The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011966	Clostridium beijerinckii NRRL B-598, complete genome	6186879	422061	484932	6186879	coat,protease	Clostridium_phage(13.33%)	58	NA	NA
WP_017210071.1|422061_423078_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_023974835.1|423079_423886_+|coat	spore coat protein	coat	NA	NA	NA	NA
WP_023974836.1|423941_424997_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_011967735.1|425316_426438_-	glycosyltransferase family 1 protein	NA	A0A1X9SJR9	Sulfolobus_islandicus_rod-shaped_virus	27.9	1.4e-05
WP_011967736.1|426546_427545_+|coat	CotS family spore coat protein	coat	NA	NA	NA	NA
WP_011967737.1|427707_428568_+	sporulation peptidase YabG	NA	NA	NA	NA	NA
WP_011967738.1|428806_429346_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_011967739.1|429961_430204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023974837.1|430667_432230_+	peptidoglycan-binding protein	NA	S6BFI4	Thermus_phage	59.5	2.0e-05
WP_017209901.1|432349_432553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011967741.1|432559_433405_+	cyanophycinase	NA	NA	NA	NA	NA
WP_023974838.1|433376_436019_+	cyanophycin synthetase	NA	NA	NA	NA	NA
WP_023974839.1|436167_437010_+	4-diphosphocytidyl-2C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_023974840.1|437073_437811_+	stage II sporulation protein R	NA	NA	NA	NA	NA
WP_011967745.1|437942_438359_+	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_023974841.1|438464_438773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023974842.1|438937_440548_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	51.0	1.5e-149
WP_054249154.1|440856_442299_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_023974843.1|442340_443447_-	galactosyldiacylglycerol synthase	NA	NA	NA	NA	NA
WP_023974844.1|443660_443870_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017209894.1|444059_444644_+	thymidine kinase	NA	A0A249XXF6	Clostridium_phage	55.3	6.7e-55
WP_023974845.1|444669_446430_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	A0A0K2CP67	Brevibacillus_phage	28.1	1.2e-06
WP_011967753.1|446565_447648_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_023974846.1|447713_448301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017209891.1|448356_449406_+	threonylcarbamoyl-AMP synthase	NA	S4VW33	Pandoravirus	35.4	3.3e-44
WP_023974847.1|449456_449906_+	ribose 5-phosphate isomerase B	NA	NA	NA	NA	NA
WP_011967757.1|450096_450726_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011967758.1|450807_451302_+	cytidine deaminase	NA	A0A2H5BMD7	Streptomyces_phage	39.4	3.0e-16
WP_011967759.1|451539_452730_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.0	1.6e-26
WP_023974849.1|452851_454033_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_023974850.1|454753_455119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077723628.1|455111_455801_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_017209887.1|455855_456071_+	ATP synthase F0 subunit C	NA	NA	NA	NA	NA
WP_023974852.1|456123_456603_+	ATP synthase subunit B	NA	NA	NA	NA	NA
WP_011967764.1|456605_457145_+	ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_011967765.1|457155_458670_+	ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_011967766.1|458711_459563_+	ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_011967767.1|459577_460969_+	ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_011967768.1|460984_461392_+	ATP synthase epsilon chain	NA	NA	NA	NA	NA
WP_011967769.1|461606_462257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023974853.1|462418_463681_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_011967771.1|464247_465306_+	stage II sporulation protein D	NA	Q2XU88	Pseudomonas_phage	35.1	3.0e-37
WP_077723629.1|465731_466484_+	M23 family peptidase	NA	NA	NA	NA	NA
WP_011967773.1|466591_466846_+	sporulation transcriptional regulator SpoIIID	NA	M9Q261	Clostridium_phage	56.4	5.7e-19
WP_011967774.1|466925_467960_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_023974855.1|468027_468564_-|protease	spore protease YyaC	protease	NA	NA	NA	NA
