The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007067	Rhizobium leguminosarum bv. trifolii CB782 chromosome, complete genome	4378440	1119899	1129109	4378440		Aeromonas_phage(14.29%)	9	NA	NA
WP_025415833.1|1119899_1121198_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.3	4.9e-98
WP_003547190.1|1121207_1121684_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_025415834.1|1121687_1122989_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	37.2	4.2e-33
WP_003574063.1|1122988_1123600_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.6	1.2e-17
WP_003574061.1|1123697_1124567_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	59.5	3.4e-95
WP_025415835.1|1124576_1125464_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_025415836.1|1125467_1126523_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.8	6.3e-96
WP_025415837.1|1126529_1127108_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	43.4	3.2e-33
WP_025415838.1|1127132_1129109_-	glycosyltransferase family 1 protein	NA	F2Y0P4	Organic_Lake_phycodnavirus	36.4	8.7e-06
>prophage 2
NZ_CP007067	Rhizobium leguminosarum bv. trifolii CB782 chromosome, complete genome	4378440	1394795	1458712	4378440	integrase,tRNA,head,portal,tail,protease,capsid,terminase	Rhizobium_phage(40.0%)	67	1427442:1427461	1463054:1463073
WP_025415973.1|1394795_1395533_-|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_025415974.1|1395538_1396576_-	cysteine synthase A	NA	NA	NA	NA	NA
WP_025415975.1|1396801_1397458_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_025415976.1|1397556_1398390_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003573637.1|1398390_1399653_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	33.8	8.2e-42
WP_025415977.1|1399859_1401308_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	29.7	2.8e-54
WP_003573634.1|1401459_1401786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025415978.1|1401987_1402302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003573630.1|1402319_1402805_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003573628.1|1402943_1403363_+	DUF2000 domain-containing protein	NA	NA	NA	NA	NA
WP_003573626.1|1403493_1404171_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_025415979.1|1404195_1406853_-	nitrate reductase	NA	NA	NA	NA	NA
WP_025415980.1|1406852_1407188_-	nitrite reductase small subunit NirD	NA	NA	NA	NA	NA
WP_025415981.1|1407192_1409643_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003573619.1|1409660_1410902_-	NarK/NasA family nitrate transporter	NA	NA	NA	NA	NA
WP_025415982.1|1411296_1412580_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_037092785.1|1412614_1413202_-	ANTAR domain-containing response regulator	NA	NA	NA	NA	NA
WP_025415984.1|1413533_1415357_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_025415985.1|1415373_1416372_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003573610.1|1416663_1417323_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_003573608.1|1417472_1418429_+	lytic transglycosylase domain-containing protein	NA	A0A0A0P1R1	Enterobacteria_phage	34.6	2.5e-06
WP_025415986.1|1418526_1419480_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_025415987.1|1419491_1420757_-	glycerate kinase	NA	NA	NA	NA	NA
WP_003573603.1|1420951_1421251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025415988.1|1421267_1422353_-	PHB depolymerase family esterase	NA	NA	NA	NA	NA
WP_025415989.1|1422563_1422971_+	low affinity iron permease family protein	NA	Q19XG2	Mycobacterium_phage	42.9	1.3e-09
WP_025415990.1|1422997_1423357_-	low affinity iron permease family protein	NA	NA	NA	NA	NA
WP_025415991.1|1423508_1425623_-	catalase	NA	A0A2K9L572	Tupanvirus	49.4	2.9e-140
WP_025415992.1|1425800_1426697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080687562.1|1426911_1427178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025415993.1|1427174_1427411_-	hypothetical protein	NA	NA	NA	NA	NA
1427442:1427461	attL	CCGATGTTCTTATTATGTTC	NA	NA	NA	NA
WP_025415995.1|1428612_1428927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155256625.1|1429182_1429482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025415997.1|1429724_1430909_+|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	44.6	1.6e-79
WP_172644311.1|1431136_1431343_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_025415999.1|1431433_1432003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025416000.1|1432251_1434603_+	DUF3987 domain-containing protein	NA	A0A249XYW6	Clostridium_phage	34.1	6.7e-05
WP_025416001.1|1434830_1435232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025416002.1|1436633_1437647_+	hypothetical protein	NA	A0A0R6PIZ6	Moraxella_phage	26.7	4.3e-25
WP_025416004.1|1438054_1438525_+|terminase	phage terminase small subunit P27 family	terminase	NA	NA	NA	NA
WP_052349976.1|1438554_1440123_+|terminase	terminase large subunit	terminase	F1C585	Cronobacter_phage	44.6	2.8e-100
WP_025416006.1|1440138_1441380_+|portal	phage portal protein	portal	B0VK31	Azospirillum_phage	43.2	3.1e-94
WP_155256626.1|1441376_1442117_+|head,protease	HK97 family phage prohead protease	head,protease	B0VK32	Azospirillum_phage	43.4	7.7e-24
WP_025416008.1|1442160_1443450_+|capsid	phage major capsid protein	capsid	B0VK33	Azospirillum_phage	32.8	2.1e-48
WP_025416009.1|1443515_1443947_+	hypothetical protein	NA	B0VK34	Azospirillum_phage	54.0	3.0e-28
