The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	458227	507092	4701875	transposase,capsid,integrase,head,portal,protease,holin,terminase,tail	Escherichia_phage(43.75%)	63	462916:462975	506166:506230
WP_025237220.1|458227_458815_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_025237221.1|458811_459519_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_025237222.1|459537_461331_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_025237223.1|461327_462446_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
462916:462975	attL	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCA	NA	NA	NA	NA
WP_167330639.1|463889_465117_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	4.8e-172
WP_025237225.1|465509_465779_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.1e-44
WP_038429927.1|465780_467085_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	93.1	2.4e-68
WP_025237227.1|467149_467749_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	5.7e-102
WP_025237228.1|467819_471317_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.7	0.0e+00
WP_077696009.1|471377_472025_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	1.2e-110
WP_071825205.1|471922_472666_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	5.6e-147
WP_025237231.1|472671_473370_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.0	2.2e-129
WP_025237232.1|473369_473711_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.4	2.1e-40
WP_025237233.1|473703_476943_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	97.5	0.0e+00
WP_000394908.1|476991_477333_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	67.3	2.6e-35
WP_000978929.1|477390_477669_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	89.1	4.2e-39
WP_000164661.1|477692_478064_-|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000097537.1|478078_478783_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	98.7	2.5e-120
WP_001209399.1|478843_479188_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_001312916.1|479184_479634_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	7.9e-64
WP_001147820.1|479630_479969_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000983037.1|479977_480283_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_025237234.1|480294_480483_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	96.8	1.4e-25
WP_025237235.1|480533_481739_-|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	99.0	2.2e-222
WP_001193631.1|481753_482404_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466258.1|482381_483623_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	7.6e-242
WP_000478568.1|483622_483805_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	100.0	1.3e-25
WP_001140905.1|483816_485574_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.8	0.0e+00
WP_024210769.1|485573_486056_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	93.1	3.8e-80
WP_025237236.1|486203_486554_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	94.8	1.3e-61
WP_025237237.1|486574_486871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052931673.1|486940_487141_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	66.1	2.0e-11
WP_167330640.1|487362_487500_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	91.1	4.6e-15
WP_025237239.1|487657_488191_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.3	4.3e-101
WP_025237240.1|488254_488605_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	83.3	2.1e-32
WP_000839572.1|488609_488825_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_025237241.1|489566_490388_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.8	4.1e-82
WP_025237242.1|490384_490765_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	3.7e-38
WP_025237243.1|490765_491821_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	1.7e-88
WP_025237244.1|491822_492101_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_000687436.1|492167_492428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025237245.1|492585_493689_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001004956.1|493669_494320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|494485_494641_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_051419129.1|494741_494963_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	88.2	1.2e-25
WP_025237246.1|494930_495650_-	DUF551 domain-containing protein	NA	A0A0N7C063	Escherichia_phage	74.3	9.8e-48
WP_025237247.1|495808_496225_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	64.0	5.1e-41
WP_025237248.1|496232_496922_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	77.9	4.0e-99
WP_025237249.1|496944_497691_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.5	1.4e-113
WP_025237250.1|497697_498663_-	hypothetical protein	NA	U5P0A0	Shigella_phage	64.2	4.3e-59
WP_025237251.1|498643_499165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025237252.1|499148_499379_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000379971.1|499462_499870_+	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	54.7	2.6e-13
WP_000379575.1|500036_500192_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|500351_500570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394520.1|500592_501000_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.9	1.0e-09
WP_000920491.1|500977_501211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123003437.1|501204_501372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449200.1|501769_501958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025237254.1|502237_504718_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	64.1	9.8e-63
WP_000273158.1|504784_505036_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_024227504.1|505004_506024_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.7e-85
WP_025237255.1|506432_507092_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
506166:506230	attR	CGGTCTTGAAAACCGGCGACCCGAAAGGGTTCCAGAGTTCGAATCTCTGCGCTTCCGCCAAATAA	NA	NA	NA	NA
>prophage 2
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	519559	592284	4701875	transposase,integrase,tRNA,portal,protease,terminase	Escherichia_phage(24.14%)	59	520889:520906	589784:589801
WP_025237259.1|519559_521320_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
520889:520906	attL	CTCTGCGCCCTGATCAGC	NA	NA	NA	NA
WP_002462364.1|521388_521907_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|521975_522143_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000080197.1|522239_523853_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.0e-182
