The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_023032	Cronobacter malonaticus, complete sequence	4377544	907381	1034520	4377544	portal,tRNA,head,integrase,terminase,tail,capsid,lysis	Salmonella_phage(25.53%)	108	933808:933837	991662:991691
WP_032972039.1|907381_910009_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.0	2.2e-81
WP_000906486.1|910252_910438_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_004386439.1|911934_912501_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_007777638.1|912497_912926_+	DedA family protein	NA	NA	NA	NA	NA
WP_023898100.1|913018_914575_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_007701138.1|914727_915243_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_007777635.1|915679_918190_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_023898101.1|918240_919779_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_004386445.1|919793_920969_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_007777630.1|921108_921639_-	transcriptional repressor MprA	NA	NA	NA	NA	NA
WP_023898104.1|922176_923361_-	MFS transporter	NA	NA	NA	NA	NA
WP_007777626.1|923842_924838_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_007777624.1|924892_925963_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_023898106.1|925955_927158_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.3	3.2e-27
WP_032968994.1|927512_928472_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.8	2.0e-133
WP_023898107.1|928484_930635_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	49.4	9.9e-197
WP_023898108.1|930616_931018_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_007777609.1|931014_931260_-	glutaredoxin-like protein NrdH	NA	A0A1J0MDS4	Mycobacterium_phage	39.8	6.3e-07
WP_004386456.1|931538_931865_-	DUF883 family protein	NA	NA	NA	NA	NA
WP_004386457.1|932025_932370_+	YgaC family protein	NA	NA	NA	NA	NA
WP_007777607.1|932381_932837_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_007777601.1|933347_933656_+	hypothetical protein	NA	NA	NA	NA	NA
933808:933837	attL	GTAGGGTGGGTAAGCGAAGCGCACCCACCG	NA	NA	NA	NA
WP_004386460.1|933879_934059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004386461.1|934284_934443_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_007777598.1|934784_936662_+	FIST C-terminal domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	55.7	1.5e-10
WP_032968992.1|936783_937152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071602997.1|937444_937792_+	DUF1493 family protein	NA	NA	NA	NA	NA
WP_007777593.1|938117_938507_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_014728196.1|938589_939225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032968375.1|939516_939903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007777581.1|940562_941906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023898113.1|943409_944666_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	48.1	2.4e-102
WP_023898114.1|944668_945688_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.3	2.3e-188
WP_041461044.1|945689_946313_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	68.1	1.9e-76
WP_080675958.1|946429_946669_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	82.3	2.3e-30
WP_015742223.1|946704_947214_+	phage regulatory CII family protein	NA	A0A218M4I4	Erwinia_phage	65.7	1.1e-58
WP_023898116.1|947222_947414_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	59.7	1.3e-12
WP_023898117.1|947410_947785_+	hypothetical protein	NA	F1BUS4	Erwinia_phage	46.5	1.1e-23
WP_041461045.1|947855_948089_+	DUF2732 domain-containing protein	NA	A0A1S6L021	Salmonella_phage	62.3	3.7e-17
WP_023898119.1|948088_948313_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	75.7	1.2e-25
WP_023898123.1|950746_950938_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	77.4	1.9e-19
WP_041461046.1|951172_951850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023898125.1|951836_952916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023898126.1|952915_953917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023898127.1|954322_955357_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	84.1	3.0e-167
WP_023898128.1|955356_957126_-|terminase	terminase ATPase subunit family protein	terminase	A0A0M4RE51	Salmonella_phage	85.7	1.0e-303
WP_023898129.1|957292_958147_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	79.2	2.2e-123
WP_023898130.1|958199_959288_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	81.6	1.2e-166
WP_041461047.1|959291_960038_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	79.4	1.4e-97
WP_023898132.1|960133_960628_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	76.7	3.8e-59
WP_023898133.1|960627_960831_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	83.6	1.7e-26
WP_023898134.1|960821_961037_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	53.4	9.7e-12
WP_041461048.1|961020_961530_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	79.6	2.5e-74
WP_023898137.1|961526_961952_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0M4R2N5	Salmonella_phage	67.9	3.3e-19
