGAAG	NA	NA	NA	NA
WP_025235726.1|876584_878036_+|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_025235727.1|878154_878439_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_025235728.1|878619_879564_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	38.6	3.8e-52
>prophage 2
NZ_CP006942	Mannheimia sp. USDA-ARS-USMARC-1261 chromosome, complete genome	2393449	1062685	1073321	2393449		Bacillus_phage(28.57%)	9	NA	NA
WP_025235836.1|1062685_1064452_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.4	6.8e-18
WP_025235837.1|1064451_1066119_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.6	8.1e-21
WP_025235838.1|1066256_1066439_+	addiction module toxin, HicA family	NA	A0A0R6PJD4	Moraxella_phage	65.0	7.7e-18
WP_025235839.1|1066463_1066874_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	61.9	2.9e-41
WP_025235840.1|1066990_1067620_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_025235841.1|1067653_1069021_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	46.9	5.3e-111
WP_025235842.1|1069087_1069849_+	DeoR/GlpR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	29.2	7.0e-20
WP_025235843.1|1069841_1070717_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_025235844.1|1070888_1073321_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	A0A172JHT4	Bacillus_phage	32.1	1.1e-103
>prophage 3
NZ_CP006942	Mannheimia sp. USDA-ARS-USMARC-1261 chromosome, complete genome	2393449	1134864	1144387	2393449	integrase,terminase,tail,head,capsid,protease	uncultured_Caudovirales_phage(75.0%)	10	1137872:1137887	1152192:1152207
WP_025235902.1|1134864_1136544_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	70.8	3.3e-240
WP_025235903.1|1136540_1136900_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	68.1	2.9e-40
WP_025235904.1|1137144_1137501_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	53.4	6.5e-29
WP_025235905.1|1137512_1137818_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J8C5	uncultured_Caudovirales_phage	33.0	5.1e-06
WP_025235906.1|1137810_1138182_-|head	phage head closure protein	head	NA	NA	NA	NA
1137872:1137887	attL	AAGTCGATAACATCAA	NA	NA	NA	NA
WP_025235907.1|1139378_1139948_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	57.5	4.4e-51
WP_025235908.1|1140000_1141188_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	2.9e-129
WP_025235909.1|1141180_1141615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025235910.1|1141941_1143180_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	42.3	1.2e-85
WP_025235911.1|1143574_1144387_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	S4TT53	Salmonella_phage	38.6	1.8e-10
1152192:1152207	attR	TTGATGTTATCGACTT	NA	NA	NA	NA
>prophage 4
NZ_CP006942	Mannheimia sp. USDA-ARS-USMARC-1261 chromosome, complete genome	2393449	1506109	1516109	2393449		Chrysochromulina_ericina_virus(16.67%)	10	NA	NA
WP_025236215.1|1506109_1507963_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	43.0	1.0e-109
WP_025236216.1|1508020_1508653_-	DUF2625 family protein	NA	NA	NA	NA	NA
WP_025236217.1|1508687_1509209_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_025236218.1|1509218_1509542_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	46.7	1.3e-23
WP_025236219.1|1509650_1510034_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	74.2	2.5e-50
WP_025236220.1|1510064_1511285_-	IscS subfamily cysteine desulfurase	NA	A0A2K9L679	Tupanvirus	27.7	9.8e-16
WP_025236221.1|1511341_1511794_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_025236222.1|1512152_1513637_+	membrane protein	NA	NA	NA	NA	NA
WP_025236223.1|1513700_1514255_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	44.6	3.0e-28
WP_025236224.1|1514267_1516109_-	response regulator	NA	A0A1V0SGX0	Hokovirus	30.1	4.1e-42
>prophage 5
NZ_CP006942	Mannheimia sp. USDA-ARS-USMARC-1261 chromosome, complete genome	2393449	1762473	1768917	2393449	protease	Acinetobacter_phage(33.33%)	8	NA	NA
