The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	285664	342160	5488183	tRNA,protease,transposase,integrase	uncultured_Caudovirales_phage(36.36%)	52	317087:317105	342386:342404
WP_024912408.1|285664_286675_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_024912407.1|286678_287938_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_024912406.1|288030_289311_-	GTPase HflX	NA	NA	NA	NA	NA
WP_024912405.1|289409_289715_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_024912404.1|289829_290771_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_024912403.1|290763_292626_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	29.8	5.3e-61
WP_024912402.1|292649_294374_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	M1IQ67	Bacillus_virus	26.1	1.3e-18
WP_024912401.1|294381_294852_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_024912400.1|294862_296377_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_024912399.1|296375_297515_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_045784823.1|298211_298766_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024912397.1|298918_299788_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_024912396.1|299987_300377_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_024912395.1|300407_301076_-	NAD(P)H dehydrogenase	NA	NA	NA	NA	NA
WP_024912394.1|301226_302081_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024912393.1|302415_303396_-	acyltransferase	NA	NA	NA	NA	NA
WP_024912392.1|303495_304374_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154666859.1|304274_304874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024912390.1|305180_305549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024912389.1|305548_305905_-	DUF2778 domain-containing protein	NA	A0A2H4IBA1	Erwinia_phage	48.3	1.3e-24
WP_024912388.1|306227_306758_+	DUF1697 domain-containing protein	NA	NA	NA	NA	NA
WP_024912387.1|306979_308122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024914516.1|308672_309875_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.0	5.8e-77
WP_024914325.1|310160_311066_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_024914324.1|311264_311738_+	GyrI-like domain-containing protein	NA	NA	NA	NA	NA
WP_037407555.1|312043_312484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154667028.1|313097_313454_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024914322.1|313972_316684_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
317087:317105	attL	TTGGAGCGGGAAACGAGAC	NA	NA	NA	NA
WP_024914321.1|317706_318780_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	35.2	8.3e-51
WP_024914320.1|318781_319516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037407577.1|319530_320601_+	DNA cytosine methyltransferase	NA	A0A0R6PG08	Moraxella_phage	53.2	2.7e-102
WP_024914318.1|320602_321385_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_024914317.1|321651_321996_-	DUF2645 family protein	NA	NA	NA	NA	NA
WP_024914316.1|321992_322715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024914315.1|322729_323209_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_024914314.1|323433_323712_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_024914313.1|324596_325460_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_024914312.1|325559_325934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024914311.1|325930_328114_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_024914310.1|328119_330435_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_154666860.1|330494_331172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024914308.1|331388_331568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024914307.1|332445_332739_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_037407553.1|332805_333528_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.2	1.8e-94
WP_024914305.1|333535_334081_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_024914304.1|334156_334516_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_167336764.1|334560_336321_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_024914302.1|336377_336806_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.0	2.1e-50
WP_024914301.1|336868_338158_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	72.8	2.1e-170
WP_024914300.1|338376_338715_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.6	4.5e-19
WP_024914299.1|339238_340267_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_024914298.1|340453_342160_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5QF66	Pseudomonas_virus	49.2	1.6e-96
342386:342404	attR	TTGGAGCGGGAAACGAGAC	NA	NA	NA	NA
>prophage 2