WP_041461049.1|962047_962515_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	75.5	2.2e-64
WP_023898141.1|962979_964296_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	57.8	1.2e-147
WP_023898142.1|964295_964898_+|tail	tail assembly chaperone	tail	A0A218M4J2	Erwinia_phage	50.3	1.7e-53
WP_023898143.1|965043_966213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023898145.1|966331_967519_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	85.8	4.3e-194
WP_015742190.1|967532_968054_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	82.0	9.5e-77
WP_023898146.1|968114_968396_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	79.1	1.5e-28
WP_071601019.1|968392_968548_+|tail	GpE family phage tail protein	tail	Q7Y4C9	Escherichia_virus	72.5	1.4e-15
WP_023898147.1|968540_971018_+|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	69.7	8.1e-235
WP_041461050.1|971030_971513_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	67.5	7.0e-58
WP_023898149.1|971512_972664_+	phage late control D family protein	NA	S4TRX8	Salmonella_phage	76.3	1.4e-160
WP_041461051.1|972722_973136_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	50.4	6.9e-30
WP_080675972.1|973235_973454_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	77.5	3.1e-29
WP_041461052.1|974548_986752_+	Ig-like domain repeat protein	NA	NA	NA	NA	NA
WP_032983497.1|986837_988187_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_023898154.1|988210_990346_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	29.1	1.7e-26
WP_032980765.1|990355_991525_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004387953.1|991792_992275_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.1	1.0e-29
991662:991691	attR	GTAGGGTGGGTAAGCGAAGCGCACCCACCG	NA	NA	NA	NA
WP_007763442.1|992423_992861_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004387955.1|992850_993141_+	RnfH family protein	NA	NA	NA	NA	NA
WP_004387956.1|993249_993594_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_023898158.1|993811_995473_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_007777462.1|995559_996438_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004387959.1|996560_997154_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_014728249.1|997223_998513_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_007777459.1|998531_999326_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_007777457.1|999488_1000850_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_004385557.1|1001108_1001357_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_007870198.1|1001375_1001924_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_004385559.1|1001954_1002728_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|1002773_1003121_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_032983496.1|1003287_1003749_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_007777448.1|1003801_1005160_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_007777438.1|1005365_1006436_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0B6VT43	Edwardsiella_phage	51.5	3.1e-90
WP_007777435.1|1006447_1007569_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_023898163.1|1007636_1008515_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_023898164.1|1008545_1009706_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_007777430.1|1009955_1010297_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_007777426.1|1010642_1011848_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_007777423.1|1011900_1012638_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_032968361.1|1012767_1013748_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_023898168.1|1013744_1014473_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_007777417.1|1014602_1017176_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.1	4.5e-127
WP_023898170.1|1022755_1022932_-	molybdopterin-guanine dinucleotide biosynthesis protein B	NA	NA	NA	NA	NA
WP_007777415.1|1023175_1023643_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_007777414.1|1023682_1025479_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_023898171.1|1025636_1026092_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	3.3e-33
WP_007777411.1|1026209_1027511_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.6	1.5e-43
WP_007777409.1|1027507_1027831_-	YfiM family lipoprotein	NA	B5AX59	Iodobacteriophage	37.8	2.1e-05
WP_004386364.1|1027884_1029240_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_032983151.1|1029352_1032013_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_023898174.1|1032046_1032748_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_007777393.1|1032817_1033249_-	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	39.0	1.6e-13
WP_014728268.1|1033458_1034520_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NC_023032	Cronobacter malonaticus, complete sequence	4377544	1224866	1271076	4377544	plate,head,integrase,terminase,tail,protease	Enterobacteria_phage(23.73%)	75	1224778:1224793	1269974:1269989
