The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_HG738867	Escherichia coli str. K-12 substr. MC4100 strain K-12	4527247	421121	484080	4527247	transposase,lysis,tRNA,protease,terminase,integrase	Enterobacteria_phage(50.0%)	66	466738:466784	488040:488086
WP_001295836.1|421121_421745_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|421715_422402_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|422398_424813_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|425243_429524_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|429563_429932_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|430622_430883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297301.1|430939_431113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|432114_433209_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|433277_434204_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|434433_434916_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|434993_435809_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|435898_437680_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|437692_438469_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|438568_439447_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|439615_441070_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|441129_442491_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|442547_443849_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|443870_445016_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|445243_446029_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|446039_447275_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|447296_448346_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|448662_450330_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|450339_451599_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|451609_452425_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|452421_453315_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|453509_454577_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|454573_455083_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|455200_455923_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|455925_456420_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|456593_457979_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|458014_458536_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|458643_458856_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|458857_459724_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|460194_460737_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|460956_461649_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|461679_464283_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|464261_465302_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|465312_465828_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|465830_466463_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
466738:466784	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|466797_467961_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|468080_468344_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|468666_468762_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|468824_469986_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|470297_470630_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|470677_470827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|470884_472411_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|472875_473427_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|473436_474234_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|474350_474452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|474448_474904_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|474903_475074_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|475066_475357_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|475353_475716_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|475712_475853_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|475938_476322_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|476719_477736_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|477740_478808_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|479380_479596_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|479595_480093_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|480309_480492_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|480582_480876_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|481166_481577_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|481862_482069_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|482233_482428_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|482816_483362_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|483336_484080_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
488040:488086	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
NZ_HG738867	Escherichia coli str. K-12 substr. MC4100 strain K-12	4527247	1295091	1359038	4527247	tRNA,tail,transposase,lysis	Escherichia_phage(40.62%)	60	NA	NA
WP_000628058.1|1295091_1296324_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1296578_1297562_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1298039_1299413_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1299541_1300477_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1300528_1301764_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1301765_1301981_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1302059_1302269_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1302261_1302456_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1302512_1303322_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1303314_1305915_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1306016_1306292_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1306366_1306537_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1306536_1306758_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1307199_1307688_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1307684_1307840_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1308293_1308770_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1308893_1309190_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1309212_1309635_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1309647_1310505_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1310511_1311258_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1311280_1311841_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1311928_1312114_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1312310_1313768_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1313905_1314169_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1314149_1314509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1316274_1317255_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000279097.1|1317577_1320940_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1320939_1321515_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1321612_1322203_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1322519_1322753_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1322821_1322935_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1323713_1324148_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1324288_1325422_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|1325788_1329313_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1329586_1329853_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1329849_1330272_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|1330382_1331372_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_000900941.1|1331579_1334219_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1334215_1334401_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|1334408_1334735_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|1334906_1335812_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1336047_1337547_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|1337604_1339878_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|1340125_1342171_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|1342455_1343385_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1343396_1343684_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|1343692_1344439_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|1344453_1344951_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|1344958_1346029_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|1346025_1346793_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|1346792_1347581_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|1347582_1349010_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1348999_1349422_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|1349421_1350627_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|1350653_1351967_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|1352067_1353018_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|1352999_1353590_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|1353693_1353759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|1356449_1357678_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001254938.1|1357886_1359038_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
>prophage 3
NZ_HG738867	Escherichia coli str. K-12 substr. MC4100 strain K-12	4527247	1517981	1537192	4527247	tail,lysis	Enterobacteria_phage(40.91%)	35	NA	NA
WP_000527743.1|1517981_1519442_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1519530_1520814_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1521418_1521532_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1521600_1521834_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|1522150_1522741_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1522838_1523414_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1523413_1524376_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1524326_1524896_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1525284_1525518_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1525575_1525986_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1526137_1526311_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1526482_1526638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1526716_1526782_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1526784_1526973_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1526983_1527196_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1527558_1528056_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1528052_1528586_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1528582_1528894_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1528898_1529114_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1529867_1530083_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1530383_1530596_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1530650_1530740_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1531017_1531770_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1531783_1532833_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1532834_1533113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1533179_1533431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1533647_1533803_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1533874_1534162_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1534161_1534401_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1534425_1534731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1534933_1535266_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1535702_1535852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1536148_1536379_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1536462_1536870_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1537036_1537192_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
>prophage 4
NZ_HG738867	Escherichia coli str. K-12 substr. MC4100 strain K-12	4527247	1996178	2004849	4527247		Escherichia_phage(28.57%)	8	NA	NA
WP_000272486.1|1996178_1997282_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	59.5	1.0e-133
WP_001393538.1|1997289_1998537_-	O16 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100981.1|1998533_1999091_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	7.8e-53
WP_000783975.1|1999090_1999972_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	1.9e-106
WP_001023610.1|2000029_2000929_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	1.5e-29
WP_000699460.1|2000928_2002014_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	5.2e-101
WP_000183060.1|2002386_2003280_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116026.1|2003454_2004849_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 5
NZ_HG738867	Escherichia coli str. K-12 substr. MC4100 strain K-12	4527247	2347573	2358783	4527247	tail,integrase	Enterobacteria_phage(53.33%)	16	2345548:2345564	2362458:2362474
2345548:2345564	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2347573_2348506_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2348817_2349975_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2350127_2350490_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_000703651.1|2350486_2351407_+	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	89.9	4.2e-160
WP_001030215.1|2351403_2352735_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2352769_2353051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2353349_2353790_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2353816_2354335_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2354384_2354660_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2354659_2355154_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2355876_2356239_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2356304_2357129_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2357256_2357793_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2357783_2358146_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2358145_2358451_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2358582_2358783_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2362458:2362474	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_HG738867	Escherichia coli str. K-12 substr. MC4100 strain K-12	4527247	3919549	3926688	4527247		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|3919549_3920188_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001393459.1|3920279_3921446_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_000848004.1|3921442_3922351_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001300386.1|3922546_3923314_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141337.1|3923364_3924021_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001272928.1|3924126_3926688_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
