The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HG326223	Serratia marcescens subsp. marcescens Db11	5113802	1431625	1462963	5113802	protease,coat	Moraxella_phage(33.33%)	27	NA	NA
WP_025302579.1|1431625_1432558_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025302580.1|1432578_1434921_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025302581.1|1435066_1435831_-	molecular chaperone	NA	NA	NA	NA	NA
WP_162838013.1|1435856_1436405_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025302583.1|1436410_1436914_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_016928005.1|1436916_1437456_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_025302584.1|1437731_1439168_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_025302585.1|1439270_1441901_-	PqiB family protein	NA	NA	NA	NA	NA
WP_025302586.1|1441869_1443117_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_025302587.1|1443372_1443870_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_004931497.1|1443966_1444677_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_025302588.1|1444696_1446745_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.0	1.2e-85
WP_016927998.1|1447054_1447939_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_025302589.1|1448275_1448983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025302590.1|1449097_1450492_-	MFS transporter	NA	NA	NA	NA	NA
WP_025302591.1|1450723_1451515_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_025302592.1|1451561_1452365_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_025302593.1|1452367_1453231_-	2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_038629243.1|1453232_1454369_-	2-aminoethylphosphonate ABC transport system ATP-binding subunit PhnT	NA	G3M9Y6	Bacillus_virus	33.7	9.7e-26
WP_025302595.1|1454365_1455376_-	2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004931465.1|1455550_1456270_-	phosphonate utilization transcriptional regulator PhnR	NA	NA	NA	NA	NA
WP_025302596.1|1456423_1457527_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_025302597.1|1457536_1458346_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_025302598.1|1458409_1459801_-	L-cystine transporter	NA	NA	NA	NA	NA
WP_004931456.1|1459982_1460531_-	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	35.1	1.4e-06
WP_025302599.1|1460952_1461618_-	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_025302600.1|1461682_1462963_-|protease	protease	protease	NA	NA	NA	NA
>prophage 2
NZ_HG326223	Serratia marcescens subsp. marcescens Db11	5113802	2744948	2787752	5113802	terminase,protease,portal,capsid,integrase,tail,plate,head	Salmonella_phage(31.91%)	59	2748295:2748341	2787894:2787940
WP_025303563.1|2744948_2745956_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.1	9.1e-84
WP_004935782.1|2746166_2746394_+	YejL family protein	NA	NA	NA	NA	NA
WP_025303564.1|2746403_2748185_+	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
2748295:2748341	attL	CATGGGGTGTCGGGGGTCGGAGGTTCGAATCCTCTCATGCCGACCAA	NA	NA	NA	NA
WP_012906750.1|2748572_2748752_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	72.9	1.3e-17
WP_025303565.1|2748774_2749185_+	type II toxin-antitoxin system HicB family antitoxin	NA	Q775F5	Haemophilus_virus	51.5	1.7e-36
WP_025303566.1|2749239_2750355_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	35.4	1.1e-37
WP_071826130.1|2750329_2750746_-|tail	tail fiber assembly protein	tail	A0A291LAV4	Bordetella_phage	28.1	2.0e-05
WP_025303568.1|2752138_2752726_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	77.4	5.8e-91
WP_025303569.1|2752729_2753803_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	71.3	3.3e-148
WP_025303570.1|2753795_2754209_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	71.5	4.9e-52
WP_025303571.1|2754208_2754745_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	52.2	3.1e-38
WP_025303572.1|2754744_2755815_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	69.9	7.5e-145
WP_025303573.1|2755811_2757113_-	DNA circularization N-terminal domain-containing protein	NA	U5P4I0	Shigella_phage	60.3	1.1e-145
WP_071826131.1|2757177_2757630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025303574.1|2757736_2759644_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	56.3	2.0e-180
WP_025303575.1|2759728_2760052_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	57.9	1.6e-26
WP_025303576.1|2760048_2760405_-|tail	phage tail tube protein	tail	Q8W622	Enterobacteria_phage	82.2	7.2e-52
WP_025303577.1|2760404_2761922_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	69.9	3.3e-194
WP_071826132.1|2761918_2762092_-	DUF2635 domain-containing protein	NA	A0A1C9II04	Salmonella_phage	61.8	6.0e-12