1224778:1224793	attL	ATGGCGTCCCCTGCAG	NA	NA	NA	NA
WP_007776948.1|1224866_1225064_-	AlpA family phage regulatory protein	NA	K7P7V0	Enterobacteria_phage	77.8	1.9e-22
WP_041461058.1|1225098_1225353_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	41.3	4.1e-09
WP_023898262.1|1225405_1226143_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	31.7	1.9e-14
WP_023898263.1|1226146_1226434_-	hypothetical protein	NA	G8C7K8	Escherichia_phage	57.7	5.4e-26
WP_023898264.1|1226489_1227011_-	hypothetical protein	NA	F1C5B6	Cronobacter_phage	50.5	7.8e-31
WP_080675959.1|1227007_1227163_-	DUF2737 family protein	NA	Q9MCR2	Enterobacteria_phage	58.8	1.2e-08
WP_023898266.1|1227195_1227390_-	hypothetical protein	NA	A0A2H4IYD2	uncultured_Caudovirales_phage	62.3	3.3e-11
WP_023898267.1|1227395_1227878_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	66.9	1.2e-54
WP_023898268.1|1227861_1228767_-	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	80.1	3.3e-133
WP_023898269.1|1228766_1229075_-	hypothetical protein	NA	F1C5B9	Cronobacter_phage	92.2	1.1e-45
WP_041461059.1|1229169_1229325_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	69.8	2.0e-11
WP_041461060.1|1229303_1229435_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_023898271.1|1229529_1229679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041461061.1|1229834_1230080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023899352.1|1230080_1230242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080675960.1|1230286_1230475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041461196.1|1230483_1230780_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	60.6	2.6e-07
WP_012125662.1|1231536_1232199_-	LexA family transcriptional regulator	NA	Q37946	Enterobacteria_phage	93.2	2.6e-119
WP_041460603.1|1232316_1232532_+	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	94.4	6.5e-32
WP_041461063.1|1232651_1232930_+	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	73.9	1.9e-31
WP_041461064.1|1232978_1233776_+	ParB N-terminal domain-containing protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	69.5	1.9e-100
WP_144083701.1|1233772_1233919_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	72.9	4.6e-13
WP_041461065.1|1233911_1234811_+	replication protein	NA	K7PL20	Enterobacteria_phage	87.7	2.6e-74
WP_023898279.1|1234810_1236148_+	hypothetical protein	NA	A0A2I7S0U1	Vibrio_phage	36.7	2.9e-77
WP_023898280.1|1236175_1236793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041461197.1|1237060_1237411_+	hypothetical protein	NA	F1C5C6	Cronobacter_phage	97.4	5.4e-60
WP_179944218.1|1237412_1237556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023898283.1|1237548_1237797_+	hypothetical protein	NA	U5P0J0	Shigella_phage	53.7	3.7e-07
WP_041461066.1|1237990_1238431_+	recombination protein NinB	NA	F1C5C7	Cronobacter_phage	91.8	4.2e-70
WP_041461067.1|1238427_1239003_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.2	4.3e-62
WP_080675961.1|1238978_1239158_+	NinE family protein	NA	Q76H73	Enterobacteria_phage	48.2	2.3e-06
WP_023898287.1|1239147_1239372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041461068.1|1239371_1239761_+	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	55.9	4.3e-26
WP_041461069.1|1239753_1239936_+	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	71.7	2.2e-20
WP_032988370.1|1240191_1240587_+	RusA family crossover junction endodeoxyribonuclease	NA	F1C5C9	Cronobacter_phage	99.2	1.5e-71
WP_051401894.1|1240583_1240775_+	hypothetical protein	NA	A0A1R3Y5V4	Salmonella_virus	57.1	5.2e-09
WP_041461070.1|1240771_1240951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041461071.1|1240947_1241727_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	80.5	1.3e-106
WP_007825061.1|1242437_1242644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051401895.1|1242640_1242919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041461072.1|1242915_1243383_+	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	43.8	4.3e-28
WP_007864863.1|1243382_1243637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023898294.1|1243633_1243903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023898295.1|1243904_1244048_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	51.1	4.0e-06
WP_023898296.1|1244044_1244233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038887881.1|1244448_1245135_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	92.5	5.5e-117
WP_023898298.1|1245250_1245460_+	hypothetical protein	NA	V5KSC6	Escherichia_phage	70.5	8.3e-08
WP_041461073.1|1245469_1245946_+|terminase	terminase	terminase	C7U0W1	Enterobacteria_phage	72.6	9.3e-55
WP_023898300.1|1245947_1247606_+|terminase	phage terminase large subunit	terminase	H9C191	Pectobacterium_phage	74.7	3.6e-247
WP_023898302.1|1247606_1249121_+	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.0	2.7e-100
WP_041461074.1|1249173_1249869_+|head	head morphogenesis protein	head	H9C0V1	Aeromonas_phage	54.9	6.9e-67
WP_041461076.1|1250258_1251581_+	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	42.1	4.4e-70