WP_000422741.1|524028_524454_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000759093.1|524737_525301_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_025237261.1|525297_526938_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_025237262.1|526942_528196_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_025237263.1|528397_530305_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	6.4e-54
WP_025237264.1|530316_532425_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_025237265.1|532668_533778_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220656.1|533774_534317_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_002462366.1|534490_535501_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_025237266.1|535914_538527_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.7	3.5e-18
WP_025237267.1|538792_539995_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117893.1|540163_541564_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.3	3.1e-82
WP_025237268.1|542166_543237_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	55.0	2.5e-100
WP_025237269.1|543421_544612_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109492.1|544833_545481_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_002462368.1|545507_546056_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000572612.1|548344_552805_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_025237270.1|552804_553509_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288860.1|553489_554812_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_010329757.1|554808_555594_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_025237271.1|555729_556509_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_038429945.1|556494_557379_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011625.1|557532_558279_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|558275_558458_-	protein YcaR	NA	NA	NA	NA	NA
WP_025237272.1|558509_559742_-	YcaQ family DNA glycosylase	NA	NA	NA	NA	NA
WP_000570517.1|559778_560765_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551258.1|560761_562510_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.1	1.2e-59
WP_025237273.1|562546_564811_-	ComEC family protein	NA	Q332C0	Clostridium_botulinum_C_phage	24.3	2.5e-12
WP_000167336.1|565016_565301_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|565460_567134_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000124000.1|567244_567928_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000445276.1|568117_569395_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057156.1|569465_570554_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_010329917.1|571042_572803_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642550.1|573207_574065_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292823.1|574119_576402_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000468308.1|576720_576939_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882969.1|577020_578184_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_001333118.1|578209_578479_+|terminase	terminase	terminase	A0A0F7LCM8	Escherichia_phage	100.0	9.6e-41
WP_000038161.1|578478_579513_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_025237274.1|579858_581691_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_025237275.1|581677_582925_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_025237277.1|585159_585435_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.5e-44
WP_025237278.1|585431_585656_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	95.9	9.4e-34
WP_001277897.1|585655_585958_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_000557703.1|585957_586182_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217681.1|586245_586746_-	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.0e-91
WP_001614686.1|586742_586913_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	2.3e-24
WP_001389237.1|586923_587280_-	hypothetical protein	NA	Q1JS28	Enterobacteria_phage	99.2	1.5e-62
WP_001389238.1|587388_587688_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	100.0	3.0e-51
WP_000023390.1|587781_588777_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	100.0	5.4e-190
WP_025237279.1|588808_589606_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	3.0e-21
WP_001171554.1|589971_590352_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
589784:589801	attR	CTCTGCGCCCTGATCAGC	NA	NA	NA	NA
WP_000612591.1|590348_590696_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|590745_592284_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 3
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	957177	968480	4701875	transposase,protease	Stx2-converting_phage(30.77%)	15	NA	NA
WP_164473239.1|957177_958406_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.5e-177
WP_000998048.1|958517_960056_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|960105_960453_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|960449_960830_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000067727.1|961691_961907_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_113640107.1|961979_962675_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	2.8e-132
WP_001062368.1|962714_963272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968517.1|963268_964021_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000438342.1|964297_964480_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000088203.1|964457_964730_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_001066173.1|964746_965328_-	superinfection exclusion B family protein	NA	K7P6T7	Enterobacteria_phage	92.2	1.5e-91
WP_000213975.1|965541_965742_+	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000392424.1|965801_966251_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	89.3	8.7e-71
WP_001198861.1|968203_968368_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_024178562.1|968336_968480_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	100.0	1.2e-18
>prophage 4
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	1188449	1196314	4701875	transposase,integrase	Shigella_phage(33.33%)	6	1188823:1188837	1199518:1199532
WP_001340136.1|1188449_1188752_-|transposase	IS3 family transposase	transposase	Q716C1	Shigella_phage	98.0	3.2e-45
1188823:1188837	attL	CAAAGCCAGCCGGAA	NA	NA	NA	NA
WP_025237531.1|1189926_1190526_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	9.4e-105
