The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP004003	Burkholderia pseudomallei NAU20B-16 chromosome 1, complete sequence	4067895	40797	119572	4067895	lysis,integrase,head,holin,capsid,tail,portal,terminase	Burkholderia_virus(91.43%)	92	60811:60859	119702:119750
WP_038723436.1|40797_41043_+|integrase	tyrosine-type recombinase/integrase	integrase	A4PE72	Ralstonia_virus	73.2	3.2e-19
WP_038718123.1|45205_45466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038718126.1|45576_45795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128972816.1|46504_47050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009970413.1|47161_47752_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	41.1	7.5e-22
WP_009970412.1|48315_49134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_128972815.1|49306_50098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004521810.1|50819_51650_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_004521811.1|52197_53106_+	aldose 1-epimerase	NA	NA	NA	NA	NA
WP_038723439.1|53402_54104_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	39.3	1.4e-11
WP_004531123.1|54181_54355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004192280.1|54366_54480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193897.1|54459_56085_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	35.4	2.3e-68
WP_004192567.1|56349_56667_+	DUF2288 domain-containing protein	NA	NA	NA	NA	NA
WP_004531119.1|56674_58066_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_004531118.1|58327_58519_-	lipoprotein	NA	NA	NA	NA	NA
WP_004191316.1|58686_58857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004266561.1|59189_60008_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004550641.1|60159_60618_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
60811:60859	attL	CTGATTTGGGATCAGAGGGTCGTAGGTTCGAATCCTATCGCTCCGACCA	NA	NA	NA	NA
WP_038723840.1|61056_61728_-	SOS response-associated peptidase family protein	NA	Q8W6R8	Burkholderia_virus	96.4	5.9e-132
WP_038723440.1|61813_62455_+	hypothetical protein	NA	Q8W6R9	Burkholderia_virus	99.5	1.2e-118
WP_038723441.1|62587_63679_-	DUF3396 domain-containing protein	NA	Q8W6S0	Burkholderia_virus	99.4	7.2e-212
WP_004552924.1|63706_64441_-	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	100.0	3.6e-138
WP_076882068.1|64437_64998_-	PAAR domain-containing protein	NA	A4JX23	Burkholderia_virus	98.9	1.8e-102
WP_038723442.1|65179_66106_-	hypothetical protein	NA	C7BGE2	Burkholderia_phage	53.9	3.0e-73
WP_038723443.1|66214_67003_-	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	97.7	5.5e-153
WP_038723444.1|67145_67691_-|lysis	lysis protein	lysis	A4JX21	Burkholderia_virus	87.8	1.7e-76
WP_038723445.1|67690_68182_-	lysozyme	NA	Q6JIK8	Burkholderia_virus	96.9	2.1e-86
WP_004552929.1|68174_68387_-|holin	class II holin gp23	holin	Q8W6S7	Burkholderia_virus	100.0	6.6e-29
WP_038723446.1|68429_69173_-	hypothetical protein	NA	Q8W6S8	Burkholderia_virus	71.6	2.1e-101
WP_080278171.1|69172_69439_-	hypothetical protein	NA	Q8W6S9	Burkholderia_virus	75.0	2.4e-36
WP_038723447.1|69477_72789_-|tail	phage tail protein	tail	Q6JIL2	Burkholderia_virus	98.0	0.0e+00
WP_004526680.1|72785_73370_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	99.5	6.8e-100
WP_038723448.1|73366_74119_-	C40 family peptidase	NA	Q6JIL4	Burkholderia_virus	98.4	8.7e-148
WP_004549626.1|74168_74852_-|tail	phage minor tail protein L	tail	Q8W6T3	Burkholderia_virus	96.0	3.7e-129
WP_038723450.1|74848_76237_-|tail	tail fiber domain-containing protein	tail	Q6JIL6	Burkholderia_virus	94.4	7.0e-260
WP_004548805.1|76245_76584_-|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	100.0	8.0e-61
WP_038723451.1|76580_80645_-|tail	phage tail tape measure protein	tail	Q6JIL8	Burkholderia_virus	99.7	0.0e+00
WP_004526674.1|80658_80943_-	DUF4035 domain-containing protein	NA	Q6JIL9	Burkholderia_virus	100.0	6.8e-45
WP_004548907.1|80942_81407_-|tail	tail assembly protein	tail	A4JX08	Burkholderia_virus	100.0	2.4e-84
WP_004549350.1|81433_81889_-	hypothetical protein	NA	A4JX07	Burkholderia_virus	100.0	7.5e-78
WP_015984957.1|81950_82298_-	hypothetical protein	NA	A4JX06	Burkholderia_virus	100.0	3.5e-59
WP_024429290.1|82294_82717_-	HK97 gp10 family phage protein	NA	A4JX05	Burkholderia_virus	99.3	1.0e-68
WP_024429289.1|82709_83036_-|head	phage head closure protein	head	A4JX04	Burkholderia_virus	87.0	1.8e-49
WP_038723452.1|83035_83602_-	hypothetical protein	NA	A4JX03	Burkholderia_virus	71.8	1.6e-74
WP_024429287.1|83608_83794_-	hypothetical protein	NA	A4JX02	Burkholderia_virus	62.3	6.2e-15
WP_038723454.1|83854_85162_-|capsid	phage major capsid protein	capsid	A4JX01	Burkholderia_virus	82.5	1.3e-194
WP_038723455.1|85263_86232_-	S49 family peptidase	NA	A4JX00	Burkholderia_virus	96.9	5.0e-164