WP_041461078.1|1251582_1252065_+	hypothetical protein	NA	A0A219YBF2	Aeromonas_phage	51.0	2.2e-35
WP_023898305.1|1252064_1253099_+	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	51.4	5.6e-89
WP_023898306.1|1253102_1253429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041461079.1|1253431_1253875_+	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	46.7	3.7e-21
WP_105611604.1|1253943_1254324_+	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	54.5	5.7e-31
WP_023898308.1|1254320_1254692_+	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	67.8	5.5e-47
WP_041461198.1|1254889_1255198_+	hypothetical protein	NA	A0A077KC88	Edwardsiella_phage	69.0	1.5e-34
WP_023898311.1|1255194_1256685_+	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	74.7	1.9e-207
WP_041461082.1|1256695_1257130_+	hypothetical protein	NA	A0A077K9T0	Edwardsiella_phage	68.8	9.4e-54
WP_041461083.1|1257129_1257537_+	hypothetical protein	NA	A0A077KC08	Edwardsiella_phage	67.2	1.0e-41
WP_041461086.1|1259561_1260002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041461088.1|1260086_1260902_+	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	65.1	3.8e-88
WP_041461089.1|1260898_1261204_+	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	70.0	1.4e-35
WP_041461090.1|1261193_1262057_+	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	46.5	6.6e-67
WP_041461092.1|1262049_1262760_+|plate	phage baseplate assembly protein	plate	A0A077KAY0	Edwardsiella_phage	61.4	2.8e-79
WP_041461096.1|1262756_1263116_+	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	64.9	6.6e-37
WP_023898320.1|1263112_1264342_+|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	66.5	2.5e-152
WP_041461098.1|1264338_1264980_+	DUF2612 domain-containing protein	NA	A0A077K9U8	Edwardsiella_phage	72.6	2.5e-87
WP_023898322.1|1264982_1265894_+|tail	tail fiber protein	tail	A0A077KC23	Edwardsiella_phage	63.2	2.4e-43
WP_041461099.1|1265893_1266484_+|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	43.9	1.1e-44
WP_023898323.1|1266521_1268375_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	38.0	2.6e-105
WP_023898324.1|1268654_1269812_-|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	73.1	2.1e-164
WP_023898326.1|1270125_1271076_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	80.1	3.5e-130
1269974:1269989	attR	ATGGCGTCCCCTGCAG	NA	NA	NA	NA
>prophage 3
NC_023032	Cronobacter malonaticus, complete sequence	4377544	1591178	1600165	4377544		Burkholderia_phage(33.33%)	9	NA	NA
WP_007794693.1|1591178_1591418_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	84.8	5.5e-32
WP_007776171.1|1591572_1592697_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	55.9	3.2e-106
WP_007776167.1|1593340_1594039_+	phosphohydrolase	NA	S4W232	Pandoravirus	25.5	3.6e-07
WP_007776166.1|1594099_1595533_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	53.3	5.2e-101
WP_032968279.1|1595516_1596014_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.0	4.0e-32
WP_007776162.1|1596017_1596929_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_023898472.1|1597107_1598022_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_004388133.1|1598111_1598294_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_023898473.1|1598494_1600165_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	38.6	7.9e-24
>prophage 4
NC_023032	Cronobacter malonaticus, complete sequence	4377544	2014865	2064652	4377544	integrase,terminase,tail,holin,protease,lysis	Salmonella_phage(44.44%)	58	2008959:2008975	2027981:2027997
2008959:2008975	attL	CCTTCTTCGCGGCGCGC	NA	NA	NA	NA
WP_023898662.1|2014865_2016116_+|integrase	site-specific integrase	integrase	T1S9J3	Salmonella_phage	66.5	1.0e-156
WP_023898663.1|2016137_2016299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032983329.1|2016390_2016645_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	46.0	5.7e-11
WP_041461115.1|2016710_2017019_-	hypothetical protein	NA	I6PD68	Cronobacter_phage	59.8	7.6e-26
WP_023898665.1|2017173_2017770_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	85.1	8.5e-98
WP_007901910.1|2017766_2017931_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	61.1	4.8e-11
WP_007901913.1|2017927_2018233_-	PerC family transcriptional regulator	NA	Q858E4	Salmonella_phage	54.9	6.9e-19
WP_007761581.1|2018345_2018594_-	AlpA family phage regulatory protein	NA	A0A193GYW1	Enterobacter_phage	74.4	1.2e-29
WP_023898666.1|2018646_2019528_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	76.2	1.4e-117
WP_023898667.1|2019524_2020346_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A193GYK2	Enterobacter_phage	76.1	2.4e-119
WP_129560328.1|2020342_2020621_-	hypothetical protein	NA	T1SA88	Salmonella_phage	35.9	1.9e-07
WP_023898669.1|2020641_2020830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007901935.1|2021196_2021787_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	50.3	2.0e-46
WP_007761568.1|2021941_2022172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007901938.1|2022320_2022524_+	hypothetical protein	NA	Q858D5	Salmonella_phage	80.6	2.6e-22