WP_000051894.1|1191234_1192398_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.5	4.5e-228
WP_025237533.1|1192602_1193856_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.2e-96
WP_025237534.1|1193867_1194971_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	1.1e-61
WP_025237535.1|1195258_1196314_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	59.2	2.7e-115
1199518:1199532	attR	TTCCGGCTGGCTTTG	NA	NA	NA	NA
>prophage 5
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	1542620	1556972	4701875	transposase	Shigella_phage(41.18%)	17	NA	NA
WP_025237715.1|1542620_1544207_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	9.1e-30
WP_025237716.1|1544426_1544675_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	97.6	2.7e-37
WP_024176333.1|1545020_1546253_+	hypothetical protein	NA	K7PHS1	Enterobacteria_phage	99.5	1.1e-237
WP_025237718.1|1546781_1547771_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	2.3e-193
WP_077696031.1|1547778_1548210_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH75	Enterobacteria_phage	82.8	1.0e-39
WP_025237720.1|1548130_1549042_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	91.1	2.4e-128
WP_001250269.1|1549031_1549211_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_023993852.1|1549386_1549944_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	2.6e-96
WP_001191669.1|1549936_1550197_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_038430071.1|1550294_1550987_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|1551689_1552052_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081316.1|1552117_1552942_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000008209.1|1553069_1553606_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
WP_001242723.1|1553596_1553959_+	phage protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
WP_000422741.1|1554555_1554981_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|1554977_1555328_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080197.1|1555358_1556972_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.0e-182
>prophage 6
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	1865163	1878323	4701875	tail	Escherichia_phage(26.67%)	15	NA	NA
WP_025237847.1|1865163_1868547_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	72.7	0.0e+00
WP_025237848.1|1868970_1869240_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	98.9	3.8e-45
WP_025237849.1|1869241_1870555_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	2.5e-81
WP_001188051.1|1871392_1871572_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.4	2.7e-15
WP_000514174.1|1871747_1872332_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001231956.1|1872359_1872557_-	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|1872652_1873306_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_000135680.1|1873763_1874126_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001700344.1|1874191_1875016_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	2.3e-149
WP_000008248.1|1875143_1875680_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	2.4e-99
WP_025237851.1|1875670_1876192_+	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	91.0	1.0e-62
WP_021563902.1|1876188_1876677_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	76.8	1.7e-67
WP_025237852.1|1876980_1877553_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	98.9	1.0e-108
WP_001093909.1|1877589_1877862_+	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_000549966.1|1877888_1878323_-	type II toxin-antitoxin system YafO family toxin	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
>prophage 7
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	1948256	1962740	4701875	holin,tail,integrase,transposase	Enterobacteria_phage(42.86%)	17	1942930:1942947	1973759:1973776
1942930:1942947	attL	GCGTTCACGCCGTATCCG	NA	NA	NA	NA
WP_000332264.1|1948256_1949354_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	100.0	4.3e-212
WP_025237847.1|1949707_1953091_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	72.7	0.0e+00
WP_001023417.1|1953514_1953784_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	2.4e-44
WP_025237880.1|1953785_1955111_-|tail	phage tail protein	tail	A0A0P0ZDE7	Stx2-converting_phage	91.4	2.7e-75
WP_025237881.1|1955175_1955775_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.5	7.5e-110
WP_000075132.1|1955923_1956421_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000284515.1|1956420_1956636_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_025237882.1|1957039_1957423_+	hypothetical protein	NA	A5LH60	Enterobacteria_phage	70.5	1.3e-27
WP_000073886.1|1957419_1957731_+	hypothetical protein	NA	A0A2H4N7F8	Pectobacterium_phage	42.6	1.1e-11
WP_025237883.1|1957730_1958303_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	5.1e-108
WP_001093917.1|1958339_1958621_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.8e-43
WP_000654815.1|1958668_1958842_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|1959038_1959572_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
WP_002460756.1|1959936_1960452_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030604.1|1960492_1960702_-	CsbD family protein	NA	NA	NA	NA	NA
WP_025237884.1|1960817_1962143_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000526135.1|1962281_1962740_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
1973759:1973776	attR	CGGATACGGCGTGAACGC	NA	NA	NA	NA
>prophage 8
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	2100633	2188713	4701875	transposase,integrase,plate,tRNA,portal,lysis,protease,terminase,tail	Escherichia_virus(22.64%)	88	2123056:2123102	2152925:2152971
WP_000208242.1|2100633_2101164_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293346.1|2101173_2102505_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	2.2e-45
WP_010342312.1|2102571_2103498_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872905.1|2103590_2104076_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_125060168.1|2104426_2105053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296623.1|2105091_2105337_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084280.1|2105761_2106607_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.4	5.7e-15