WP_025416010.1|1443946_1444189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025416011.1|1444194_1444758_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A286S294	Klebsiella_phage	44.6	1.5e-06
WP_025416012.1|1444775_1445186_+	hypothetical protein	NA	B4UTP8	Rhizobium_phage	59.0	1.9e-32
WP_025416013.1|1445337_1445688_+|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_025416014.1|1445684_1446146_+	HK97 gp10 family phage protein	NA	B4UTQ0	Rhizobium_phage	45.2	1.3e-24
WP_025416015.1|1446149_1446566_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_025416016.1|1446605_1447043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025416017.1|1447042_1447408_+	gene transfer agent family protein	NA	B4UTQ4	Rhizobium_phage	41.3	7.4e-12
WP_025416018.1|1447633_1449904_+	tape measure protein	NA	A0A141GEX2	Brucella_phage	27.6	9.3e-36
WP_025416019.1|1449913_1450636_+	hypothetical protein	NA	B4UTQ7	Rhizobium_phage	66.7	4.2e-91
WP_080687588.1|1450665_1451205_+	hypothetical protein	NA	B4UTQ9	Rhizobium_phage	52.5	1.3e-52
WP_025416021.1|1451290_1451509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025416022.1|1451507_1451948_+	hypothetical protein	NA	B4UTR0	Rhizobium_phage	60.9	4.3e-38
WP_025416023.1|1451948_1453994_+	hypothetical protein	NA	B4UTR1	Rhizobium_phage	53.3	8.0e-204
WP_025416024.1|1454032_1455502_+	hypothetical protein	NA	B4UTR2	Rhizobium_phage	64.3	3.3e-66
WP_155256627.1|1455506_1456598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025416026.1|1456615_1456909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025416027.1|1457020_1457230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025416028.1|1457216_1457813_+	lysozyme	NA	L7TM06	Rhizobium_phage	61.8	2.2e-61
WP_025416029.1|1457809_1458181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038573798.1|1458101_1458404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025416031.1|1458400_1458712_+	hypothetical protein	NA	B4UTS1	Rhizobium_phage	53.7	6.1e-23
1463054:1463073	attR	CCGATGTTCTTATTATGTTC	NA	NA	NA	NA
>prophage 3
NZ_CP007067	Rhizobium leguminosarum bv. trifolii CB782 chromosome, complete genome	4378440	1488099	1501203	4378440	tRNA	uncultured_Mediterranean_phage(90.91%)	13	NA	NA
WP_025416059.1|1488099_1489113_+	beta-N-acetylhexosaminidase	NA	A0A1B1IVS3	uncultured_Mediterranean_phage	42.6	4.8e-24
WP_003573554.1|1489161_1490019_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	37.2	1.2e-33
WP_025416060.1|1490015_1490732_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.5	4.1e-38
WP_003538990.1|1490915_1491107_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	72.1	8.9e-09
WP_025416061.1|1491157_1491772_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003573547.1|1491768_1492596_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.1	1.2e-52
WP_025416062.1|1492695_1493979_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.3	6.3e-98
WP_025416063.1|1493983_1494757_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	30.2	5.2e-23
WP_003573541.1|1494753_1495407_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	35.9	3.6e-17
WP_025416064.1|1495546_1497139_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV24	Clostridium_phage	29.2	8.6e-12
WP_025416065.1|1497193_1498066_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_003573534.1|1498269_1498617_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	38.0	3.2e-12
WP_025416066.1|1498662_1501203_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	47.8	6.3e-57
>prophage 4
NZ_CP007067	Rhizobium leguminosarum bv. trifolii CB782 chromosome, complete genome	4378440	1704475	1714675	4378440		uncultured_Mediterranean_phage(83.33%)	9	NA	NA
WP_025416163.1|1704475_1707397_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	62.0	0.0e+00
WP_025416164.1|1707680_1708190_+	single-stranded DNA-binding protein	NA	R9TP78	Rhizobium_phage	56.8	9.3e-45
WP_003573165.1|1708276_1708924_-	MarC family protein	NA	NA	NA	NA	NA
WP_025416165.1|1709160_1711980_+	DNA gyrase subunit A	NA	A0A1B1IVS2	uncultured_Mediterranean_phage	41.9	1.1e-75
WP_003573160.1|1712330_1712486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025416166.1|1712628_1712907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025416167.1|1712996_1713491_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.5	6.7e-24
WP_025416168.1|1713564_1714137_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	52.6	4.9e-42
WP_003573154.1|1714165_1714675_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	59.4	3.2e-45
>prophage 5
NZ_CP007067	Rhizobium leguminosarum bv. trifolii CB782 chromosome, complete genome	4378440	3468924	3476084	4378440		Mycobacterium_phage(28.57%)	8	NA	NA
WP_025417122.1|3468924_3469635_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2P1JXV3	Rhodococcus_phage	47.3	1.3e-47
WP_003566894.1|3469634_3469991_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_025417123.1|3469987_3470716_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	38.3	4.4e-40
WP_025417124.1|3470722_3471946_-	adenylate/guanylate cyclase domain-containing protein	NA	M1HLN3	Pelagibacter_phage	27.5	3.2e-14
WP_025417125.1|3472050_3473025_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	75.1	3.3e-139
WP_025417126.1|3473256_3475455_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	51.5	6.1e-210
WP_025417127.1|3475433_3475850_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	34.1	2.9e-12