WP_011967776.1|468664_469069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011967777.1|470335_471511_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	67.6	2.6e-151
WP_023974856.1|471962_474191_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.4	3.2e-65
WP_023974857.1|474209_475226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011967780.1|475198_475855_+	amidophosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011967781.1|476270_476804_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_023974858.1|477148_479707_+	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_023974859.1|480001_480976_+	peptide chain release factor 2	NA	W8EDB3	Pseudomonas_phage	41.5	2.1e-05
WP_017213034.1|481110_481443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017213033.1|481637_482333_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	40.5	3.8e-41
WP_023974860.1|482322_483822_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.5	8.6e-30
WP_023974861.1|484020_484932_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 2
NZ_CP011966	Clostridium beijerinckii NRRL B-598, complete genome	6186879	1002600	1016068	6186879	integrase	Clostridium_phage(64.29%)	22	989123:989138	1018805:1018820
989123:989138	attL	GAATTTAACAAAGAAA	NA	NA	NA	NA
WP_023973976.1|1002600_1003503_-	NAD-dependent DNA ligase	NA	M1PFD8	Streptococcus_phage	37.5	1.2e-05
WP_023973975.1|1003593_1003935_-	XRE family transcriptional regulator	NA	A0A1L2BY72	Clostridium_phage	60.0	6.9e-28
WP_023973974.1|1004110_1004302_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_023973973.1|1004352_1004784_+	XRE family transcriptional regulator	NA	A0A1L2BY71	Clostridium_phage	88.1	1.2e-64
WP_023973971.1|1005040_1005340_+	hypothetical protein	NA	A0A1L2BY79	Clostridium_phage	81.0	2.0e-23
WP_011968234.1|1005430_1005613_+	hypothetical protein	NA	A0A1L2BY78	Clostridium_phage	86.4	3.3e-21
WP_023973970.1|1005660_1006473_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	50.4	8.1e-67
WP_054249150.1|1006465_1007245_+	hypothetical protein	NA	A0A1L2BY85	Clostridium_phage	55.6	8.0e-72
WP_023973969.1|1007516_1007840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023973968.1|1007862_1008180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023973967.1|1008202_1008520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023973965.1|1008990_1009314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023973963.1|1009682_1010075_+	sigma factor	NA	A0A1L2BY86	Clostridium_phage	89.2	1.5e-55
WP_023973962.1|1010312_1010495_+	hypothetical protein	NA	A0A1L2BY88	Clostridium_phage	67.2	2.0e-18
WP_023973961.1|1010510_1011116_+|integrase	integrase	integrase	A0A1L2BY87	Clostridium_phage	92.0	7.6e-102
WP_023973960.1|1011403_1011616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023973959.1|1011612_1011840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023973958.1|1011826_1012249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077723633.1|1012323_1012503_-	hypothetical protein	NA	A0A0C5AEA5	Paenibacillus_phage	57.6	1.9e-13
WP_023973957.1|1012686_1014168_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	48.1	1.7e-110
WP_023973956.1|1014693_1015308_-|integrase	integrase	integrase	A0A0C5AEA5	Paenibacillus_phage	49.0	8.1e-27
WP_077723634.1|1015852_1016068_+	hypothetical protein	NA	S6B9W8	Thermus_phage	59.5	8.0e-06
1018805:1018820	attR	GAATTTAACAAAGAAA	NA	NA	NA	NA
>prophage 3
NZ_CP011966	Clostridium beijerinckii NRRL B-598, complete genome	6186879	1171265	1181492	6186879		Cyanophage(28.57%)	7	NA	NA
WP_023973459.1|1171265_1175012_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	24.8	5.7e-30
WP_017210869.1|1175441_1175921_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.4	5.9e-25
WP_023973458.1|1175920_1176628_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4SM18	Cyanophage	43.8	3.1e-46
WP_023973457.1|1176883_1178299_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.5	1.0e-56
WP_023973456.1|1178369_1179371_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SQF5	Cyanophage	45.5	6.5e-66
WP_023973455.1|1179358_1179970_+	phosphoribosylglycinamide formyltransferase	NA	R9S626	Prochlorococcus_phage	36.2	1.0e-21