WP_000136774.1|2106629_2108138_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_025237944.1|2108335_2109346_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_025237945.1|2109442_2110189_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000323550.1|2110193_2110622_-	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000655995.1|2110633_2110933_-	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000155267.1|2111142_2111583_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000834911.1|2111683_2112283_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216333.1|2112390_2113158_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_025237946.1|2113192_2114482_-	MFS transporter	NA	NA	NA	NA	NA
WP_025237947.1|2114503_2115976_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_025237948.1|2116106_2117237_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	27.0	3.2e-29
WP_000020999.1|2117267_2118533_-	MFS transporter	NA	NA	NA	NA	NA
WP_025237949.1|2118762_2119518_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001099280.1|2119621_2120611_-	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_001355350.1|2120930_2121893_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_025237950.1|2122074_2122977_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2123056:2123102	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|2123213_2123432_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882968.1|2123511_2124675_-	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.4	1.3e-206
WP_025237951.1|2124797_2125283_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	6.5e-80
WP_025237952.1|2125297_2127745_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	99.6	0.0e+00
WP_000785970.1|2127737_2127857_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2127889_2128165_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2128221_2128740_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_025237953.1|2128752_2129943_-|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	99.5	1.1e-224
WP_000014362.1|2130262_2131162_-	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
WP_001164114.1|2131377_2131905_-|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	95.4	1.8e-91
WP_025237954.1|2131908_2133918_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	98.5	0.0e+00
WP_021548487.1|2133928_2134459_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	99.4	2.3e-102
WP_001121497.1|2134451_2135360_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	100.0	1.5e-162
WP_000127163.1|2135364_2135712_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093714.1|2135708_2136344_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.6e-113
WP_025237955.1|2136427_2137213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025237956.1|2137284_2137737_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	1.2e-75
WP_025237957.1|2137729_2138197_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	97.4	3.7e-80
WP_077696047.1|2138159_2138333_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	89.5	2.9e-22
WP_001512906.1|2138304_2138730_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_025237960.1|2139863_2141636_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.5	0.0e+00
WP_000038182.1|2141635_2142670_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.7	2.4e-201
WP_000368931.1|2143085_2144159_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_001350076.1|2144163_2145189_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	3.3e-198
WP_001143634.1|2145185_2146124_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_000554771.1|2146366_2146573_-	hypothetical protein	NA	Q2P9X3	Enterobacteria_phage	97.0	2.4e-31
WP_014640573.1|2146572_2147025_-	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	6.1e-80
WP_025237961.1|2147024_2149310_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	98.7	0.0e+00
WP_000027667.1|2149299_2149575_-	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113264.1|2149571_2149796_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_025237962.1|2149798_2150098_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	93.9	5.6e-42
WP_000557703.1|2150097_2150322_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217671.1|2150385_2150886_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_001005162.1|2150882_2151053_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001308179.1|2151055_2151328_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_016237179.1|2151464_2151758_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	99.0	1.0e-48
WP_025237963.1|2151827_2152808_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.4	2.3e-185
WP_024164685.1|2152994_2153495_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2152925:2152971	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033724.1|2153644_2154346_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580409.1|2154342_2155716_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.2	3.2e-15
WP_025237964.1|2155901_2156108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025237965.1|2156127_2156811_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_002460606.1|2156880_2157501_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.4	1.0e-61
WP_025237966.1|2157764_2158820_-	YiiG family protein	NA	NA	NA	NA	NA
WP_000753603.1|2158973_2159807_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077871465.1|2160000_2163051_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.5	1.1e-07
WP_000331386.1|2163063_2163966_+	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_000829019.1|2163962_2164598_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027704.1|2164594_2165524_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_025237968.1|2166418_2167264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259575.1|2168029_2169844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025237970.1|2170304_2171246_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560979.1|2171290_2171728_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_025237971.1|2171724_2172597_-	virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002460585.1|2172590_2173190_-	glucose-1-phosphatase	NA	NA	NA	NA	NA
WP_000998048.1|2173601_2175140_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2175189_2175537_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2175533_2175914_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_144083443.1|2176091_2177588_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	64.4	2.8e-182
WP_025237974.1|2179154_2182946_+	temperature sensitive hemagglutinin	NA	Q9LA54	Enterobacteria_phage	32.6	4.4e-171