WP_038723456.1|86228_87488_-|portal	phage portal protein	portal	A4JWZ9	Burkholderia_virus	99.5	2.5e-240
WP_015984952.1|87492_87678_-	hypothetical protein	NA	A4JWZ8	Burkholderia_virus	100.0	2.0e-21
WP_038723457.1|87674_89390_-|terminase	terminase large subunit	terminase	A4JWZ7	Burkholderia_virus	99.8	0.0e+00
WP_004549538.1|89393_89870_-|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	99.4	2.1e-86
WP_004548856.1|90021_90378_-	HNH endonuclease	NA	Q8W6N0	Burkholderia_virus	100.0	3.3e-65
WP_004549735.1|90436_90694_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q8W6N1	Burkholderia_virus	100.0	2.4e-41
WP_004548635.1|90690_91077_+	helix-turn-helix transcriptional regulator	NA	Q8W6N2	Burkholderia_virus	99.2	1.4e-64
WP_080278149.1|91672_92656_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_076882155.1|93153_94320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080278150.1|94255_96010_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_076882153.1|95985_96471_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_038723459.1|96808_97456_-	hypothetical protein	NA	Q8W6N4	Burkholderia_virus	90.7	3.3e-103
WP_038723461.1|98035_98461_-	DUF1364 family protein	NA	Q6JIF7	Burkholderia_virus	99.3	1.3e-79
WP_038723462.1|98457_98832_-	hypothetical protein	NA	Q6JIF8	Burkholderia_virus	98.4	2.1e-62
WP_172644498.1|98828_99296_-	DUF1064 domain-containing protein	NA	Q6JIF9	Burkholderia_virus	91.6	2.9e-77
WP_038723465.1|99340_100333_-	hypothetical protein	NA	A4JX55	Burkholderia_virus	99.1	3.4e-176
WP_004526650.1|100486_100747_-	helix-turn-helix domain-containing protein	NA	Q6JIG2	Burkholderia_virus	100.0	4.2e-41
WP_038723466.1|100743_101565_-	hypothetical protein	NA	Q8W6P2	Burkholderia_virus	99.6	2.3e-146
WP_024429365.1|101599_102562_-	phosphoadenosine phosphosulfate reductase family protein	NA	A9YWY5	Burkholderia_phage	99.3	3.5e-170
WP_024429366.1|102999_103314_+	DUF4145 domain-containing protein	NA	A4JX50	Burkholderia_virus	98.1	1.6e-50
WP_038723467.1|103460_103901_-	phage regulatory CII family protein	NA	Q8W6P5	Burkholderia_virus	90.4	9.4e-70
WP_021251775.1|104086_104341_+	hypothetical protein	NA	Q8W6P6	Burkholderia_virus	98.8	9.4e-38
WP_038764272.1|104570_104903_-	hypothetical protein	NA	Q6JIG8	Burkholderia_virus	96.4	8.4e-55
WP_004552953.1|105019_105334_-	helix-turn-helix domain-containing protein	NA	Q6JIG9	Burkholderia_virus	100.0	3.0e-54
WP_004552954.1|105577_105799_+	hypothetical protein	NA	Q6JIH0	Burkholderia_virus	98.6	3.3e-31
WP_038723468.1|105795_106059_-	hypothetical protein	NA	Q6JIH1	Burkholderia_virus	98.9	3.2e-41
WP_004552955.1|106142_107432_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	100.0	1.5e-235
WP_004526641.1|107586_108480_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	99.3	4.3e-170
WP_038723469.1|108981_109257_+	hypothetical protein	NA	Q8W6Q1	Burkholderia_virus	97.8	2.3e-42
WP_038723472.1|109610_110225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172644481.1|110305_110623_+	hypothetical protein	NA	Q6JII2	Burkholderia_virus	97.1	2.5e-48
WP_038723473.1|110619_111432_+	prohibitin family protein	NA	Q8W6Q7	Burkholderia_virus	98.9	2.2e-144
WP_038723475.1|111705_112413_+	hypothetical protein	NA	Q6JII4	Burkholderia_virus	91.1	7.2e-120
WP_038717937.1|112426_113098_+	hypothetical protein	NA	Q6JII5	Burkholderia_virus	96.4	7.5e-119
WP_080124839.1|113358_113577_+	hypothetical protein	NA	Q6JII7	Burkholderia_virus	98.6	1.0e-32
WP_004526632.1|114781_115039_+	hypothetical protein	NA	Q6JIJ0	Burkholderia_virus	100.0	1.7e-42
WP_015973597.1|115031_115274_+	hypothetical protein	NA	Q6JIJ1	Burkholderia_virus	100.0	1.9e-40
WP_038725203.1|115263_115602_+	hypothetical protein	NA	Q6JIJ2	Burkholderia_virus	98.2	2.9e-58
WP_038723477.1|115598_116546_+	phage Gp37/Gp68 family protein	NA	Q6JIJ3	Burkholderia_virus	62.3	1.9e-107
WP_038723479.1|116536_116779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723481.1|117165_117435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723482.1|117686_117896_-	hypothetical protein	NA	Q6JIJ5	Burkholderia_virus	91.3	2.4e-31
WP_004526625.1|118247_118472_+	DUF4224 domain-containing protein	NA	Q6JIJ7	Burkholderia_virus	100.0	2.9e-35
WP_004526624.1|118471_119572_+|integrase	tyrosine-type recombinase/integrase	integrase	Q6JIJ8	Burkholderia_virus	100.0	5.4e-215
119702:119750	attR	CTGATTTGGGATCAGAGGGTCGTAGGTTCGAATCCTATCGCTCCGACCA	NA	NA	NA	NA
>prophage 2
NZ_CP004003	Burkholderia pseudomallei NAU20B-16 chromosome 1, complete sequence	4067895	673100	684064	4067895	protease	Agrobacterium_phage(16.67%)	10	NA	NA
WP_004196461.1|673100_675401_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.1e-167
WP_004194131.1|675397_675712_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	44.6	4.4e-13