WP_025236453.1|1762473_1763064_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	40.9	2.2e-37
WP_025236454.1|1763056_1763443_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_025236455.1|1763481_1764480_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	1.3e-53
WP_025236456.1|1764543_1765299_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	36.2	2.2e-34
WP_025236457.1|1765526_1765904_-	SufE family protein	NA	NA	NA	NA	NA
WP_025236458.1|1766018_1766612_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	62.9	3.6e-64
WP_025236459.1|1766611_1767859_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.9	7.4e-120
WP_025236460.1|1767936_1768917_+	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	3.3e-06
>prophage 6
NZ_CP006942	Mannheimia sp. USDA-ARS-USMARC-1261 chromosome, complete genome	2393449	2052112	2112238	2393449	plate,transposase,integrase,terminase,tail,head,tRNA,capsid	Mannheimia_phage(66.0%)	71	2073524:2073540	2114160:2114176
WP_025236712.1|2052112_2053540_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_025236713.1|2053754_2054255_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_025236714.1|2054335_2056057_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.5	4.3e-17
WP_025216575.1|2056169_2056427_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_025236715.1|2056683_2058258_+	thiamine/thiamine pyrophosphate ABC transporter permease ThiP	NA	NA	NA	NA	NA
WP_025236716.1|2058254_2058899_+	thiamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	1.7e-22
WP_025236717.1|2059008_2060433_+	PTS sucrose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_025236718.1|2060515_2061319_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_025236719.1|2061399_2062065_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	58.0	5.6e-58
WP_025236720.1|2062269_2062959_+	pirin family protein	NA	NA	NA	NA	NA
WP_025236721.1|2063035_2064055_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_025236722.1|2064118_2064874_-	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	28.5	9.0e-20
WP_025236723.1|2064860_2065511_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_025236724.1|2065514_2065751_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_025236725.1|2065861_2067499_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.7	1.1e-38
WP_025236726.1|2067498_2068128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025236727.1|2068130_2068919_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_025236728.1|2069248_2070202_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_025236729.1|2070268_2072071_+	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_025236730.1|2072114_2073119_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_025236731.1|2073196_2074036_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
2073524:2073540	attL	ATTTTCGACCGCTTGTG	NA	NA	NA	NA
WP_025236732.1|2074281_2075616_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_025236733.1|2075933_2076716_-	hypothetical protein	NA	F6MIM2	Haemophilus_phage	76.6	3.3e-118
WP_025236734.1|2076844_2077309_-	enoyl-CoA hydratase	NA	F6MIM0	Haemophilus_phage	65.6	1.9e-57
WP_051411648.1|2077305_2077716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025236737.1|2079725_2080310_-	DUF2313 domain-containing protein	NA	F6MIL7	Haemophilus_phage	79.8	1.1e-84
WP_025236738.1|2080309_2081371_-|plate	baseplate J/gp47 family protein	plate	F6MIL6	Haemophilus_phage	77.3	4.5e-150
WP_025236739.1|2081385_2081736_-	hypothetical protein	NA	A0A0M3LQK5	Mannheimia_phage	87.1	9.2e-52
WP_038644035.1|2081842_2082496_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	86.6	1.0e-96
WP_038644037.1|2082498_2083638_-|tail	tail protein	tail	A0A0M3LPS4	Mannheimia_phage	92.6	2.2e-195
WP_025236742.1|2083641_2085003_-	hypothetical protein	NA	F6MIL2	Haemophilus_phage	59.2	9.8e-150
WP_025236743.1|2085002_2087381_-|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	85.5	0.0e+00
WP_005606527.1|2087433_2087622_-	hypothetical protein	NA	A0A0M3LSQ8	Mannheimia_phage	96.8	3.6e-26