WP_000080197.1|2183409_2185023_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.0e-182
WP_000624722.1|2185053_2185404_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|2185400_2185826_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_114311086.1|2186650_2187819_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.8	1.0e-171
WP_000526135.1|2188254_2188713_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
>prophage 9
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	3133636	3199625	4701875	transposase,tRNA,integrase,protease	Stx2-converting_phage(40.0%)	51	3131106:3131121	3189807:3189822
3131106:3131121	attL	AAAAAGCCCCGGCAAG	NA	NA	NA	NA
WP_025238371.1|3133636_3138190_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_025238372.1|3138388_3139198_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_024164873.1|3139263_3139674_+	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_025238373.1|3139691_3140651_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_025238374.1|3140680_3142741_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_025238375.1|3142740_3144234_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_025238376.1|3144233_3145457_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087299.1|3145473_3145929_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_025238377.1|3145932_3146496_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_025238378.1|3146492_3146864_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_025238379.1|3146860_3147466_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_025238380.1|3147462_3148440_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_025238381.1|3148436_3149615_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_025238382.1|3149616_3150153_+	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
WP_000605492.1|3150239_3151184_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_000677251.1|3151528_3152248_+	amino acid racemase	NA	NA	NA	NA	NA
WP_025238383.1|3152314_3153613_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_164473239.1|3154196_3155424_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.5e-177
WP_025238384.1|3155522_3164459_+	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_001290183.1|3164858_3165701_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001374283.1|3165785_3165983_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000537317.1|3167096_3167849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000192872.1|3167845_3169150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020778.1|3169146_3169872_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_000624722.1|3170477_3170828_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080197.1|3170858_3172472_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.0e-182
WP_000194394.1|3172965_3173541_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_085947598.1|3174726_3175889_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_001218783.1|3176253_3177516_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	1.6e-77
WP_025238387.1|3177894_3178602_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001049796.1|3182500_3183757_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_025238391.1|3183956_3185036_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|3185103_3185379_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_025238392.1|3185406_3186459_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786924.1|3186619_3187339_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107570.1|3187338_3187665_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984785.1|3187847_3188567_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394134.1|3188742_3189789_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_025238393.1|3189905_3190913_+	DUF1202 family protein	NA	NA	NA	NA	NA
3189807:3189822	attR	CTTGCCGGGGCTTTTT	NA	NA	NA	NA
WP_000239934.1|3190977_3192114_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_025238394.1|3192117_3192699_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277225.1|3192706_3192997_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094839.1|3192993_3193560_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_025238395.1|3193577_3194282_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_010336949.1|3194299_3195280_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017099.1|3195463_3195880_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_162147909.1|3195879_3196515_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593300.1|3196551_3197502_-	glutathione synthase	NA	NA	NA	NA	NA
WP_025238397.1|3197514_3198246_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_025238398.1|3198325_3199033_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_002461299.1|3199127_3199625_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 10
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	3256258	3264176	4701875	transposase,tRNA	Stx2-converting_phage(33.33%)	8	NA	NA
WP_025238423.1|3256258_3257992_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	1.1e-60
WP_095522726.1|3258082_3259180_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003076.1|3259190_3260708_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	1.3e-86
WP_025238424.1|3260750_3261299_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_032275372.1|3261420_3261546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|3261759_3262185_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3262181_3262532_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080197.1|3262562_3264176_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.0e-182
>prophage 11
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	3429211	3436352	4701875		Escherichia_phage(83.33%)	6	NA	NA
WP_025238491.1|3429211_3429850_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	2.2e-83
WP_025238492.1|3429846_3431109_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.8	4.1e-134
WP_025238493.1|3431105_3432014_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	75.5	1.9e-117
WP_002461462.1|3432209_3432977_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	1.1e-68
WP_025238494.1|3433027_3433684_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	2.7e-52
WP_025238495.1|3433790_3436352_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	3.5e-31
>prophage 12