WP_025417128.1|3475862_3476084_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	52.1	6.1e-17
>prophage 1
NZ_CP007070	Rhizobium leguminosarum bv. trifolii CB782 plasmid unnamed, complete sequence	251612	76427	143282	251612	integrase,transposase	Acinetobacter_phage(18.18%)	59	64943:64957	110365:110379
64943:64957	attL	TGCCGACCGGGCGAC	NA	NA	NA	NA
WP_080687673.1|76427_76649_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	43.5	2.2e-06
WP_080687674.1|76588_77125_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	31.6	1.1e-11
WP_025419103.1|78237_78960_+	type IV secretion system lytic transglycosylase VirB1	NA	NA	NA	NA	NA
WP_025419104.1|78959_79319_+	pilin major subunit VirB2	NA	NA	NA	NA	NA
WP_025419105.1|79318_79645_+	type IV secretion system protein VirB3	NA	NA	NA	NA	NA
WP_025419106.1|79644_82014_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_025419107.1|82027_82696_+	type IV secretion system protein VirB5	NA	NA	NA	NA	NA
WP_025419108.1|82761_83649_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_080687676.1|83678_83837_+	type IV secretion system lipoprotein VirB7	NA	NA	NA	NA	NA
WP_025419109.1|83833_84547_+	type IV secretion system protein VirB8	NA	NA	NA	NA	NA
WP_025419110.1|84543_85425_+	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_041686884.1|85421_86516_+	type IV secretion system protein VirB10	NA	NA	NA	NA	NA
WP_155256699.1|86849_87149_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_025419113.1|87261_88302_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_025419114.1|88860_89637_+	winged helix-turn-helix domain-containing protein	NA	W8CYM9	Bacillus_phage	29.1	3.1e-15
WP_025419115.1|89652_91347_-	type IV secretion system ATPase VirD4	NA	NA	NA	NA	NA
WP_025419116.1|92487_93591_+	acyltransferase	NA	A9YX16	Burkholderia_phage	29.8	9.8e-15
WP_025419117.1|94307_94796_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_025419118.1|94872_96699_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HHR4	Paramecium_bursaria_Chlorella_virus	39.8	1.3e-104
WP_025419119.1|96944_97496_-	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_025419120.1|97852_99061_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_025419121.1|99060_99339_-	nodulation protein NodF	NA	NA	NA	NA	NA
WP_025419122.1|99853_100801_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025419123.1|101021_101612_+	NodA family N-acyltransferase	NA	NA	NA	NA	NA
WP_025419124.1|101608_102259_+	chitooligosaccharide deacetylase NodB	NA	NA	NA	NA	NA
WP_025419125.1|102279_103560_+	chitooligosaccharide synthase NodC	NA	NA	NA	NA	NA
WP_025419126.1|103597_104626_+	nodulation factor ABC transporter ATP-binding protein NodI	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	36.8	9.7e-25
WP_025419127.1|104622_105411_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172644342.1|105748_106183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025419129.1|106708_107374_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_025419130.1|107402_107561_-	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_025419131.1|107557_109846_-	cadmium-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	29.9	2.0e-78
WP_025419132.1|109842_110328_-	FixH family protein	NA	NA	NA	NA	NA
WP_025419133.1|110324_111893_-	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
110365:110379	attR	GTCGCCCGGTCGGCA	NA	NA	NA	NA
WP_003568506.1|112082_112268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025419134.1|112278_113142_-	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_025419135.1|113143_113296_-	CcoQ/FixQ family Cbb3-type cytochrome c oxidase assembly chaperone	NA	NA	NA	NA	NA
WP_025419136.1|113304_114039_-	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_025419137.1|114047_115670_-	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_025419139.1|116618_118415_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.3	2.6e-33
WP_080687677.1|118575_118926_-	ferredoxin III, nif-specific	NA	NA	NA	NA	NA
WP_025419140.1|119164_119518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025419141.1|119696_120944_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_025419142.1|122023_124645_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_025419143.1|124706_126149_+	biotin carboxylase	NA	NA	NA	NA	NA
WP_025419144.1|126210_127359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025419145.1|127355_128387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080687679.1|128503_128815_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	40.6	4.2e-16
WP_025419146.1|129228_129525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080687680.1|130600_130828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_025419148.1|131291_132839_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_025419149.1|132877_133816_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025419150.1|133827_134679_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_025419151.1|134675_136340_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.8	1.1e-12
WP_025419152.1|136733_137663_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025419153.1|137692_138883_+	serine hydrolase	NA	NA	NA	NA	NA
WP_155256711.1|140251_140896_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_025419155.1|141012_141756_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080687681.1|142970_143282_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	42.6	2.0e-18