WP_004196460.1|676244_676448_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	81.8	6.8e-23
WP_038723578.1|676577_678194_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_004189626.1|678206_678389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004189552.1|678361_679621_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	63.0	5.2e-12
WP_004189780.1|679888_680467_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_071810810.1|680729_680948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185496.1|681139_681649_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	5.5e-13
WP_004197486.1|681949_684064_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	5.8e-56
>prophage 3
NZ_CP004003	Burkholderia pseudomallei NAU20B-16 chromosome 1, complete sequence	4067895	1750770	1761998	4067895	integrase	Burkholderia_virus(22.22%)	10	1748184:1748201	1764777:1764794
1748184:1748201	attL	CGCGGCGAGCGCGTCGAG	NA	NA	NA	NA
WP_038722961.1|1750770_1752858_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.8	3.2e-99
WP_004202928.1|1753180_1754080_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_004553012.1|1755262_1755850_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	50.0	9.1e-44
WP_024430280.1|1756229_1756547_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	57.0	3.7e-15
WP_004530410.1|1756546_1757464_+	DUF4935 domain-containing protein	NA	A4PE40	Ralstonia_virus	40.6	4.0e-46
WP_009922654.1|1757717_1758260_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	56.4	3.3e-48
WP_009932249.1|1758517_1758970_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	58.8	2.3e-31
WP_038723776.1|1758969_1760049_+	DUF3396 domain-containing protein	NA	A9YX32	Burkholderia_phage	98.3	1.4e-159
WP_004525721.1|1760205_1760454_+	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	97.6	4.0e-41
WP_004195754.1|1761353_1761998_+	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	30.4	5.7e-07
1764777:1764794	attR	CTCGACGCGCTCGCCGCG	NA	NA	NA	NA
>prophage 4
NZ_CP004003	Burkholderia pseudomallei NAU20B-16 chromosome 1, complete sequence	4067895	1941500	1994392	4067895	protease,plate,transposase	Burkholderia_phage(33.33%)	55	NA	NA
WP_004196743.1|1941500_1942214_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011852289.1|1942504_1947208_+	glutamate synthase subunit alpha	NA	NA	NA	NA	NA
WP_004521924.1|1947301_1948768_+	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_004521925.1|1949048_1950560_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_004521926.1|1950556_1951117_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_004527892.1|1951314_1953081_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_004521927.1|1953683_1954817_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004521928.1|1954865_1955063_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_004199935.1|1955115_1955931_+	thiazole synthase	NA	NA	NA	NA	NA
WP_004521929.1|1955927_1957031_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_004521930.1|1957130_1957949_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.4	3.4e-20
WP_004199929.1|1957945_1958713_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_004521931.1|1958725_1959301_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_004521932.1|1959348_1960308_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_004521933.1|1960422_1961055_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004199923.1|1961051_1961321_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_004554063.1|1961616_1962543_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.7	2.0e-21
WP_004199919.1|1962539_1963295_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004199917.1|1963380_1963620_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004521935.1|1963633_1964983_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_038722992.1|1964979_1965636_+	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_004527888.1|1965677_1967015_+	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_004521936.1|1967170_1968241_+	histidinol-phosphate transaminase	NA	A0A1X7BZP2	Faustovirus	26.9	5.6e-15
WP_004199911.1|1968304_1968892_+	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_004199909.1|1968947_1969568_+	YchE family NAAT transporter	NA	NA	NA	NA	NA
WP_004199907.1|1969564_1970206_+	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_004199906.1|1970373_1971129_+	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_004557290.1|1971211_1971985_+	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_004201279.1|1971984_1972398_+	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_004202813.1|1972394_1972763_+	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_004202812.1|1972815_1973205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004185206.1|1973233_1973599_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_038722994.1|1973687_1973921_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_004531855.1|1973947_1974475_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_004199900.1|1974513_1975296_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.7	8.7e-26