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	1709291	1717142	5488183	tRNA	uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_024911242.1|1709291_1709909_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J122	uncultured_Caudovirales_phage	45.3	6.2e-35
WP_024911243.1|1709937_1710828_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	46.2	1.1e-64
WP_024911244.1|1710811_1711648_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.9e-39
WP_024911245.1|1711742_1713581_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_024911246.1|1713738_1715490_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.9	4.8e-72
WP_001144069.1|1715625_1715841_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_024911247.1|1716128_1717142_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	1.4e-108
>prophage 3
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	2932349	3003807	5488183	tail,lysis,transposase,holin	uncultured_virus(12.5%)	52	NA	NA
WP_025297165.1|2932349_2933558_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.4	6.0e-50
WP_154666951.1|2934067_2934166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024914172.1|2934697_2935228_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_037407480.1|2935409_2937962_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_051506738.1|2938107_2938845_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_162149760.1|2938932_2939994_+	fimbrial protein	NA	NA	NA	NA	NA
WP_024914176.1|2940518_2941664_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_024914177.1|2941657_2942458_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	31.2	1.6e-11
WP_024914178.1|2942461_2943403_+	MCE family protein	NA	NA	NA	NA	NA
WP_024914179.1|2943399_2944050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024914180.1|2944263_2944662_+	RidA family protein	NA	NA	NA	NA	NA
WP_045784789.1|2944658_2945783_+	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_024914182.1|2945849_2946740_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024914183.1|2946908_2947811_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024914184.1|2947926_2948916_+	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_024914185.1|2948942_2949641_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_037407473.1|2949754_2951065_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_024914187.1|2951154_2952072_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024914188.1|2952163_2952526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024914189.1|2952542_2953034_-	ATPase	NA	NA	NA	NA	NA
WP_024914190.1|2953087_2953414_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_154666952.1|2953542_2954253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024914192.1|2954379_2955282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024914193.1|2955268_2955622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162149761.1|2955618_2956929_-	DUF4303 domain-containing protein	NA	NA	NA	NA	NA
WP_024914195.1|2957110_2958454_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_024914196.1|2958623_2959340_-	UTRA domain-containing protein	NA	NA	NA	NA	NA
WP_024914197.1|2959448_2960510_+	solute-binding protein	NA	NA	NA	NA	NA
WP_025297164.1|2960517_2961318_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_024914209.1|2961345_2962185_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024914208.1|2962218_2963004_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_024914207.1|2963006_2963999_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.8	5.1e-31
WP_024914206.1|2963995_2964652_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_024914204.1|2966873_2967986_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_024914203.1|2967982_2969929_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	38.6	1.7e-38
WP_025297163.1|2970135_2989512_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.5	9.7e-166
WP_154666953.1|2989671_2990325_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_154666954.1|2990343_2990451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071882828.1|2990495_2990753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024913642.1|2991435_2992665_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_081758478.1|2992750_2993458_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_024913640.1|2993563_2994211_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_024913639.1|2994454_2995342_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_024913638.1|2995490_2996708_+	MFS transporter	NA	NA	NA	NA	NA
WP_024913637.1|2997194_2997509_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024913636.1|2998008_2998425_+	GFA family protein	NA	NA	NA	NA	NA