WP_023973454.1|1179983_1181492_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase PurH	NA	E3SNU8	Prochlorococcus_phage	45.0	4.0e-35
>prophage 4
NZ_CP011966	Clostridium beijerinckii NRRL B-598, complete genome	6186879	1215148	1226666	6186879		Enterobacteria_phage(28.57%)	11	NA	NA
WP_023973432.1|1215148_1216495_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	42.5	3.2e-92
WP_023973431.1|1216512_1217721_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_023973430.1|1217837_1218704_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_023973429.1|1218716_1219655_+	glucose-1-phosphate thymidylyltransferase	NA	I7I009	Enterobacteria_phage	61.5	8.4e-100
WP_023973428.1|1219641_1220223_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.1	4.8e-53
WP_023973427.1|1220302_1221211_+	dTDP-4-dehydrorhamnose reductase	NA	H9NCE8	Sphingomonas_phage	28.6	9.9e-13
WP_023973426.1|1221210_1222260_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D8EQC0	Escherichia_phage	47.1	9.1e-79
WP_023973425.1|1222291_1223143_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	38.1	9.9e-15
WP_023973424.1|1223170_1224352_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_031275581.1|1224363_1225620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051398412.1|1225643_1226666_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.4	4.2e-12
>prophage 5
NZ_CP011966	Clostridium beijerinckii NRRL B-598, complete genome	6186879	2493336	2497818	6186879		Clostridium_virus(16.67%)	6	NA	NA
WP_012058440.1|2493336_2493696_-	XRE family transcriptional regulator	NA	B6SBW8	Clostridium_virus	40.4	1.0e-13
WP_023975159.1|2494014_2494212_+	transcriptional regulator	NA	A0A0A7RTP5	Clostridium_phage	53.3	1.2e-08
WP_023975158.1|2494700_2496062_+	replisome organizer region-containing protein	NA	A8ASN4	Listeria_phage	51.7	1.1e-28
WP_031275900.1|2496111_2496738_+	ATPase AAA	NA	A0A0K2CPA5	Brevibacillus_phage	39.5	3.6e-30
WP_012058444.1|2496851_2497094_+	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	48.6	2.7e-10
WP_023975156.1|2497509_2497818_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	44.9	7.4e-13
>prophage 6
NZ_CP011966	Clostridium beijerinckii NRRL B-598, complete genome	6186879	2553771	2560492	6186879		Clostridium_phage(37.5%)	12	NA	NA
WP_012058485.1|2553771_2554131_-	XRE family transcriptional regulator	NA	B6SBW8	Clostridium_virus	40.4	2.3e-13
WP_012058486.1|2554589_2554787_+	transcriptional regulator	NA	A0A0A7RTP5	Clostridium_phage	51.7	2.7e-08
WP_012058487.1|2554905_2555166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023975103.1|2555393_2556743_+	replisome organizer region-containing protein	NA	Q7Y4K5	Streptococcus_phage	51.8	8.8e-26
WP_012058489.1|2556792_2557419_+	ATPase AAA	NA	Q0H276	Geobacillus_phage	41.9	1.4e-29
WP_009168788.1|2557533_2557776_+	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	52.7	5.8e-13
WP_012058490.1|2557777_2558170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012058491.1|2558248_2559004_+	phage antirepressor Ant	NA	A0A2R2ZGJ4	Clostridioides_phage	39.4	7.9e-40
WP_009168791.1|2559082_2559301_-	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_012058448.1|2559416_2559641_-	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_023975102.1|2559775_2560201_+	hypothetical protein	NA	A0A1L2BY85	Clostridium_phage	55.1	1.7e-31
WP_023975101.1|2560282_2560492_+	hypothetical protein	NA	A0A1L2BY85	Clostridium_phage	55.4	3.8e-13
>prophage 7
NZ_CP011966	Clostridium beijerinckii NRRL B-598, complete genome	6186879	2921016	2953949	6186879	portal,tail,terminase,capsid	uncultured_Caudovirales_phage(40.74%)	35	NA	NA
WP_023976332.1|2921016_2921643_+	hypothetical protein	NA	A0A1S5SFL0	Streptococcus_phage	30.3	2.1e-14
WP_023976331.1|2922055_2922772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023976330.1|2922947_2923640_+	recombinase family protein	NA	H2A0H0	Bacteroides_phage	23.9	6.8e-06
WP_023976329.1|2923747_2923945_+	addiction module toxin, HicA family	NA	A0A1L2JY37	Aeribacillus_phage	53.2	1.1e-14
WP_023976328.1|2923999_2924404_+	HicB family protein	NA	A0A090DBV2	Clostridium_phage	66.7	8.7e-46