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	3466547	3539344	4701875	tail,transposase,tRNA,integrase	Stx2-converting_phage(17.24%)	66	3532248:3532292	3538285:3538329
WP_025238512.1|3466547_3469178_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.8	6.5e-81
WP_000906486.1|3469412_3469598_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273324.1|3470915_3471482_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287448.1|3471478_3471907_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611774.1|3471979_3473536_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130206.1|3473685_3474201_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_000526135.1|3474774_3475233_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001187290.1|3475410_3476949_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_010338431.1|3476965_3478138_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378445.1|3478264_3478795_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_161522614.1|3478765_3478885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119741.1|3478886_3479222_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445627.1|3479211_3479949_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_025238514.1|3480072_3481257_-	MFS transporter	NA	NA	NA	NA	NA
WP_025238515.1|3481449_3482442_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774958.1|3482499_3483561_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_025238516.1|3483553_3484756_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	6.4e-28
WP_025238517.1|3485110_3486070_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	70.8	1.6e-130
WP_025238518.1|3486079_3488224_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	6.4e-196
WP_000053318.1|3488196_3488607_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	43.2	2.1e-18
WP_025238519.1|3488603_3488849_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	36.8	2.2e-07
WP_000209801.1|3489057_3489489_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_025238520.1|3489576_3490911_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_025238521.1|3490966_3491296_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281308.1|3491447_3491792_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492665.1|3491828_3492278_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115372.1|3492948_3493350_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229486.1|3493396_3493921_-	rhodanese family protein	NA	NA	NA	NA	NA
WP_001114364.1|3493930_3494230_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001590556.1|3494412_3494571_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_025238522.1|3494650_3495310_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_025238523.1|3495330_3496731_-	GABA permease	NA	NA	NA	NA	NA
WP_025238524.1|3497239_3498520_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.9	4.2e-33
WP_025238525.1|3498533_3499982_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_025238526.1|3500004_3501273_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993128.1|3501292_3502270_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_025238527.1|3502584_3504801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000866440.1|3506010_3506151_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000812362.1|3506147_3506414_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662203.1|3506875_3506977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144083445.1|3508074_3509001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|3509628_3510009_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3510005_3510353_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3510402_3511941_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000624722.1|3512959_3513310_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080197.1|3513340_3514954_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.0e-182
WP_025238531.1|3515039_3518279_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.5	3.7e-62
WP_001356249.1|3518337_3519531_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	34.7	5.4e-19
WP_000101606.1|3519527_3521075_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	27.6	4.2e-48
WP_000614783.1|3522670_3523567_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000936465.1|3523563_3524460_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_000135615.1|3524449_3526006_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	30.0	3.2e-19
WP_001062342.1|3526288_3527518_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	86.6	4.6e-207
WP_071527343.1|3528435_3528633_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446136.1|3528706_3529279_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_024225804.1|3529715_3530597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162147906.1|3530650_3530824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024225803.1|3530851_3532063_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.6	7.5e-109
3532248:3532292	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_087599366.1|3532416_3533073_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	47.3	1.6e-49
WP_025238534.1|3533611_3534628_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	91.1	4.6e-184
WP_025238535.1|3534630_3535263_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	51.9	3.7e-59
WP_000980384.1|3535782_3536268_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	1.8e-66
WP_025238537.1|3536264_3537365_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.3	1.4e-178
WP_000980501.1|3537433_3537652_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_000391794.1|3537678_3538161_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000162574.1|3538861_3539344_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3538285:3538329	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
>prophage 13
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	3935085	3946595	4701875	tail,integrase	Enterobacteria_phage(57.14%)	9	3926908:3926943	3964668:3964703
3926908:3926943	attL	CGTAGGCCGGATAAGGTGTTTACACCGCATCCGGCA	NA	NA	NA	NA
WP_001281236.1|3935085_3937713_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.2	2.6e-90
WP_025238681.1|3937861_3939559_+	DUF2138 domain-containing protein	NA	NA	NA	NA	NA
WP_025238682.1|3939555_3940182_+	DUF1175 family protein	NA	NA	NA	NA	NA
WP_025238683.1|3940176_3941247_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	97.7	3.2e-196
WP_001444001.1|3941224_3941443_-	excisionase	NA	K7PKU2	Enterobacteria_phage	98.6	2.4e-34