WP_023898672.1|2022520_2023600_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	69.0	1.4e-151
WP_050505959.1|2023577_2024405_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	48.3	3.8e-64
WP_023898675.1|2024520_2024988_+	crossover junction endodeoxyribonuclease RuvC	NA	Q858D2	Salmonella_phage	79.9	1.1e-65
WP_023898676.1|2025024_2025558_+	hypothetical protein	NA	F1C5B6	Cronobacter_phage	63.0	1.3e-44
WP_023898678.1|2025613_2025901_+	hypothetical protein	NA	G8C7K8	Escherichia_phage	58.8	2.4e-26
WP_023898682.1|2026548_2026887_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	76.8	5.8e-43
WP_023898683.1|2026915_2027350_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_023898684.1|2027426_2028014_+|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	67.2	2.4e-60
2027981:2027997	attR	GCGCGCCGCGAAGAAGG	NA	NA	NA	NA
WP_023898685.1|2028006_2029473_+	hypothetical protein	NA	G9L6B8	Escherichia_phage	82.4	7.9e-246
WP_144083702.1|2029495_2030548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023898687.1|2030877_2031087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041461116.1|2031107_2032781_+|tail	tail protein	tail	G9L6C2	Escherichia_phage	77.5	1.4e-246
WP_023898690.1|2032777_2033092_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	56.4	2.7e-18
WP_023898692.1|2033088_2033817_+	hypothetical protein	NA	T1SAP9	Salmonella_phage	74.4	4.3e-59
WP_023898693.1|2033827_2034835_+	hypothetical protein	NA	T1S9H9	Salmonella_phage	91.0	3.7e-178
WP_023898694.1|2034845_2035238_+	hypothetical protein	NA	T1SA71	Salmonella_phage	88.5	2.2e-54
WP_023898695.1|2035230_2035512_+	hypothetical protein	NA	Q858G6	Salmonella_phage	51.0	1.0e-16
WP_032986295.1|2035560_2035896_+	hypothetical protein	NA	Q858G5	Salmonella_phage	75.7	1.3e-42
WP_023898696.1|2035895_2036501_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	75.1	3.3e-81
WP_023898697.1|2036500_2038978_+	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	78.6	0.0e+00
WP_032986296.1|2038970_2039435_+	hypothetical protein	NA	T1SA73	Salmonella_phage	66.2	1.3e-58
WP_032986297.1|2039434_2039977_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	63.6	4.6e-50
WP_032986298.1|2039987_2042609_+	transglycosylase SLT domain-containing protein	NA	G9L6D3	Escherichia_phage	33.1	1.7e-52
WP_023898701.1|2042610_2044323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023898702.1|2044322_2046872_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	45.9	9.6e-207
WP_041461117.1|2047063_2047753_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	57.0	1.9e-64
WP_041461118.1|2048076_2048334_-	hypothetical protein	NA	T1SA06	Salmonella_phage	62.5	5.6e-22
WP_023898708.1|2050946_2052389_-	glucosyltransferase domain-containing protein	NA	F1C5A9	Cronobacter_phage	28.1	2.6e-31
WP_041461119.1|2052389_2053304_-	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	96.1	2.5e-165
WP_041461203.1|2053300_2053663_-	GtrA family protein	NA	F1C5B1	Cronobacter_phage	93.3	6.4e-56
WP_032806528.1|2053815_2054220_+	membrane protein	NA	T1SA79	Salmonella_phage	83.3	8.7e-54
WP_032986397.1|2054206_2054500_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	63.7	5.0e-27
WP_023898710.1|2054489_2055110_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.8	1.7e-88
WP_041461120.1|2055109_2055574_+|lysis	lysis protein	lysis	G0ZNC9	Cronobacter_phage	58.6	4.2e-36
WP_080675963.1|2056190_2057396_-	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_032983691.1|2057448_2057979_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023898717.1|2058214_2060179_+	U32 family peptidase	NA	Q6DW11	Phage_TP	27.1	4.3e-21
WP_007775328.1|2060382_2060802_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	54.5	3.0e-33
WP_023898719.1|2060803_2062072_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	64.4	1.5e-152
WP_023898720.1|2062199_2062607_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_007775324.1|2063113_2063473_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_007775321.1|2063459_2063789_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_007775309.1|2063830_2064652_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 5
NC_023032	Cronobacter malonaticus, complete sequence	4377544	2432066	2442263	4377544	tRNA	Bacillus_phage(14.29%)	12	NA	NA
WP_007783693.1|2432066_2432531_-	C40 family peptidase	NA	S5MM68	Bacillus_phage	36.9	2.8e-11
WP_007783690.1|2432608_2433355_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	30.7	3.8e-10
WP_004387815.1|2433354_2433906_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_032968130.1|2433935_2434937_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_007676383.1|2435014_2435314_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_007783675.1|2435318_2437706_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	26.0	2.8e-06
WP_007792775.1|2437721_2438705_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	1.4e-33