WP_024913635.1|2999172_2999664_-|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	42.5	1.7e-19
WP_024913634.1|2999770_3000169_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	53.1	6.2e-36
WP_024913633.1|3000165_3000474_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	39.2	6.1e-15
WP_024913632.1|3000849_3001299_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_024913631.1|3001337_3002405_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
WP_024913630.1|3002427_3003807_+|tail	phage tail sheath family protein	tail	NA	NA	NA	NA
>prophage 4
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	3243420	3278750	5488183	head,integrase,capsid,holin,tail,plate,portal	Salmonella_phage(53.12%)	44	3242907:3242966	3278869:3278978
3242907:3242966	attL	TTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGTACCACATTGA	NA	NA	NA	NA
WP_024911047.1|3243420_3244539_-	bacteriophage late gene control protein D	NA	A0A0M4REC6	Salmonella_phage	68.0	6.0e-121
WP_024911046.1|3244687_3245854_+|tail	tail protein	tail	A0A0M4S6M1	Salmonella_phage	60.8	2.2e-134
WP_024911045.1|3245864_3246380_+|tail	phage major tail tube protein	tail	A0A0M5M1I5	Salmonella_phage	62.0	8.8e-59
WP_024911044.1|3246448_3246757_+|tail	phage tail assembly protein	tail	A0A0M4RCV2	Salmonella_phage	60.5	3.7e-20
WP_071882834.1|3246774_3246897_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	71.8	5.1e-10
WP_024911043.1|3246899_3249962_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	47.5	2.1e-139
WP_024911042.1|3249993_3250422_+|tail	phage tail protein	tail	A0A1J0I2L5	Salmonella_phage	64.7	5.4e-46
WP_024911041.1|3250505_3251672_-	hypothetical protein	NA	S4TP62	Salmonella_phage	48.4	2.1e-47
WP_024911040.1|3251680_3254680_-	hypothetical protein	NA	Q6QI97	Burkholderia_phage	50.9	7.8e-06
WP_024911039.1|3254681_3255281_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	53.7	6.9e-55
WP_024911038.1|3255273_3256185_-|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	67.1	2.0e-106
WP_024911037.1|3256181_3256532_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	50.0	1.6e-24
WP_024911036.1|3256528_3257083_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	47.8	3.5e-37
WP_024911035.1|3257179_3257809_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	44.0	1.1e-34
WP_024911034.1|3257805_3258297_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	40.9	1.5e-23
WP_024911033.1|3258360_3258909_-	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_037405874.1|3258905_3259481_-	N-acetylmuramidase family protein	NA	A0A248SKU3	Klebsiella_phage	56.5	3.9e-55
WP_037405872.1|3259458_3259770_-|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	43.0	1.7e-09
WP_024911032.1|3259759_3260146_-	hypothetical protein	NA	A0A1S5NRL1	Burkholderia_phage	41.1	5.3e-08
WP_024911031.1|3260180_3260387_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	60.3	3.4e-14
WP_024911030.1|3260386_3260881_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	51.8	1.7e-35
WP_081758410.1|3260978_3261833_-	hypothetical protein	NA	B9A7B6	Serratia_phage	42.7	1.5e-47
WP_024911028.1|3261885_3262920_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	62.0	6.6e-122
WP_024911027.1|3262956_3263817_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1J0I2E9	Salmonella_phage	54.4	5.6e-58
WP_024911026.1|3263973_3265695_+	oxidoreductase	NA	A0A0M4S6K7	Salmonella_phage	58.9	8.3e-186
WP_081758414.1|3265874_3266798_+|portal	phage portal protein	portal	A0A0M5M1H6	Salmonella_phage	66.3	5.5e-120
WP_024911024.1|3267243_3268056_-	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	30.9	1.9e-23
WP_024911023.1|3268068_3268284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024911022.1|3268464_3270990_-	replication endonuclease	NA	A0A0M3ULG0	Salmonella_phage	40.5	2.0e-135
WP_024911021.1|3271150_3271558_-	DUF3850 domain-containing protein	NA	C9E2N9	Enterococcus_phage	68.1	5.0e-09
WP_037405868.1|3271526_3272399_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	E5G6L8	Salmonella_phage	54.3	5.8e-79
WP_024911019.1|3272395_3272689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045784796.1|3272685_3272931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024911017.1|3273144_3273420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154666966.1|3273416_3273566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024911016.1|3273565_3273802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024911015.1|3274109_3274598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024911014.1|3274775_3275015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024911013.1|3275004_3275208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024911012.1|3275218_3275410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024911011.1|3275494_3275833_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	33.6	1.5e-11