WP_023976327.1|2924497_2925271_+	hypothetical protein	NA	A0A1L2BWH4	Clostridium_phage	47.1	4.4e-38
WP_023976326.1|2925270_2926605_+|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	67.1	1.5e-147
WP_023976325.1|2926746_2928288_+|portal	phage portal protein	portal	A0A0A7RW62	Clostridium_phage	62.9	3.2e-173
WP_023976323.1|2930133_2930331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023976322.1|2930574_2931228_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.3	6.9e-08
WP_023976320.1|2931906_2932155_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_023976319.1|2932182_2932578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023976318.1|2932620_2933241_+	hypothetical protein	NA	A0A0A7RW68	Clostridium_phage	51.0	2.1e-43
WP_023976317.1|2933261_2933618_+	hypothetical protein	NA	A0A2H4J872	uncultured_Caudovirales_phage	52.9	1.6e-27
WP_023976316.1|2933636_2934665_+|capsid	phage capsid protein	capsid	A0A1J1GG50	Clostridium_phage	80.4	9.7e-158
WP_023976315.1|2934720_2934966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_034851843.1|2934977_2935298_+	hypothetical protein	NA	A0A2H4J040	uncultured_Caudovirales_phage	62.7	2.4e-30
WP_054249111.1|2935294_2935684_+	hypothetical protein	NA	A0A2H4J057	uncultured_Caudovirales_phage	47.7	2.5e-26
WP_023976312.1|2935684_2936110_+	hypothetical protein	NA	A0A2H4J736	uncultured_Caudovirales_phage	39.9	2.3e-20
WP_023976311.1|2936112_2936940_+	hypothetical protein	NA	A0A2H4J4Q0	uncultured_Caudovirales_phage	61.1	1.2e-94
WP_031276186.1|2937045_2937225_+	hypothetical protein	NA	A0A0A8WEX5	Clostridium_phage	61.1	2.0e-10
WP_023976309.1|2937227_2938640_+|portal	phage portal protein	portal	A0A2H4J1N7	uncultured_Caudovirales_phage	54.3	3.2e-143
WP_023976308.1|2938655_2939066_+|portal	phage portal protein	portal	A0A2H4J032	uncultured_Caudovirales_phage	64.4	6.8e-46
WP_023976307.1|2939129_2939561_+	hypothetical protein	NA	A0A2H4J883	uncultured_Caudovirales_phage	47.1	2.5e-27
WP_023976305.1|2939739_2943876_+|tail	phage tail tape measure protein	tail	D9ZNE6	Clostridium_phage	52.7	5.9e-97
WP_054249110.1|2943918_2944296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054249109.1|2944322_2944574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023976303.1|2944648_2945338_+	SH3 domain-containing protein	NA	A0A2H4J045	uncultured_Caudovirales_phage	51.8	2.2e-57
WP_023976302.1|2945348_2946323_+	hypothetical protein	NA	A0A2H4J063	uncultured_Caudovirales_phage	48.6	1.7e-79
WP_023976301.1|2946312_2946648_+	hypothetical protein	NA	A0A0A8WFG6	Clostridium_phage	40.4	4.7e-13
WP_023976300.1|2946640_2947078_+	DUF2634 domain-containing protein	NA	A0A2H4J4Q8	uncultured_Caudovirales_phage	50.0	3.7e-26
WP_023976299.1|2947084_2948215_+	hypothetical protein	NA	A0A0A8WEY6	Clostridium_phage	52.3	1.4e-101
WP_023976298.1|2948211_2949909_+	DUF2313 domain-containing protein	NA	J9QE20	Clostridium_phage	42.9	1.0e-31
WP_023976297.1|2949905_2950199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023976296.1|2950202_2953949_+	hypothetical protein	NA	G3MAG1	Bacillus_virus	30.2	3.2e-33
>prophage 8
NZ_CP011966	Clostridium beijerinckii NRRL B-598, complete genome	6186879	3805036	3810845	6186879		Clostridium_phage(28.57%)	8	NA	NA
WP_023973787.1|3805036_3805279_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	51.4	3.4e-13
WP_051398420.1|3805604_3806186_-	AAA family ATPase	NA	Q0H276	Geobacillus_phage	43.5	4.3e-30
WP_023973790.1|3806280_3807267_-	DnaD domain protein	NA	V5UQV4	Oenococcus_phage	55.6	2.0e-35
WP_031275646.1|3807344_3808115_-	hypothetical protein	NA	A0A0A7RW37	Clostridium_phage	52.4	2.9e-66
WP_023973791.1|3808174_3809089_-	hypothetical protein	NA	A0A0A7RWR9	Clostridium_phage	57.6	9.3e-104
WP_023973792.1|3809324_3809537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023973793.1|3809754_3810225_+	XRE family transcriptional regulator	NA	Q786F1	Bacillus_phage	34.8	8.1e-11
WP_069955989.1|3810374_3810845_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	38.9	7.6e-17
>prophage 9
NZ_CP011966	Clostridium beijerinckii NRRL B-598, complete genome	6186879	4005761	4018720	6186879	tail,terminase,plate	Clostridium_phage(83.33%)	15	NA	NA