WP_025303578.1|2762095_2762656_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	81.2	3.9e-84
WP_071826133.1|2762652_2763171_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	83.5	8.5e-78
WP_025303579.1|2763142_2763553_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	70.6	8.0e-47
WP_025303580.1|2763549_2763873_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	65.1	3.2e-35
WP_025303581.1|2763953_2765192_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	83.7	5.2e-190
WP_025303582.1|2765201_2765801_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	79.9	8.0e-88
WP_025303583.1|2765793_2767020_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	80.2	2.4e-195
WP_025303584.1|2767009_2767171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025303585.1|2767167_2768901_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	85.2	9.8e-304
WP_025303586.1|2768897_2769392_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	85.4	4.8e-78
WP_025303587.1|2769487_2769844_-	HNH endonuclease	NA	S5FKR6	Shigella_phage	76.3	3.9e-50
WP_025303588.1|2769824_2770187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038629711.1|2770183_2770813_-	methyltransferase domain-containing protein	NA	A0A2H4PI74	Pseudomonas_phage	46.9	2.0e-44
WP_049833028.1|2770787_2771660_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	46.8	4.9e-70
WP_025303591.1|2771668_2772217_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	54.2	1.0e-49
WP_025303592.1|2772343_2772628_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	66.0	5.4e-26
WP_025303593.1|2772751_2772946_-	hypothetical protein	NA	K7PHC3	Enterobacterial_phage	70.5	5.9e-16
WP_025303594.1|2772942_2773470_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	46.1	3.2e-32
WP_025303595.1|2773570_2774098_-	lysozyme	NA	H9C184	Pectobacterium_phage	83.0	9.9e-82
WP_025303596.1|2774097_2774358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025303597.1|2774609_2775275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025303598.1|2775271_2776309_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	47.2	1.4e-84
WP_025303599.1|2776305_2776848_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	64.2	2.2e-60
WP_025303600.1|2776844_2777858_-	conserved phage C-terminal domain-containing protein	NA	U5P0A0	Shigella_phage	61.5	3.3e-33
WP_071826134.1|2777854_2778034_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_025303601.1|2778033_2778855_-	hypothetical protein	NA	A0A248SL11	Klebsiella_phage	49.7	2.9e-40
WP_025303602.1|2779105_2779579_-	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	66.0	7.8e-54
WP_071826136.1|2779638_2779902_-	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	52.0	1.4e-15
WP_025303603.1|2780002_2780488_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	52.7	9.0e-13
WP_038630285.1|2780756_2780960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025303605.1|2782127_2782499_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	74.0	5.5e-47
WP_025303606.1|2782552_2783380_+	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	81.5	1.3e-125
WP_025303607.1|2783465_2783999_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	60.6	2.9e-57
WP_025303608.1|2783998_2784190_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_025303609.1|2784182_2784671_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.6	2.1e-70
WP_025303610.1|2784660_2785203_+	hypothetical protein	NA	A0A0H4IQ56	Shigella_phage	67.0	1.0e-65
WP_025303611.1|2785388_2785664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025303612.1|2785708_2786290_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	66.1	1.9e-65
WP_071826138.1|2786334_2786553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025303613.1|2786552_2787752_+|integrase	site-specific integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	30.0	7.6e-29
2787894:2787940	attR	CATGGGGTGTCGGGGGTCGGAGGTTCGAATCCTCTCATGCCGACCAA	NA	NA	NA	NA
>prophage 3
NZ_HG326223	Serratia marcescens subsp. marcescens Db11	5113802	4065236	4074163	5113802		environmental_Halophage(16.67%)	7	NA	NA
WP_025304518.1|4065236_4067315_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	71.9	1.3e-52
WP_025304519.1|4067355_4068573_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.3	1.5e-27
WP_025304520.1|4068704_4069280_-	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.6	4.0e-68
WP_025304521.1|4069352_4070876_-	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	42.6	4.3e-77
WP_025304522.1|4071027_4071753_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_025304523.1|4071752_4073438_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	72.8	8.8e-225
WP_025304524.1|4073593_4074163_-	peptidylprolyl isomerase A	NA	A0A1V0S9I2	Catovirus	31.0	1.7e-07