WP_025236744.1|2087651_2088011_-	hypothetical protein	NA	A0A0M3LSI2	Mannheimia_phage	77.9	1.1e-44
WP_025236745.1|2088010_2088385_-|tail	phage tail protein	tail	A0A0M3LRV6	Mannheimia_phage	91.9	3.2e-58
WP_025236746.1|2088395_2089808_-|tail	tail sheath protein	tail	A0A0M3LQC3	Mannheimia_phage	93.6	1.1e-239
WP_025236747.1|2089800_2089992_-	DUF2635 domain-containing protein	NA	A0A0M3LQM9	Mannheimia_phage	86.4	1.5e-19
WP_025236748.1|2089978_2090245_-	hypothetical protein	NA	B7SDP6	Haemophilus_phage	65.9	1.3e-26
WP_025236749.1|2090241_2090880_-	DUF1834 family protein	NA	A0A0M3LQJ7	Mannheimia_phage	94.6	7.0e-106
WP_025236750.1|2090876_2091302_-	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	93.6	2.2e-68
WP_025236751.1|2091301_2091619_-	hypothetical protein	NA	A0A0M3LPR6	Mannheimia_phage	89.4	1.1e-27
WP_025236752.1|2091666_2092584_-|head	head protein	head	B7SDP1	Haemophilus_phage	85.5	9.6e-149
WP_025236753.1|2092583_2093651_-	hypothetical protein	NA	A0A0M3LPA7	Mannheimia_phage	92.4	1.8e-183
WP_025236754.1|2093908_2094325_-	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	88.3	1.6e-63
WP_038644039.1|2094321_2094531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025236756.1|2094681_2095986_-|capsid	minor capsid protein	capsid	A0A0M3LSH7	Mannheimia_phage	92.6	4.0e-233
WP_025236757.1|2095972_2097586_-	DUF935 domain-containing protein	NA	A0A0M3LRU4	Mannheimia_phage	92.0	4.9e-289
WP_025236758.1|2097645_2099268_-|terminase	phage terminase large subunit	terminase	A0A0M3LQB7	Mannheimia_phage	92.2	1.9e-296
WP_025236759.1|2099417_2099918_-	DUF1804 family protein	NA	A0A0M3LQI8	Mannheimia_phage	97.0	2.3e-80
WP_025236760.1|2099925_2100180_-	hypothetical protein	NA	A0A0M3LP87	Mannheimia_phage	94.0	2.0e-27
WP_025236761.1|2100179_2100437_-	hypothetical protein	NA	A0A0M3LPQ4	Mannheimia_phage	100.0	2.1e-13
WP_038644040.1|2100599_2100959_-	DUF2681 domain-containing protein	NA	A0A0M3LP93	Mannheimia_phage	84.0	2.3e-50
WP_025236762.1|2100955_2101198_-	DUF2644 domain-containing protein	NA	A0A0M3LSN9	Mannheimia_phage	88.9	7.8e-34
WP_025236763.1|2101201_2101735_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	95.5	1.4e-96
WP_025236764.1|2101821_2102253_-	hypothetical protein	NA	A0A0M3LRS6	Mannheimia_phage	69.9	3.5e-53
WP_025236765.1|2103028_2103376_-	hypothetical protein	NA	A0A0M3LQH8	Mannheimia_phage	97.4	2.3e-55
WP_025236766.1|2103469_2103676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025236767.1|2103686_2104286_-	antirepressor	NA	A0A0R6PJV6	Moraxella_phage	51.1	3.0e-26
WP_025236768.1|2104641_2105070_-	regulatory protein GemA	NA	F6MIJ6	Haemophilus_phage	58.2	4.9e-39
WP_025236769.1|2105053_2105611_-	hypothetical protein	NA	A0A0M3LPP6	Mannheimia_phage	94.1	8.5e-92
WP_025236770.1|2105607_2105850_-	hypothetical protein	NA	A0A0M3LPZ3	Mannheimia_phage	50.0	3.1e-06
WP_025236771.1|2105921_2106311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025236772.1|2106334_2106517_-	hypothetical protein	NA	A0A0M3LSN0	Mannheimia_phage	86.7	2.0e-21
WP_025236773.1|2106526_2106724_-	ANR family transcriptional regulator	NA	A0A0M3LSH0	Mannheimia_phage	77.5	3.7e-10
WP_025236775.1|2107041_2107659_-	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	95.6	3.2e-108
WP_005822932.1|2107672_2107864_-	hypothetical protein	NA	A0A0M3LQK4	Mannheimia_phage	95.2	5.6e-27
WP_005606439.1|2107866_2108187_-	hypothetical protein	NA	A0A0M3LQH1	Mannheimia_phage	92.5	2.7e-42
WP_025236776.1|2108197_2109079_-	AAA family ATPase	NA	A0A0M3LP72	Mannheimia_phage	93.5	9.5e-146
WP_025236777.1|2109089_2111057_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	F6MII5	Haemophilus_phage	39.3	3.8e-126
WP_025236778.1|2111077_2111338_-	Nlp family transcriptional regulator	NA	F6MII4	Haemophilus_phage	87.2	1.6e-37
WP_025236779.1|2111521_2112238_+	helix-turn-helix transcriptional regulator	NA	F6MII3	Haemophilus_phage	67.9	1.8e-86
2114160:2114176	attR	CACAAGCGGTCGAAAAT	NA	NA	NA	NA