WP_025238684.1|3941843_3942365_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	66.7	2.0e-63
WP_001023380.1|3943452_3943722_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	94.4	7.3e-41
WP_032321283.1|3943931_3944579_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	43.3	1.4e-37
WP_001025664.1|3945272_3946595_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	85.7	2.5e-227
3964668:3964703	attR	CGTAGGCCGGATAAGGTGTTTACACCGCATCCGGCA	NA	NA	NA	NA
>prophage 14
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	4094166	4164780	4701875	transposase,integrase,tRNA,protease,tail	Escherichia_phage(20.0%)	52	4097187:4097202	4109265:4109280
WP_025238739.1|4094166_4096200_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.8	6.6e-57
WP_025238740.1|4096331_4097441_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
4097187:4097202	attL	TGCGGTCATCACGAAC	NA	NA	NA	NA
WP_001046485.1|4097701_4097983_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_025238741.1|4098274_4098817_+	fimbrial protein	NA	NA	NA	NA	NA
WP_025238742.1|4098907_4099582_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_025238743.1|4099597_4102078_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_025238744.1|4102093_4103128_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_025238745.1|4103211_4103550_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_025238746.1|4103767_4104589_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019947.1|4104709_4104982_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001257775.1|4105235_4106543_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000240373.1|4106671_4107397_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000612591.1|4108059_4108407_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_038430133.1|4110255_4110720_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
4109265:4109280	attR	GTTCGTGATGACCGCA	NA	NA	NA	NA
WP_001273871.1|4110886_4111438_-	recombinase family protein	NA	Q2A092	Sodalis_phage	43.9	2.0e-29
WP_164473239.1|4112561_4113789_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	8.5e-177
WP_025238747.1|4114551_4114734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000594465.1|4114880_4115600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000617145.1|4115611_4115857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000141032.1|4116022_4116262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025238748.1|4116608_4117397_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_025238749.1|4117393_4118194_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_025238750.1|4118259_4119075_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	9.4e-23
WP_025238751.1|4119160_4121734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025238752.1|4121730_4124409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025238753.1|4124455_4127140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025238754.1|4127140_4128484_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_000434054.1|4128529_4129276_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025238755.1|4129249_4130215_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846193.1|4130211_4131216_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	27.7	3.4e-14
WP_071825281.1|4132584_4133361_+	cytolethal distending toxin type II subunit CdtA	NA	G1BEM3	Escherichia_phage	93.0	2.8e-125
WP_000759937.1|4133357_4134167_+	cytolethal distending toxin type III/V nuclease subunit CdtB	NA	G1BEM4	Escherichia_phage	95.9	9.7e-145
WP_085947598.1|4134471_4135633_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_071825283.1|4135691_4135988_+	toxin	NA	G1BEM5	Escherichia_phage	94.9	4.3e-50
WP_000129582.1|4137316_4138369_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_025238757.1|4138624_4139629_+	MFS transporter	NA	A0A2L1IV26	Escherichia_phage	100.0	3.4e-06
WP_000476034.1|4141228_4142590_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	98.4	2.3e-215
WP_025238758.1|4142791_4143397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025238759.1|4143457_4143790_-	YegP family protein	NA	NA	NA	NA	NA
WP_025238760.1|4143977_4144700_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	2.9e-31
WP_000675180.1|4144696_4146100_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	4.1e-34
WP_025238761.1|4146096_4147503_-	MFS transporter	NA	NA	NA	NA	NA
WP_025238762.1|4147503_4150581_-	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_025238763.1|4150581_4153704_-	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_025238764.1|4153703_4154951_-	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_144083447.1|4155515_4156683_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	91.5	1.3e-171
WP_001254228.1|4156919_4157102_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001429269.1|4157605_4159441_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_001108084.1|4159964_4160531_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_025238770.1|4162600_4162864_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.0	8.2e-37
WP_025238771.1|4162969_4163851_+	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	91.1	3.2e-149
WP_025238772.1|4164081_4164780_+|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
>prophage 15
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	4175023	4187645	4701875		Bacillus_phage(25.0%)	10	NA	NA
WP_038430135.1|4175023_4176589_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	2.1e-34
WP_000183032.1|4177888_4178782_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_025238777.1|4179151_4180237_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.6	3.3e-100
WP_025238778.1|4180236_4181136_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	9.7e-29
WP_025238779.1|4181193_4182069_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.7	6.2e-105
WP_025238780.1|4182198_4183317_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	68.3	2.8e-134
WP_025238781.1|4183322_4184288_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.5	2.1e-85
WP_137649319.1|4184251_4184752_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_025238783.1|4184815_4186231_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_025238784.1|4186265_4187645_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	27.3	6.7e-29
>prophage 16
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	4244551	4266438	4701875	holin,transposase,integrase	Stx2-converting_phage(40.0%)	26	4247718:4247777	4261674:4261911