WP_038722996.1|1975640_1976849_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	31.9	8.5e-12
WP_004202811.1|1976870_1977617_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_004204996.1|1977837_1978458_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_004199894.1|1978458_1979841_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_004521940.1|1979863_1980622_+	cytochrome c1	NA	NA	NA	NA	NA
WP_004185176.1|1980714_1981326_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004199890.1|1981395_1981917_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	51.0	1.9e-21
WP_038723778.1|1982610_1982937_+|plate	baseplate assembly protein	plate	K4NZR5	Burkholderia_phage	98.1	3.3e-51
WP_076882245.1|1983238_1983841_+	site-specific DNA-methyltransferase	NA	K4NZW3	Burkholderia_phage	88.5	1.9e-81
WP_111952238.1|1984237_1984828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009922432.1|1984931_1985297_-	phage virion morphogenesis protein	NA	K4NZQ8	Burkholderia_phage	89.3	1.1e-52
WP_004521948.1|1985398_1986184_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_038722998.1|1986180_1987527_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_038723000.1|1987635_1988250_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004531875.1|1988624_1989296_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_004521952.1|1989332_1989851_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004521953.1|1989867_1991358_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004527837.1|1991430_1991934_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004204912.1|1991991_1992474_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_038723001.1|1992553_1994392_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 5
NZ_CP004003	Burkholderia pseudomallei NAU20B-16 chromosome 1, complete sequence	4067895	2323215	2332460	4067895		Hokovirus(16.67%)	7	NA	NA
WP_004194034.1|2323215_2325168_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	49.2	2.7e-148
WP_004522147.1|2325434_2326565_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.6	1.7e-22
WP_038723056.1|2326598_2328605_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	S4VT78	Pandoravirus	35.0	1.9e-53
WP_004194137.1|2328788_2329604_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.8e-37
WP_004532195.1|2329668_2330352_-	deoxynucleoside kinase	NA	A0A249XZR7	Enterococcus_phage	26.0	2.0e-05
WP_004194373.1|2330348_2330876_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_004522151.1|2330912_2332460_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	31.2	4.3e-24
>prophage 6
NZ_CP004003	Burkholderia pseudomallei NAU20B-16 chromosome 1, complete sequence	4067895	2667779	2676662	4067895		Bacillus_phage(16.67%)	8	NA	NA
WP_004522358.1|2667779_2669180_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.5	1.9e-79
WP_009921652.1|2669211_2670135_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.1	1.3e-15
WP_004190173.1|2670193_2671186_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	30.9	9.1e-28
WP_004189725.1|2671257_2671575_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004532363.1|2671956_2672859_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	39.9	1.9e-53
WP_038723131.1|2673085_2674375_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_004188957.1|2674553_2675477_+	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	36.5	8.4e-44
WP_063831528.1|2675819_2676662_-	alpha/beta hydrolase	NA	A7XCB7	Tanapox_virus	27.2	7.2e-18
>prophage 7
NZ_CP004003	Burkholderia pseudomallei NAU20B-16 chromosome 1, complete sequence	4067895	2974515	2984806	4067895	lysis,integrase	Burkholderia_phage(33.33%)	11	2971716:2971731	2980886:2980901
2971716:2971731	attL	GCCGCCGCGTCGGCGG	NA	NA	NA	NA
WP_038723190.1|2974515_2977200_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	24.3	9.3e-27
WP_038723191.1|2977359_2978661_+|integrase	integrase family protein	integrase	C7BGE7	Burkholderia_phage	58.9	6.1e-149
WP_009890227.1|2978611_2978854_-	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	59.2	9.3e-19
WP_038723806.1|2978862_2979336_-	hypothetical protein	NA	B5TA88	Burkholderia_phage	71.4	3.0e-05
WP_038723193.1|2979344_2979674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723808.1|2980684_2981230_+|lysis	lysis protein	lysis	Q8W6S5	Burkholderia_virus	96.1	4.1e-83
2980886:2980901	attR	GCCGCCGCGTCGGCGG	NA	NA	NA	NA
