The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP005995	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 chromosome, complete genome	4783867	632955	640207	4783867		Morganella_phage(33.33%)	8	NA	NA
WP_001157304.1|632955_634386_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
WP_000377037.1|634459_635155_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_000107434.1|635234_635546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|636196_637393_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_024131109.1|637650_637839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|637849_638062_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457664.1|638516_639785_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000394197.1|639787_640207_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 2
NZ_CP005995	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 chromosome, complete genome	4783867	729551	740057	4783867		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|729551_730865_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565905.1|730891_731971_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000648784.1|731975_732749_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018226.1|732745_733738_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973708.1|733743_734295_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000857529.1|734295_735174_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_001023662.1|735221_736121_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000697840.1|736120_737206_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_000981469.1|737582_738476_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_001111845.1|738653_740057_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	6.8e-21
>prophage 3
NZ_CP005995	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 chromosome, complete genome	4783867	808333	817504	4783867	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|808333_810367_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|810607_811066_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|811237_811768_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|811824_812292_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|812338_813058_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|813054_814740_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240417.1|814962_815694_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|815753_815861_+	protein YohO	NA	NA	NA	NA	NA
WP_000824857.1|815841_816573_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569165.1|816556_817504_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 4
NZ_CP005995	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 chromosome, complete genome	4783867	836911	903297	4783867	holin,lysis,tail	Salmonella_phage(25.0%)	58	NA	NA
WP_000989295.1|836911_837607_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|837760_838645_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|838821_839541_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|839537_839783_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136394.1|839987_841229_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956097.1|841222_842458_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|842532_843543_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535907.1|843558_845079_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_001036943.1|845212_846211_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_001520237.1|847880_849023_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|849037_849706_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|850035_850893_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|850881_851271_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001531764.1|851275_852643_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022910.1|852859_853747_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|853779_855102_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488244.1|855145_857137_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|857482_858952_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|859141_860005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|860125_861175_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873906.1|861253_862111_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	1.3e-22
WP_000854395.1|862175_863864_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|863880_864819_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|864818_865949_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|866316_867498_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_001213897.1|867561_868227_-	membrane protein	NA	NA	NA	NA	NA
WP_001519564.1|868228_868351_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|868738_868993_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|869316_869889_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|870101_871088_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|871117_871837_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|872250_872823_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957755.1|873148_874705_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000561742.1|874811_876617_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501626.1|876626_877721_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137747.1|877720_878746_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000222013.1|878747_880337_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	7.2e-19
WP_001094639.1|880340_880685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213347.1|881075_882266_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	2.4e-19
WP_001234834.1|882293_882989_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578130.1|883140_884901_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	1.4e-100
WP_000494192.1|885025_885310_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|885418_886039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|886066_887074_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|887253_887481_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256150.1|887512_889273_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|889553_890057_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|890084_890375_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000022213.1|892598_893042_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|893419_893947_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|893949_895191_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|895783_896113_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894638.1|896409_897741_+	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_010989045.1|897769_898138_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_001202279.1|898152_899142_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_001115840.1|899470_901837_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|902005_902209_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|902505_903297_-|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
>prophage 5
NZ_CP005995	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 chromosome, complete genome	4783867	2924251	2945148	4783867	tail,plate	Burkholderia_phage(45.0%)	26	NA	NA
WP_000587739.1|2924251_2924893_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