WP_037405863.1|3275860_3276751_+	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	29.9	6.9e-19
WP_024911009.1|3276840_3277746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024911008.1|3277745_3278750_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.0	2.4e-105
3278869:3278978	attR	TTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGTACCACATTGATTTACAAAGAATTTTAGACCGCCTTAAGGGCGGTTTTTTTGTGTCTGAAA	NA	NA	NA	NA
>prophage 5
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	3448063	3455068	5488183	holin	Escherichia_phage(50.0%)	9	NA	NA
WP_037405816.1|3448063_3448360_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	36.2	4.9e-06
WP_024910856.1|3448346_3448739_+	M15 family metallopeptidase	NA	M9UXQ4	Escherichia_phage	62.8	6.7e-35
WP_024910855.1|3448822_3450070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051506683.1|3450180_3450528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024910853.1|3450712_3450979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154666973.1|3451200_3451380_+	hypothetical protein	NA	K7P6U5	Enterobacteria_phage	64.6	4.7e-12
WP_024910852.1|3451572_3451869_+	hypothetical protein	NA	O64316	Escherichia_phage	63.2	4.8e-17
WP_081758411.1|3452397_3453330_+	DUF1983 domain-containing protein	NA	Q9MCR7	Enterobacteria_phage	54.3	1.1e-30
WP_024910850.1|3453385_3455068_+	hypothetical protein	NA	W6ATR4	Escherichia_phage	66.2	2.4e-49
>prophage 6
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	3871493	3923720	5488183	integrase,protease,transposase,holin	Bacillus_phage(20.0%)	48	3881544:3881558	3929823:3929837
WP_024912989.1|3871493_3872372_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_024912988.1|3872568_3872949_-	DUF4260 domain-containing protein	NA	NA	NA	NA	NA
WP_024912987.1|3873036_3875091_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.2	7.5e-85
WP_024912986.1|3875110_3875827_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_024912985.1|3875922_3876420_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_024912984.1|3876654_3877902_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_024912983.1|3877870_3880501_+	PqiB family protein	NA	NA	NA	NA	NA
WP_024912982.1|3880638_3880887_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_024912981.1|3881028_3881418_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
3881544:3881558	attL	TTACAGGATTTTATG	NA	NA	NA	NA
WP_024912980.1|3881808_3882024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024912979.1|3882195_3882405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024912978.1|3882526_3883192_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024912976.1|3883975_3885226_+	MFS transporter	NA	NA	NA	NA	NA
WP_024912975.1|3885225_3886668_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	26.2	1.3e-30
WP_024912974.1|3886708_3887710_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_024912973.1|3887777_3888341_-	HutD family protein	NA	NA	NA	NA	NA
WP_024912972.1|3888340_3889711_-	formimidoylglutamate deiminase	NA	NA	NA	NA	NA
WP_024912971.1|3889888_3890644_+	histidine utilization repressor	NA	NA	NA	NA	NA
WP_024912970.1|3890786_3892007_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_024912969.1|3892003_3892807_+	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_024912968.1|3892884_3893409_-	chorismate mutase	NA	NA	NA	NA	NA
WP_024912967.1|3893689_3893869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024912966.1|3894112_3895006_-	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_024912965.1|3895096_3896467_-	APC family permease	NA	NA	NA	NA	NA
WP_024912964.1|3896595_3898014_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_024912963.1|3898279_3899041_+	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_024912962.1|3899037_3899595_+	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_024912961.1|3899610_3901107_+	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_024912960.1|3901117_3902398_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_024912959.1|3903302_3903674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024912958.1|3904081_3905596_+	hypothetical protein	NA	M1HLT6	Pelagibacter_phage	32.7	1.9e-61
WP_024912957.1|3905810_3906269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024912956.1|3906262_3906589_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_154666983.1|3906631_3907980_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	49.6	3.4e-70
WP_162149751.1|3908195_3909677_-	hypothetical protein	NA	A6M964	Geobacillus_virus	30.8	4.8e-09