WP_023898905.1|2438923_2439070_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2439089_2439446_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2439493_2439691_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_012905609.1|2439788_2440331_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.3	1.1e-14
WP_004387090.1|2440334_2442263_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	1.1e-130
>prophage 6
NC_023032	Cronobacter malonaticus, complete sequence	4377544	3337216	3399629	4377544	transposase,integrase,tail,capsid,protease	Cronobacter_phage(40.62%)	89	3343403:3343417	3374080:3374094
WP_007780382.1|3337216_3338536_+|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	27.7	4.5e-06
WP_016246899.1|3339416_3340181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071601457.1|3340642_3341263_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
3343403:3343417	attL	CATATCAAAATCAGG	NA	NA	NA	NA
WP_071601456.1|3343698_3343962_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001295708.1|3343976_3344240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007780320.1|3344784_3345354_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_032986565.1|3345459_3348309_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.1	4.0e-129
WP_023899324.1|3348556_3350374_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	40.8	3.6e-99
WP_001275372.1|3350461_3350920_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_023898324.1|3351282_3352440_+|integrase	tyrosine-type recombinase/integrase	integrase	E5AGD0	Erwinia_phage	73.1	2.1e-164
WP_032986463.1|3352643_3353006_+	GtrA family protein	NA	F1C5B1	Cronobacter_phage	99.2	8.1e-59
WP_032986462.1|3353002_3353920_+	glycosyltransferase family 2 protein	NA	F1C5B0	Cronobacter_phage	96.4	6.6e-166
WP_023899329.1|3353916_3355359_+	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_023899330.1|3355384_3357529_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	73.0	1.1e-54
WP_041461155.1|3357585_3360063_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	89.8	0.0e+00
WP_051401898.1|3360049_3360466_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	90.6	8.6e-73
WP_041461157.1|3360428_3360899_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	94.9	1.3e-80
WP_023899332.1|3360898_3361396_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	96.4	9.6e-95
WP_023899333.1|3361395_3364053_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	73.1	4.7e-71
WP_041461158.1|3364113_3364479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041461159.1|3364475_3364853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104677119.1|3364953_3365259_-	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	54.5	5.4e-24
WP_041461160.1|3365417_3366251_-	phage antirepressor N-terminal domain-containing protein	NA	G0ZNF0	Cronobacter_phage	75.5	4.2e-119
WP_080675968.1|3366323_3366482_-	Arc family DNA-binding protein	NA	A0A077KAX5	Edwardsiella_phage	69.4	6.0e-11
WP_023899335.1|3366582_3366930_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	48.7	3.9e-18
WP_023899336.1|3366935_3367610_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	92.9	1.2e-116
WP_041461161.1|3367661_3368408_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	71.3	7.4e-91
WP_041461162.1|3368434_3368818_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	96.9	9.1e-69
WP_023899338.1|3368814_3369183_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	98.4	1.6e-59
WP_041461163.1|3369184_3369532_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	67.0	1.2e-38
WP_023899340.1|3369599_3369980_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	99.2	4.3e-63
WP_007847581.1|3369982_3370180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023899341.1|3370189_3371281_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	97.8	1.5e-204
WP_007706555.1|3371293_3371722_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	100.0	1.2e-72
WP_041461164.1|3371727_3373128_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	97.6	2.3e-242
WP_041461166.1|3373594_3374569_-|capsid	minor capsid protein	capsid	F1C5D8	Cronobacter_phage	94.6	8.6e-156
3374080:3374094	attR	CCTGATTTTGATATG	NA	NA	NA	NA
WP_023899344.1|3374522_3375980_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	95.2	1.8e-258
WP_023899345.1|3375991_3377464_-	hypothetical protein	NA	I6PBN3	Cronobacter_phage	82.8	5.7e-244
WP_041461167.1|3377463_3377979_-	hypothetical protein	NA	A0A0H5AUE2	Pseudomonas_phage	61.3	6.1e-52
WP_041461210.1|3377988_3378189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038887881.1|3378287_3378974_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	92.5	5.5e-117
WP_023898296.1|3379189_3379378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023898295.1|3379374_3379518_-	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	51.1	4.0e-06
WP_023898294.1|3379519_3379789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007864863.1|3379785_3380040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041461072.1|3380039_3380507_-	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	43.8	4.3e-28