WP_024132246.1|2925471_2925888_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000084336.1|2926268_2926724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001151758.1|2926720_2927335_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000368193.1|2927341_2929000_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_000359509.1|2929002_2929635_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000951734.1|2929627_2930743_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|2930733_2931093_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000632053.1|2931256_2932804_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_000703633.1|2932803_2933733_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000593182.1|2933729_2934092_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679398.1|2934419_2935142_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000818154.1|2935151_2936195_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_001269716.1|2936182_2936392_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000271420.1|2936391_2937345_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001262499.1|2937344_2939699_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_001185654.1|2939795_2939924_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001003642.1|2939883_2940201_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907497.1|2940252_2940777_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_000729852.1|2940776_2942204_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000875314.1|2942193_2942391_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000449433.1|2942387_2942843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777266.1|2943002_2943317_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_001270441.1|2943329_2943935_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_001226442.1|2943937_2944225_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_000615248.1|2944800_2945148_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
>prophage 6
NZ_CP005995	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 chromosome, complete genome	4783867	3713357	3751277	4783867	protease,portal,terminase,lysis,coat,integrase	Enterobacteria_phage(46.55%)	59	3717204:3717249	3756468:3756513
WP_001043660.1|3713357_3714410_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
WP_001285275.1|3714692_3715796_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_000893221.1|3715807_3717058_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
3717204:3717249	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_000051900.1|3717263_3718427_-|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000016640.1|3718656_3719292_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_001277769.1|3719392_3719572_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000208013.1|3719668_3720355_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_000224223.1|3720365_3720629_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_001289978.1|3720630_3721116_-	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000812182.1|3721112_3721739_-	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001682200.1|3721735_3721900_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_001111313.1|3721910_3722207_-	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_000031375.1|3722537_3723155_-	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001163402.1|3723151_3723295_-	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000158027.1|3723284_3723473_-	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_000582314.1|3723453_3723612_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000776964.1|3723697_3724009_-	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_001737461.1|3724156_3724360_-	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000651935.1|3724359_3724596_-	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_000213983.1|3724632_3724827_-	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_001682202.1|3725041_3725620_+	super-infection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000216175.1|3725640_3725943_-	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001095984.1|3726296_3726947_-	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000276884.1|3727027_3727213_+	Cro/Cl family transcriptional regulator	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_000424167.1|3727319_3727598_+	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_001125981.1|3727632_3727779_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000067075.1|3727771_3728587_+	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001248406.1|3728583_3729960_+	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000736921.1|3730033_3730471_+	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_000679702.1|3730467_3730641_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000113772.1|3730607_3730784_+	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_001531428.1|3730786_3731119_+	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000950959.1|3731111_3731288_+	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001129733.1|3731280_3731892_+	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000036317.1|3731888_3732113_+	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_000149925.1|3732109_3732313_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219131.1|3732293_3732473_+	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_001235453.1|3732469_3733093_+	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000286100.1|3733531_3733735_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_000074137.1|3733712_3734210_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_001531485.1|3734298_3734736_+|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_001177703.1|3734948_3735635_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_000807785.1|3735937_3736180_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001278047.1|3736181_3736361_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000729925.1|3736384_3736873_+	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_000417849.1|3736850_3738350_+|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000774656.1|3738349_3740527_+|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000433852.1|3740540_3741452_+	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_001196938.1|3741451_3742744_+|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000684729.1|3742782_3742992_+	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001166098.1|3742975_3743476_+	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_001122424.1|3743435_3744854_+	packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_000774927.1|3744857_3745559_+	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_000627697.1|3745558_3746014_+	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000964902.1|3746016_3746709_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000246945.1|3746718_3748014_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_001029838.1|3748013_3750011_+	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000749288.1|3750101_3750587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023602519.1|3750989_3751277_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	67.8	1.9e-26
3756468:3756513	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 7
NZ_CP005995	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 chromosome, complete genome	4783867	4361177	4369200	4783867	protease,transposase	Dickeya_phage(14.29%)	8	NA	NA
WP_001201751.1|4361177_4362296_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125890.1|4362292_4364239_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_000447499.1|4364368_4364590_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|4364913_4365234_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934063.1|4365264_4367541_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000502119.1|4367731_4368190_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001117984.1|4368463_4368661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531374.1|4368822_4369200_-	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
>prophage 8
NZ_CP005995	Salmonella enterica subsp. enterica serovar Heidelberg str. CFSAN002064 chromosome, complete genome	4783867	4419808	4517768	4783867	protease,tail,portal,terminase,transposase,lysis,tRNA	Salmonella_phage(44.83%)	103	NA	NA