WP_038723194.1|2981373_2982162_+	DNA adenine methylase	NA	Q8W6S4	Burkholderia_virus	97.3	1.0e-151
WP_004539736.1|2982202_2982913_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	41.5	1.4e-38
WP_172644489.1|2982924_2983593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080278160.1|2983877_2984384_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	39.7	3.3e-18
WP_004539640.1|2984380_2984806_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
>prophage 8
NZ_CP004003	Burkholderia pseudomallei NAU20B-16 chromosome 1, complete sequence	4067895	3198548	3206736	4067895		Burkholderia_virus(50.0%)	13	NA	NA
WP_004196630.1|3198548_3198812_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.5	2.2e-26
WP_076804731.1|3198795_3198981_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	85.2	4.4e-21
WP_038723235.1|3199001_3199727_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	44.0	5.8e-32
WP_038763587.1|3199733_3200336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063832618.1|3200677_3201184_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	40.1	3.0e-19
WP_012729878.1|3201180_3201603_-	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	4.9e-15
WP_004557051.1|3201883_3202279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004531416.1|3202532_3202760_+	hypothetical protein	NA	Q8W6S4	Burkholderia_virus	75.8	3.8e-22
WP_004521250.1|3202795_3203044_-	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	60.6	4.6e-13
WP_004550288.1|3203104_3203566_-	avidin	NA	NA	NA	NA	NA
WP_004534930.1|3204499_3204682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004193371.1|3204808_3205432_-	phospholipase D family protein	NA	NA	NA	NA	NA
WP_004192901.1|3205626_3206736_-	class II histone deacetylase	NA	A0A2K9L2T7	Tupanvirus	31.0	7.8e-36
>prophage 9
NZ_CP004003	Burkholderia pseudomallei NAU20B-16 chromosome 1, complete sequence	4067895	3986056	4058751	4067895	plate,tRNA,coat,transposase	Klosneuvirus(14.29%)	55	NA	NA
WP_004542503.1|3986056_3988681_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.2	5.5e-80
WP_038723393.1|3989207_3990428_+	CoA transferase	NA	NA	NA	NA	NA
WP_004196731.1|3990767_3991007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193654.1|3991256_3992966_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	57.5	8.8e-188
WP_004552886.1|3993309_3993792_-	NUDIX hydrolase	NA	A0A2I6PFL2	Proteus_phage	41.3	1.7e-19
WP_004545113.1|3993810_3994197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012730066.1|3994484_3996584_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_004521728.1|3996685_3997546_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_028359092.1|3997589_3999023_-	cytochrome-c peroxidase	NA	NA	NA	NA	NA
WP_004193177.1|3999256_4000840_+	acid phosphatase	NA	NA	NA	NA	NA
WP_004538373.1|4001037_4002231_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_038723394.1|4002854_4004042_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_038723395.1|4004223_4005843_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_038723396.1|4005844_4007554_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004192810.1|4007856_4008489_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_038723397.1|4008489_4010571_-	response regulator	NA	A0A1V0SGR3	Hokovirus	26.8	1.7e-12
WP_004196717.1|4010981_4011947_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_038723398.1|4011962_4014374_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_038723400.1|4014418_4015258_-	molecular chaperone	NA	NA	NA	NA	NA
WP_004526783.1|4015275_4015800_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004526782.1|4015876_4016437_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004538378.1|4016489_4017035_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_004531175.1|4017295_4017517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196705.1|4017862_4018756_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_038723401.1|4019199_4020459_+	MFS transporter	NA	NA	NA	NA	NA
WP_038723402.1|4020503_4021487_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_004193855.1|4021954_4022236_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_009927991.1|4022498_4022771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004554454.1|4023664_4024978_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_038723403.1|4025237_4026158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071897650.1|4026817_4027312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052139777.1|4028386_4028833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723406.1|4029114_4029375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009951519.1|4029589_4029757_+	hypothetical protein	NA	A0A0P0ZBS5	Stx2-converting_phage	50.0	9.5e-07