WP_024913286.1|3910802_3911327_-	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_024913284.1|3912022_3913663_-	aromatic amino acid lyase	NA	NA	NA	NA	NA
WP_081758459.1|3913747_3914254_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	34.0	1.5e-18
WP_154666984.1|3915619_3915850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024913281.1|3916011_3917235_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_071882842.1|3917427_3918177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154666985.1|3918349_3918709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024913279.1|3919208_3919505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024913278.1|3920512_3920809_-|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	44.4	9.0e-16
WP_024913277.1|3920795_3921173_-	hypothetical protein	NA	A0A1S5NRL1	Burkholderia_phage	38.8	4.1e-05
WP_024913276.1|3921428_3921698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024913275.1|3921801_3922605_-|protease	serine protease	protease	Q6JKF3	Neodiprion_sertifer_nucleopolyhedrovirus	30.5	2.9e-16
WP_024913274.1|3923471_3923720_+|integrase	tyrosine-type recombinase/integrase	integrase	O21927	Phage_21	69.1	1.4e-25
3929823:3929837	attR	CATAAAATCCTGTAA	NA	NA	NA	NA
>prophage 7
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	3987439	4032530	5488183	integrase,capsid,transposase,terminase	Escherichia_phage(18.18%)	47	3978539:3978552	3997805:3997818
3978539:3978552	attL	GCCAACAGAAAAGG	NA	NA	NA	NA
WP_154666899.1|3987439_3988548_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.6	4.8e-46
WP_024914520.1|3988762_3989221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_037407808.1|3989205_3989538_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_154666938.1|3989606_3990954_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	50.4	3.1e-71
WP_154666986.1|3990995_3991559_-	hypothetical protein	NA	W6ATR4	Escherichia_phage	46.6	7.2e-30
WP_024910318.1|3991913_3992279_-	hypothetical protein	NA	I6PCW3	Cronobacter_phage	38.7	2.5e-07
WP_154666987.1|3992399_3992633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081758388.1|3992865_3993174_-	hypothetical protein	NA	I6PD79	Cronobacter_phage	66.2	3.7e-20
WP_154666988.1|3993170_3993281_-	hypothetical protein	NA	G8C7Q5	Escherichia_phage	77.4	4.0e-06
WP_024910315.1|3993326_3993689_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	53.3	6.6e-29
WP_037405530.1|3993936_3994149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024910314.1|3994219_3994450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024910313.1|3994457_4001903_-	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	42.3	1.2e-276
3997805:3997818	attR	CCTTTTCTGTTGGC	NA	NA	NA	NA
WP_024910312.1|4002670_4002934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024910311.1|4003019_4004351_-	hypothetical protein	NA	A0A1I9KFD9	Aeromonas_phage	27.5	5.9e-14
WP_024910310.1|4004360_4004621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024910309.1|4004620_4005007_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	39.2	6.4e-14
WP_024910308.1|4005015_4005696_-	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	57.1	2.4e-43
WP_024910307.1|4005703_4006075_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	52.2	1.7e-27
WP_024910306.1|4006074_4007346_-	hypothetical protein	NA	A0A088CC36	Shigella_phage	46.5	3.5e-32
WP_024910305.1|4007342_4008968_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	53.2	1.1e-163
WP_024910304.1|4008975_4012305_-	hypothetical protein	NA	A0A2H4JC17	uncultured_Caudovirales_phage	24.2	1.7e-14
WP_024910303.1|4012301_4012961_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	49.3	2.6e-55
WP_024910302.1|4012961_4013558_-	hypothetical protein	NA	A0A1I9KFD5	Aeromonas_phage	37.3	8.4e-29
WP_024910301.1|4013557_4014040_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	47.4	3.2e-26
WP_024910300.1|4014102_4014486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024910299.1|4014545_4015769_-|capsid	N4-gp56 family major capsid protein	capsid	A0A088CC32	Shigella_phage	74.6	9.4e-176
WP_024910298.1|4015833_4016901_-	hypothetical protein	NA	A0A2L1IV47	Escherichia_phage	38.7	5.1e-53
WP_154666989.1|4016950_4017112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024910297.1|4017170_4019294_-	hypothetical protein	NA	V5URY3	Shigella_phage	68.3	4.9e-257
WP_167336768.1|4019293_4020958_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	73.1	2.6e-245
WP_037405526.1|4021005_4021869_-	hypothetical protein	NA	A0A1I9KFG9	Aeromonas_phage	45.7	1.4e-37
WP_071882845.1|4021942_4022500_-	hypothetical protein	NA	A0A2I7QK91	Vibrio_phage	46.4	1.1e-35
WP_024910293.1|4022496_4023039_-	DUF2570 domain-containing protein	NA	H9C185	Pectobacterium_phage	45.3	7.2e-19