WP_001154025.1|4419808_4420612_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|4420604_4421927_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|4421907_4422612_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572753.1|4422611_4427078_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925883.1|4427422_4429243_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|4429502_4430051_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|4430078_4430726_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|4430787_4431978_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977713.1|4432162_4433254_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	2.2e-99
WP_000117870.1|4433860_4435261_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
WP_000762342.1|4435461_4435923_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|4436239_4437454_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000893206.1|4437698_4439132_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191413.1|4439212_4440415_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|4440609_4441902_-	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|4441946_4442195_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001682304.1|4442235_4442475_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000189634.1|4442480_4443350_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_000187054.1|4443346_4444027_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000100830.1|4444023_4444809_-	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000995352.1|4444814_4445111_-	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000186242.1|4445201_4445402_-	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000373338.1|4445689_4445896_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000091280.1|4445922_4446357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000439725.1|4446358_4446784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001230956.1|4446826_4447222_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000992434.1|4447326_4447563_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_015675517.1|4447528_4447903_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000024046.1|4447994_4448900_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_000788826.1|4448896_4449598_+	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_023602525.1|4449642_4450044_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000215887.1|4450040_4450574_+	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_000224239.1|4450575_4450833_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000208143.1|4450843_4451245_+	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000877758.1|4451352_4451997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|4452227_4452461_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|4452577_4452826_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929790.1|4452860_4453463_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_001096547.1|4453671_4454283_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001617856.1|4454279_4454426_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001047631.1|4454415_4455213_+	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_000508329.1|4455379_4455598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658038.1|4455878_4456067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001682303.1|4456269_4456572_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000301013.1|4456549_4457089_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001080030.1|4457396_4457891_+|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.3	2.2e-59
WP_000371784.1|4458101_4458635_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_000989238.1|4458591_4460730_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000196190.1|4460726_4460933_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_001009205.1|4460929_4462477_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_077906133.1|4462400_4464479_+|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.3	2.4e-264
WP_001107908.1|4464569_4464893_+	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_000774239.1|4464885_4465185_+	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_000453192.1|4465165_4465732_+|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000196703.1|4465728_4466130_+|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000132755.1|4466141_4466891_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000478858.1|4466936_4467335_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_010989009.1|4467331_4467661_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_065305406.1|4467740_4470728_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_000978295.1|4470724_4471057_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_000410972.1|4471155_4471680_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000877926.1|4471769_4472303_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_001152416.1|4472392_4473088_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000606356.1|4473097_4473835_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_020867839.1|4473732_4474437_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_077906512.1|4476983_4477859_+	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.8	2.6e-50
WP_000178849.1|4477897_4478140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001532020.1|4478193_4480569_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_031618324.1|4481069_4481390_+	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_000143158.1|4481379_4481961_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000161705.1|4482157_4482880_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388788.1|4483092_4483311_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
WP_000343758.1|4483530_4484751_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_071531551.1|4484747_4485245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000193784.1|4485679_4488292_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000291723.1|4488499_4489510_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001220671.1|4489675_4490218_+	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000224069.1|4490214_4491324_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001086485.1|4491422_4493531_+	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000053044.1|4493543_4495451_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_000433414.1|4496724_4498365_+	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000759136.1|4498361_4498925_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_001537784.1|4499180_4499348_+	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000227928.1|4499447_4499966_-	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000156454.1|4500034_4501795_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877172.1|4501980_4502433_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_001674965.1|4502504_4503557_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288732.1|4503913_4504423_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001202375.1|4504639_4505245_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000950880.1|4505231_4507385_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261222.1|4507403_4507850_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420505.1|4507973_4510028_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_000424187.1|4510063_4510522_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847716.1|4510616_4511279_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001537782.1|4511452_4511866_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_000561983.1|4511910_4512228_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000140480.1|4512285_4513497_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000859416.1|4513711_4514260_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000548082.1|4514285_4515065_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000072884.1|4515113_4515395_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904446.1|4515391_4515721_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000374046.1|4515807_4516467_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000938191.1|4517087_4517768_-|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