WP_076851597.1|4030329_4031043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076882428.1|4031965_4032259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004526764.1|4032599_4032845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128972818.1|4032888_4033797_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_004526762.1|4033754_4034006_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_038723408.1|4035173_4038017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723410.1|4038013_4038889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038723411.1|4038890_4041731_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.9	2.8e-21
WP_004521762.1|4041743_4042049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021251390.1|4042066_4042309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004521767.1|4043398_4043890_-	lipoprotein	NA	NA	NA	NA	NA
WP_009973662.1|4043867_4047203_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_038723412.1|4047311_4049720_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_009943538.1|4049716_4050310_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_038723414.1|4050306_4050864_-	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_012730392.1|4051000_4051834_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_038723415.1|4051836_4054647_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.0	5.7e-27
WP_004521773.1|4054680_4054908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009920929.1|4055167_4055434_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004521774.1|4055457_4056873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004542513.1|4056900_4058751_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 1
NZ_CP004004	Burkholderia pseudomallei NAU20B-16 chromosome 2, complete sequence	3245956	494666	535625	3245956	transposase,plate	Burkholderia_virus(20.0%)	31	NA	NA
WP_076612195.1|494666_495824_+|transposase	IS3-like element ISBps2 family transposase	transposase	A4JX31	Burkholderia_virus	99.3	5.0e-78
WP_004552203.1|496071_496986_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004524799.1|497167_497872_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004190854.1|498343_498520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041188034.1|498568_498886_-	chorismate lyase	NA	NA	NA	NA	NA
WP_076882215.1|498822_499125_-	chorismate lyase	NA	NA	NA	NA	NA
WP_038766358.1|499197_500442_-	flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004524802.1|500707_500893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038774110.1|500911_502816_+	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_041188033.1|502858_504292_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004190377.1|504346_504748_-	TssQ family T6SS-associated lipoprotein	NA	NA	NA	NA	NA
WP_004190712.1|505387_505906_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004530163.1|505902_507306_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004190689.1|507321_508638_+	DotU family type VI secretion system protein	NA	NA	NA	NA	NA
WP_004529327.1|508640_512270_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_161934887.1|512251_513274_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_038783694.1|513258_513486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041188031.1|513484_516079_+	serine/threonine protein kinase	NA	M1I231	Acanthocystis_turfacea_Chlorella_virus	26.6	5.0e-09
WP_004190988.1|516131_517211_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004524810.1|517273_517852_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004190849.1|517844_519353_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004190698.1|519412_519904_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_004196148.1|519922_520483_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_038728075.1|520487_522359_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_102812242.1|522355_523813_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004539258.1|523825_526492_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	1.4e-78
WP_038758213.1|526488_528693_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.9	9.6e-46
WP_038758212.1|528708_529419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071811398.1|532369_532657_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_076847189.1|532667_533819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102607710.1|534445_535625_+|transposase	IS3-like element ISBps1 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	8.2e-60
>prophage 2
NZ_CP004004	Burkholderia pseudomallei NAU20B-16 chromosome 2, complete sequence	3245956	2616233	2684062	3245956	holin,plate	Aeromonas_phage(25.0%)	48	NA	NA