WP_024910292.1|4023171_4023714_-	lysozyme	NA	A0A0M3LQY4	Mannheimia_phage	36.8	2.7e-26
WP_024910291.1|4023710_4023944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024910290.1|4024090_4024483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024910289.1|4024525_4025341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024910288.1|4025344_4025788_-	VRR-NUC domain-containing protein	NA	M4SRS1	Psychrobacter_phage	28.7	8.5e-10
WP_024910287.1|4025780_4026113_-	DUF1364 domain-containing protein	NA	A0A223LHA7	Pseudoalteromonas_phage	42.9	5.5e-14
WP_024910286.1|4026105_4026531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024910285.1|4026541_4027213_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	29.3	1.6e-20
WP_024910284.1|4027209_4029192_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	56.8	1.4e-221
WP_024910283.1|4029188_4030583_-	site-specific DNA-methyltransferase	NA	A0A1P8DTZ3	Salmonella_phage	49.7	3.0e-93
WP_024910282.1|4030579_4030825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024910281.1|4030821_4031961_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.4	1.8e-96
WP_162149736.1|4031957_4032530_-	hypothetical protein	NA	A0A2H4J1B6	uncultured_Caudovirales_phage	29.3	6.6e-07
>prophage 8
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	4037453	4052875	5488183	integrase	Vibrio_phage(18.75%)	23	4048769:4048781	4054141:4054153
WP_037405553.1|4037453_4038053_+	hypothetical protein	NA	V5URU3	Shigella_phage	40.3	3.2e-36
WP_024910270.1|4038238_4038991_+	methyltransferase	NA	M4M9L8	Vibrio_phage	44.4	1.4e-28
WP_024910269.1|4039099_4039378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024910268.1|4039661_4039925_+	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	51.3	4.8e-13
WP_024910267.1|4039989_4040322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154666990.1|4040466_4040625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024910266.1|4040621_4041455_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.0	2.6e-68
WP_024910265.1|4041441_4043028_+	hypothetical protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	52.1	2.5e-112
WP_024910264.1|4043068_4044223_+	hypothetical protein	NA	M4MHC3	Vibrio_phage	35.8	8.6e-30
WP_024910263.1|4044224_4044647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024910262.1|4044673_4045480_+	hypothetical protein	NA	A0A248SL66	Klebsiella_phage	40.5	4.4e-49
WP_024910261.1|4045489_4045762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024910260.1|4045751_4045985_+	hypothetical protein	NA	H2DE70	Erwinia_phage	62.3	4.7e-20
WP_154666991.1|4045981_4046491_+	hypothetical protein	NA	O64349	Escherichia_phage	53.0	3.0e-43
WP_024910258.1|4046487_4047012_+	hypothetical protein	NA	A0A248SL95	Klebsiella_phage	46.7	2.4e-43
WP_024910257.1|4047008_4047221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_154666992.1|4047229_4047580_+	hypothetical protein	NA	I3PV00	Vibrio_phage	46.4	3.2e-20
WP_024910255.1|4047964_4048657_+	hypothetical protein	NA	R9VWB9	Serratia_phage	46.2	4.5e-42
WP_024910254.1|4048653_4049223_+	hypothetical protein	NA	NA	NA	NA	NA
4048769:4048781	attL	GCTTTGCTGGCGC	NA	NA	NA	NA
WP_024910253.1|4049215_4050046_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	51.1	1.4e-69
WP_024910252.1|4050055_4050574_+	hypothetical protein	NA	Q7Y3W7	Yersinia_phage	50.0	6.3e-49
WP_024910251.1|4051545_4051815_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	40.0	5.0e-13
WP_024910250.1|4051789_4052875_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.7	4.5e-105
4054141:4054153	attR	GCGCCAGCAAAGC	NA	NA	NA	NA
>prophage 9
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	4277816	4290779	5488183	tRNA	Escherichia_phage(50.0%)	10	NA	NA
WP_024911908.1|4277816_4280099_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	3.9e-159
WP_024911907.1|4280397_4281138_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.4	1.4e-20
WP_024911906.1|4281188_4282331_-	MFS transporter	NA	NA	NA	NA	NA
WP_024911905.1|4282481_4283048_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_024911904.1|4283047_4283656_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.9	2.0e-22
WP_024911903.1|4283702_4284563_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.1	2.4e-24
WP_024911902.1|4284564_4285182_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	6.6e-77
WP_024911901.1|4285192_4287646_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	51.1	7.1e-223
WP_024911900.1|4288032_4289325_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.4	1.6e-93
WP_024911899.1|4289435_4290779_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	39.4	2.6e-78
>prophage 10