WP_051401895.1|3380503_3380782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007825061.1|3380778_3380985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041461071.1|3381695_3382475_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	80.5	1.3e-106
WP_041461070.1|3382471_3382651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051401894.1|3382647_3382839_-	hypothetical protein	NA	A0A1R3Y5V4	Salmonella_virus	57.1	5.2e-09
WP_032988370.1|3382835_3383231_-	RusA family crossover junction endodeoxyribonuclease	NA	F1C5C9	Cronobacter_phage	99.2	1.5e-71
WP_041461069.1|3383486_3383669_-	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	71.7	2.2e-20
WP_041461068.1|3383661_3384051_-	DUF2591 family protein	NA	G8EYI2	Enterobacteria_phage	55.9	4.3e-26
WP_023898287.1|3384050_3384275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080675961.1|3384264_3384444_-	NinE family protein	NA	Q76H73	Enterobacteria_phage	48.2	2.3e-06
WP_041461067.1|3384419_3384995_-	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.2	4.3e-62
WP_041461066.1|3384991_3385432_-	recombination protein NinB	NA	F1C5C7	Cronobacter_phage	91.8	4.2e-70
WP_023898283.1|3385625_3385874_-	hypothetical protein	NA	U5P0J0	Shigella_phage	53.7	3.7e-07
WP_179944218.1|3385866_3386010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041461197.1|3386011_3386362_-	hypothetical protein	NA	F1C5C6	Cronobacter_phage	97.4	5.4e-60
WP_023898280.1|3386629_3387247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023898279.1|3387274_3388612_-	hypothetical protein	NA	A0A2I7S0U1	Vibrio_phage	36.7	2.9e-77
WP_041461065.1|3388611_3389511_-	replication protein	NA	K7PL20	Enterobacteria_phage	87.7	2.6e-74
WP_144083701.1|3389503_3389650_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	72.9	4.6e-13
WP_041461064.1|3389646_3390444_-	ParB N-terminal domain-containing protein	NA	A0A2H4J902	uncultured_Caudovirales_phage	69.5	1.9e-100
WP_041461063.1|3390492_3390771_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	73.9	1.9e-31
WP_041461168.1|3390883_3391087_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	69.8	3.3e-17
WP_041461169.1|3391190_3391904_+	LexA family transcriptional regulator	NA	A4KWS0	Enterobacteria_phage	62.2	2.5e-80
WP_041461170.1|3391968_3392664_+	hypothetical protein	NA	A0A1P8BL41	Lactococcus_phage	47.5	4.3e-24
WP_041461171.1|3392698_3392890_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	50.0	1.6e-10
WP_041461211.1|3393272_3393623_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	79.8	3.2e-36
WP_041461172.1|3393627_3394362_+	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	90.5	1.7e-39
WP_023899352.1|3394406_3394568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041461173.1|3394568_3394751_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_041461174.1|3394963_3395095_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	65.1	2.6e-07
WP_041461175.1|3395082_3395229_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	65.9	1.6e-10
WP_012125672.1|3395316_3395502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023899354.1|3395509_3396121_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	83.3	3.1e-87
WP_023899355.1|3396120_3396498_+	hypothetical protein	NA	I6S1T0	Salmonella_phage	77.2	5.4e-50
WP_144083714.1|3396521_3396827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_007706444.1|3396837_3396999_+	DUF2737 family protein	NA	A0A1V0E5L8	Salmonella_phage	64.0	5.2e-10
WP_041461177.1|3396995_3397187_+	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	55.9	4.3e-11
WP_023899357.1|3397365_3397845_+	hypothetical protein	NA	F1C5B5	Cronobacter_phage	94.3	8.8e-29
WP_032986685.1|3397837_3398065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023898263.1|3398061_3398349_+	hypothetical protein	NA	G8C7K8	Escherichia_phage	57.7	5.4e-26
WP_023898262.1|3398352_3399090_+	hypothetical protein	NA	A0A088CE95	Shigella_phage	31.7	1.9e-14
WP_041461058.1|3399142_3399397_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	41.3	4.1e-09
WP_007776948.1|3399431_3399629_+	AlpA family phage regulatory protein	NA	K7P7V0	Enterobacteria_phage	77.8	1.9e-22
>prophage 7
NC_023032	Cronobacter malonaticus, complete sequence	4377544	3757505	3771677	4377544	integrase	Enterobacteria_phage(62.5%)	13	3760641:3760654	3771847:3771860
WP_165688901.1|3757505_3758909_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	51.2	1.3e-107
WP_007780908.1|3758954_3760163_-	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	4.6e-34
3760641:3760654	attL	CGAAGGCCGGACTC	NA	NA	NA	NA
WP_041461181.1|3760836_3761532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023899501.1|3761733_3764067_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.0	0.0e+00
WP_041461182.1|3764081_3764402_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_007780902.1|3764398_3764626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041461183.1|3764622_3765174_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	75.9	1.0e-36
WP_023899505.1|3765170_3765437_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	76.1	4.3e-33