WP_023974402.1|4005761_4005995_-	membrane protein	NA	A0A0A7S0T7	Clostridium_phage	51.9	4.1e-16
WP_077723678.1|4006158_4006374_-	hypothetical protein	NA	S6B9W8	Thermus_phage	59.5	4.7e-06
WP_023974404.1|4006366_4006645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023974406.1|4007881_4008655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023974407.1|4008826_4009480_-|tail	tail fiber protein	tail	A0A0A7RTP0	Clostridium_phage	57.6	7.2e-50
WP_023974408.1|4009481_4010186_-	DUF2313 domain-containing protein	NA	A0A0A7RTT8	Clostridium_phage	44.8	2.3e-41
WP_023974409.1|4010178_4011285_-|plate	baseplate J protein	plate	A0A0A7RUN3	Clostridium_phage	35.7	2.5e-50
WP_023974410.1|4011277_4011718_-	DUF2634 domain-containing protein	NA	A0A0A7S0E2	Clostridium_phage	44.8	2.3e-23
WP_017210964.1|4011710_4012034_-	DUF2577 domain-containing protein	NA	NA	NA	NA	NA
WP_023974411.1|4012033_4013038_-	hypothetical protein	NA	A0A0A7RTP6	Clostridium_phage	37.7	7.7e-59
WP_031275726.1|4013034_4013514_-	hypothetical protein	NA	A0A090DBR9	Clostridium_phage	32.0	5.4e-18
WP_023974413.1|4013527_4015948_-	hypothetical protein	NA	A0A2K9V3N5	Faecalibacterium_phage	33.3	3.7e-06
WP_023974414.1|4016123_4016528_-	hypothetical protein	NA	A0A0A7RTP2	Clostridium_phage	48.4	8.2e-28
WP_012059574.1|4017154_4017586_-|terminase	terminase	terminase	A0A0A7RVT1	Clostridium_phage	58.1	3.8e-39
WP_023974415.1|4017598_4018720_-|terminase	terminase	terminase	A0A0A7S0D2	Clostridium_phage	46.5	1.3e-83
>prophage 10
NZ_CP011966	Clostridium beijerinckii NRRL B-598, complete genome	6186879	5778911	5855129	6186879	transposase,integrase,protease	Bacillus_phage(16.67%)	58	5850398:5850420	5857404:5857426
WP_054249042.1|5778911_5780867_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_023977087.1|5780859_5781987_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012060955.1|5782282_5782549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023976999.1|5782817_5783303_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_023977000.1|5783311_5784640_-	6-phospho-alpha-glucosidase	NA	NA	NA	NA	NA
WP_012060958.1|5784661_5786257_-	PTS glucose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_031276441.1|5786497_5787223_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023977002.1|5787408_5789172_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	34.2	1.2e-11
WP_023977003.1|5789472_5790660_-	amidohydrolase	NA	NA	NA	NA	NA
WP_012059009.1|5791079_5792381_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_051144873.1|5792528_5793572_-|protease	CPBP family intramembrane metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_023975961.1|5793580_5794378_-	carbon-nitrogen family hydrolase	NA	NA	NA	NA	NA
WP_023975962.1|5794478_5794823_-	MIF domain	NA	NA	NA	NA	NA
WP_023975963.1|5795370_5795760_+	response regulator	NA	NA	NA	NA	NA
WP_023975964.1|5795789_5798729_+	hybrid sensor histidine kinase/response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	28.2	4.4e-30
WP_023975965.1|5798770_5799133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031276086.1|5799251_5799662_-	hemerythrin	NA	NA	NA	NA	NA
WP_012060969.1|5799902_5800130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012060970.1|5800163_5800571_-	hemerythrin	NA	NA	NA	NA	NA
WP_023975967.1|5800689_5801097_-	response regulator	NA	A0A2K9L4R0	Tupanvirus	27.6	2.0e-05
WP_023975968.1|5801123_5802596_-	hybrid sensor histidine kinase/response regulator	NA	A0A1V0SGX0	Hokovirus	45.1	3.9e-43
WP_023975969.1|5802637_5804242_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_023975970.1|5804257_5804755_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_023975971.1|5804789_5807414_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_023975972.1|5807512_5807884_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_023975973.1|5808326_5808983_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_023975974.1|5808994_5810020_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_017212173.1|5810062_5810878_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_023975975.1|5810893_5812615_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_054249041.1|5812667_5814716_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_023975978.1|5814973_5815708_-	chemotaxis protein MotB	NA	NA	NA	NA	NA