WP_004530063.1|2616233_2617184_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_004523149.1|2617451_2618396_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_041188170.1|2618867_2620571_+	peptidase	NA	NA	NA	NA	NA
WP_004530059.1|2620688_2621915_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_021252053.1|2621969_2623112_-	porin	NA	NA	NA	NA	NA
WP_004198249.1|2623220_2623343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041188169.1|2623339_2624377_-|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_041188363.1|2624373_2625927_-|holin	choline-sulfatase	holin	NA	NA	NA	NA
WP_004554841.1|2626089_2626962_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004186920.1|2627105_2627981_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_004523142.1|2628067_2629723_-	APC family permease	NA	NA	NA	NA	NA
WP_004523141.1|2629903_2630767_-	glycine betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_038769379.1|2630876_2632022_-	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004523139.1|2632042_2633311_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_004530055.1|2633335_2634121_-	drug:proton antiporter	NA	NA	NA	NA	NA
WP_004202150.1|2634117_2635290_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_041188168.1|2635294_2637220_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004186960.1|2637222_2639286_-	NADH:flavin oxidoreductase	NA	NA	NA	NA	NA
WP_004186987.1|2639346_2639880_-	4-vinyl reductase	NA	NA	NA	NA	NA
WP_004186989.1|2640030_2641002_-	membrane dipeptidase	NA	NA	NA	NA	NA
WP_004545861.1|2641074_2642349_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	5.3e-105
WP_161630907.1|2642484_2642769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004198247.1|2642782_2643808_+	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004523135.1|2643985_2645185_-	formaldehyde dehydrogenase, glutathione-independent	NA	A0A2K9L7I1	Tupanvirus	27.2	8.4e-12
WP_004523134.1|2645635_2646652_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_041188167.1|2646937_2648422_+	glycoside hydrolase family 68 protein	NA	NA	NA	NA	NA
WP_038756008.1|2648554_2650219_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	31.6	5.4e-57
WP_004186853.1|2650804_2652058_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_041225001.1|2652796_2654380_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_004532079.1|2654376_2654559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038776723.1|2654684_2655680_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_004524288.1|2659053_2659953_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004536812.1|2660503_2660779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190471.1|2661099_2661525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004190863.1|2661547_2661907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004525554.1|2661965_2665469_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_004525553.1|2665465_2667124_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004525552.1|2667206_2668568_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004202226.1|2668564_2669158_-	type VI secretion lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004190606.1|2669163_2669553_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_004525551.1|2669595_2670312_-	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_004525550.1|2670314_2671385_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004547074.1|2671384_2673601_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_004190563.1|2673604_2675893_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004525548.1|2676058_2678350_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_041188165.1|2678340_2681211_-	type VI secretion system ATPase TssH	NA	A0A2I7REQ1	Vibrio_phage	27.2	1.8e-60
WP_004190851.1|2681213_2682203_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004196180.1|2682199_2684062_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP004004	Burkholderia pseudomallei NAU20B-16 chromosome 2, complete sequence	3245956	2847734	2854727	3245956	transposase	Burkholderia_virus(50.0%)	8	NA	NA
WP_004525420.1|2847734_2848019_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	50.0	1.4e-10
WP_009939402.1|2848002_2848176_-	BrnT family toxin	NA	NA	NA	NA	NA
WP_009975384.1|2848843_2849119_+	hypothetical protein	NA	Q6JIH4	Burkholderia_virus	95.6	2.6e-41
WP_029248167.1|2849395_2849617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161788725.1|2849583_2849883_+	hypothetical protein	NA	Q6JIH9	Burkholderia_virus	100.0	2.3e-35
WP_004542548.1|2850113_2850695_-	hypothetical protein	NA	A9YX38	Burkholderia_phage	100.0	2.2e-21
WP_004537646.1|2850950_2851100_+	bacteriophage protein Gp44	NA	Q8W6Q6	Burkholderia_virus	100.0	3.3e-19
WP_102812295.1|2853607_2854727_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.0	8.1e-49