WP_000998048.1|4244551_4246090_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001243632.1|4246139_4246433_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.5e-50
WP_144083449.1|4247677_4247884_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.6	1.8e-26
4247718:4247777	attL	AACAGATTGGCGTTAATGCCATTTTCAAGAGCAAGTTTTGAGATGGATATCCCGGGTTCA	NA	NA	NA	NA
WP_024164886.1|4248514_4249312_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533621.1|4249547_4250573_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	58.2	4.0e-103
WP_000096345.1|4250572_4250776_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_025238825.1|4250834_4253306_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.7	2.9e-59
WP_001090200.1|4253398_4253590_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|4253586_4253775_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001570019.1|4254100_4254466_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.3	6.0e-38
WP_000640017.1|4254474_4255017_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.9e-72
WP_000917767.1|4255248_4255446_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611208.1|4255596_4256646_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.8	1.8e-183
WP_000562553.1|4257444_4257576_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_051419185.1|4257823_4258192_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	7.4e-44
WP_025238826.1|4258492_4258858_+|transposase	transposase	transposase	Q76S41	Shigella_phage	99.2	9.6e-60
WP_053897820.1|4260662_4260878_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_000138558.1|4261133_4261406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|4261587_4261968_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
4261674:4261911	attR	TGAACCCGGGATATCCATCTCAAAACTTGCTCTTGAAAATGGCATTAACGCCAATCTGTTGTTCAAATGGCGACAACAATGGCGCGAGGGAAAGCTGCTATTACCTTCTTCAGAGAGCCCCCAGCTACTTCCTGTGACTCTCGATGCAGCTGCCGAACAGCCAGAATCGCTCGCAGAGGACCCGGAAACCCTCAGTATCAGCTGTGAGGTAACGTTCCGGCACGGGACGCTCCGCTTC	NA	NA	NA	NA
WP_000612591.1|4261964_4262312_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|4262361_4263900_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001003118.1|4264015_4264549_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|4264769_4264883_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|4265104_4265290_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|4265817_4266132_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001300236.1|4266213_4266438_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
>prophage 17
NZ_CP007025	Escherichia albertii KF1 chromosome, complete genome	4701875	4624718	4665902	4701875	tail,integrase,protease,transposase	Escherichia_phage(25.0%)	40	4614874:4614889	4650638:4650653
4614874:4614889	attL	TACAGCAGGAGGAGTA	NA	NA	NA	NA
WP_001260873.1|4624718_4625540_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4625639_4625723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077696109.1|4625815_4626091_-	acid resistance repetitive basic protein Asr	NA	NA	NA	NA	NA
WP_000091864.1|4626515_4627769_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019580.1|4627875_4628769_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025238980.1|4628903_4630124_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919219.1|4630249_4630945_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071586023.1|4630897_4632190_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148727.1|4632345_4632960_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	37.8	2.3e-29
WP_000526527.1|4633002_4633860_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213046.1|4633861_4634479_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	9.5e-76
WP_077696110.1|4634489_4636913_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	8.3e-208
WP_000041712.1|4636975_4639402_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	5.2e-210
WP_000857964.1|4639645_4639951_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_095575737.1|4640058_4640769_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_025238982.1|4640771_4641341_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001066433.1|4641375_4641717_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_002462117.1|4641851_4642178_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	53.5	1.7e-23
WP_025238983.1|4642374_4643589_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.8e-46
WP_025238984.1|4643602_4644622_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.7	1.1e-17
WP_072131185.1|4644679_4644787_+	transporter	NA	NA	NA	NA	NA
WP_025238985.1|4644809_4646105_-|integrase	site-specific integrase	integrase	Q20GI2	Phage_258-320	61.7	1.8e-153
WP_000005552.1|4646124_4646376_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_077696112.1|4646445_4648353_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	63.0	4.6e-60
WP_077696087.1|4648853_4649036_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	76.3	7.2e-16
WP_025238988.1|4649415_4649820_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	50.4	1.4e-30
WP_000349501.1|4650162_4650654_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	86.6	6.6e-72
4650638:4650653	attR	TACAGCAGGAGGAGTA	NA	NA	NA	NA
WP_038430145.1|4652830_4653574_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.8	4.4e-152
WP_158412315.1|4653537_4653687_+	hypothetical protein	NA	A5LH42	Enterobacteria_phage	84.4	8.5e-15
WP_071825352.1|4653644_4653746_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	93.9	1.7e-11
WP_122988840.1|4653856_4653934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001429305.1|4653955_4654546_+	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	57.8	2.0e-22
WP_025238993.1|4654595_4656968_+	type III secretion system effector HECT-type E3 ubiquitin transferase	NA	NA	NA	NA	NA
WP_167330639.1|4657613_4658842_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	4.8e-172
WP_001120551.1|4659915_4660158_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000080197.1|4660406_4662020_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.8	1.0e-182
WP_025238996.1|4662050_4662401_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_000422741.1|4662397_4662823_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_025238998.1|4664202_4665663_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	4.6e-44
WP_000214712.1|4665698_4665902_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