WP_023975979.1|5815725_5816511_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_023975980.1|5817086_5818811_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.1e-09
WP_023975981.1|5819101_5820544_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	29.3	2.0e-47
WP_023975982.1|5820965_5821661_-	manganese catalase	NA	NA	NA	NA	NA
WP_012060987.1|5821983_5823090_-	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_023975983.1|5823473_5824265_-	AAC(3) family N-acetyltransferase	NA	O64018	Bacillus_phage	40.2	7.2e-52
WP_023975984.1|5824290_5825142_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023975985.1|5825188_5826238_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023975986.1|5826269_5827241_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_023975987.1|5827275_5828376_-	gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023975990.1|5829716_5832734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077723702.1|5832958_5833996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023975992.1|5834057_5835083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023975993.1|5835328_5836579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023975994.1|5836705_5838310_-	LlaJI family restriction endonuclease	NA	NA	NA	NA	NA
WP_023975995.1|5838351_5840262_-	hypothetical protein	NA	Q6DMW9	Streptococcus_phage	33.3	3.5e-36
WP_023975996.1|5840377_5841604_-	DNA (cytosine-5-)-methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	28.3	8.6e-20
WP_023975997.1|5841616_5842870_-	DNA (cytosine-5-)-methyltransferase	NA	M1PSQ0	Streptococcus_phage	38.5	2.4e-57
WP_077723703.1|5842947_5843748_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_051398448.1|5843857_5845609_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.2	2.2e-32
WP_023977061.1|5846693_5847281_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_023977062.1|5847340_5847583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023977063.1|5847894_5848419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023977064.1|5848516_5848717_+	YvrJ family protein	NA	NA	NA	NA	NA
5850398:5850420	attL	AAATCCAATCACTAAAAATAATA	NA	NA	NA	NA
WP_023977066.1|5850823_5851210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023977083.1|5852038_5853166_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_031276454.1|5853158_5855129_+|integrase	integrase	integrase	A0A2H4J2U1	uncultured_Caudovirales_phage	25.1	9.6e-05
5857404:5857426	attR	TATTATTTTTAGTGATTGGATTT	NA	NA	NA	NA
>prophage 11
NZ_CP011966	Clostridium beijerinckii NRRL B-598, complete genome	6186879	5865200	5874721	6186879	integrase	Clostridium_phage(37.5%)	13	5860332:5860348	5887084:5887100
5860332:5860348	attL	TTTTAATATATATTCAA	NA	NA	NA	NA
WP_023975303.1|5865200_5865917_-	hypothetical protein	NA	A0A1L2BY85	Clostridium_phage	55.0	2.0e-61
WP_009168792.1|5866051_5866276_+	DUF1659 domain-containing protein	NA	NA	NA	NA	NA
WP_023975304.1|5866319_5866538_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_023975306.1|5867454_5867847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023975307.1|5867851_5868091_-	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	52.7	7.5e-13
WP_023975308.1|5868205_5868832_-	ATPase AAA	NA	Q0H276	Geobacillus_phage	41.4	5.2e-29
WP_023975309.1|5868881_5870198_-	replisome organizer region-containing protein	NA	V5UQV4	Oenococcus_phage	51.7	1.0e-26
WP_051398436.1|5870339_5870570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008423918.1|5870588_5870810_-	DNA-binding protein	NA	A0A2I7SCU5	Paenibacillus_phage	51.5	5.5e-10
WP_008423917.1|5870926_5871151_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_023975312.1|5871403_5871778_+	XRE family transcriptional regulator	NA	A0A090D830	Clostridium_phage	38.1	1.8e-13
WP_023975314.1|5872133_5873291_+|integrase	site-specific integrase	integrase	A0A0A8WIF9	Clostridium_phage	51.4	5.1e-107
WP_023975315.1|5873356_5874721_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	41.9	5.9e-102
5887084:5887100	attR	TTTTAATATATATTCAA	NA	NA	NA	NA