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	5075606	5088780	5488183		Hokovirus(16.67%)	7	NA	NA
WP_024910454.1|5075606_5080187_-	response regulator	NA	A0A1V0SGX0	Hokovirus	26.3	8.4e-60
WP_081758391.1|5080829_5081132_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_045784810.1|5081422_5082130_-	hypothetical protein	NA	A0A2H4UUT1	Bodo_saltans_virus	31.7	4.1e-22
WP_024910453.1|5083151_5085707_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.4	5.6e-29
WP_024910452.1|5085779_5086778_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.9	1.0e-31
WP_024910451.1|5086831_5087821_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	37.5	4.0e-07
WP_024910450.1|5088153_5088780_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.0	7.0e-34
>prophage 11
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	5105776	5121717	5488183	tail	Salmonella_phage(55.56%)	21	NA	NA
WP_024910430.1|5105776_5106655_-	hypothetical protein	NA	A9YX14	Burkholderia_phage	44.2	1.4e-11
WP_024910429.1|5106671_5107262_-|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	39.8	8.3e-29
WP_024910428.1|5107261_5107975_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	48.3	3.8e-36
WP_024910427.1|5107967_5108636_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	44.8	5.0e-46
WP_162149738.1|5108632_5109814_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	56.2	1.9e-117
WP_024910425.1|5109813_5110167_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	61.5	5.0e-37
WP_037405607.1|5110166_5110922_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	53.0	6.8e-60
WP_024910423.1|5110911_5111862_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	42.0	1.0e-68
WP_024910422.1|5111900_5112200_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	48.4	1.4e-16
WP_024910421.1|5112196_5112832_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	53.3	9.9e-44
WP_024910420.1|5112831_5114430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024910419.1|5114692_5115091_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	51.1	1.3e-30
WP_024910418.1|5115093_5115534_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	62.3	4.1e-49
WP_024910417.1|5115549_5117022_-	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	50.8	4.1e-133
WP_024910416.1|5117026_5117620_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	50.3	1.4e-44
WP_024910415.1|5117597_5117999_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	65.1	1.9e-40
WP_024910414.1|5118071_5118482_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.4	1.6e-39
WP_024910413.1|5118484_5118709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024910412.1|5118738_5120079_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	51.4	1.9e-129
WP_024910411.1|5120505_5120865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024910410.1|5121006_5121717_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	36.2	6.5e-28
>prophage 12
NZ_CP007044	Chania multitudinisentens RB-25 chromosome, complete genome	5488183	5432421	5459462	5488183	transposase	uncultured_virus(42.86%)	19	NA	NA
WP_025297200.1|5432421_5433630_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.4	3.0e-49
WP_154667023.1|5435230_5436374_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	1.1e-48
WP_024912040.1|5436556_5436841_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081758433.1|5436837_5437692_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.2	1.0e-80
WP_024912169.1|5438102_5440178_+	AAA domain-containing protein	NA	K4I1H4	Acidithiobacillus_phage	34.2	7.7e-37
WP_024912170.1|5440170_5441514_+	McrC family protein	NA	NA	NA	NA	NA
WP_037406385.1|5441510_5441897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024912171.1|5441946_5444100_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	42.3	5.7e-19
WP_024912172.1|5444099_5445641_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_024912173.1|5445658_5446945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024912174.1|5446941_5451228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024912175.1|5451238_5452090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024912176.1|5452092_5453250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024912177.1|5453239_5454925_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_024912178.1|5455061_5455475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024912179.1|5455471_5456941_+	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	3.0e-11
WP_071882818.1|5457231_5457534_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024914513.1|5457527_5457863_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_024914512.1|5457929_5459462_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	43.3	3.6e-92