WP_023899506.1|3765975_3766719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023899507.1|3766721_3766940_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	62.1	9.5e-15
WP_023899508.1|3766968_3767535_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	7.4e-59
WP_023899509.1|3767873_3770348_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_041461184.1|3770411_3771677_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	8.2e-74
3771847:3771860	attR	CGAAGGCCGGACTC	NA	NA	NA	NA
>prophage 8
NC_023032	Cronobacter malonaticus, complete sequence	4377544	3789035	3850665	4377544	transposase,tRNA,integrase	Stx2-converting_phage(28.57%)	51	3780188:3780219	3863312:3863343
3780188:3780219	attL	CGTAGGGCGGGTAAGCGCAGCGCACCCGCCAT	NA	NA	NA	NA
WP_023899519.1|3789035_3791891_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.0	1.1e-142
WP_023899520.1|3792009_3793212_-	DUF898 family protein	NA	NA	NA	NA	NA
WP_032981092.1|3793406_3793910_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_007780638.1|3793956_3794763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023899522.1|3794807_3795572_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_007798551.1|3795619_3796039_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_007780628.1|3796202_3797207_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_007780625.1|3797438_3797891_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_032983607.1|3798562_3799783_+	arginine deiminase	NA	NA	NA	NA	NA
WP_007780614.1|3799793_3800705_+	carbamate kinase	NA	NA	NA	NA	NA
WP_007780612.1|3800741_3801746_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_023899524.1|3801794_3803198_+	YfcC family protein	NA	NA	NA	NA	NA
WP_007780604.1|3803367_3803847_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012125907.1|3804100_3805036_+	aspartate carbamoyltransferase	NA	M1IFC1	Paramecium_bursaria_Chlorella_virus	39.9	6.5e-52
WP_004388682.1|3805046_3805508_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_004388683.1|3805581_3805968_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000654811.1|3807232_3808201_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_022649395.1|3808324_3809293_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	6.9e-182
WP_041461186.1|3809446_3810772_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	5.5e-113
WP_016151347.1|3812015_3812537_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_004118237.1|3812533_3813487_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_007898891.1|3813573_3815898_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_007898890.1|3815942_3816845_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|3816841_3817840_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118246.1|3817836_3818793_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	5.3e-17
WP_004152282.1|3818793_3819561_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_007898888.1|3819659_3819953_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.9	4.7e-49
WP_007898884.1|3820283_3820562_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000427623.1|3820823_3821828_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032435706.1|3822231_3823224_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_007851507.1|3823593_3824676_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	98.1	6.5e-189
WP_007894989.1|3824797_3827872_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.8	0.0e+00
WP_003846917.1|3827923_3829177_+	lactose permease	NA	NA	NA	NA	NA
WP_017384068.1|3830260_3831394_-	glutathione-independent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_022649401.1|3831825_3832152_+	four-helix bundle copper-binding protein	NA	NA	NA	NA	NA
WP_007897903.1|3833254_3833914_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_099975484.1|3834208_3835051_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017384065.1|3836081_3836957_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_041461187.1|3837039_3837393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839182.1|3837391_3837796_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_000612626.1|3837792_3838140_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_016247073.1|3838188_3839727_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.5	1.8e-280
WP_080675970.1|3839633_3840062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157698488.1|3840027_3840438_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017384063.1|3840697_3841822_+	alkene reductase	NA	NA	NA	NA	NA
WP_032622084.1|3841917_3842226_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017384060.1|3843551_3843980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017384059.1|3843983_3846101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897920.1|3846088_3847855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007897923.1|3847841_3849089_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_088765901.1|3849461_3850665_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.5	8.8e-102
3863312:3863343	attR	ATGGCGGGTGCGCTGCGCTTACCCGCCCTACG	NA	NA	NA	NA
