The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	715222	790914	4178958	tRNA,transposase	uncultured_virus(33.33%)	60	NA	NA
WP_001091151.1|715222_716152_-|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_069597322.1|716157_716937_+	C39 family peptidase	NA	NA	NA	NA	NA
WP_000114388.1|717002_718163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002023213.1|718175_719840_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_031982938.1|719833_721183_+	putative pilus assembly protein FilE	NA	NA	NA	NA	NA
WP_001035103.1|721202_723152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000006663.1|723207_723756_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_002000136.1|723870_724497_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_002000137.1|724519_725047_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000770261.1|725179_725845_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000548447.1|725856_726648_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_076611834.1|727180_727976_-|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
WP_001176409.1|729080_729926_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000843456.1|729931_730204_-	DUF2218 domain-containing protein	NA	A0A218MNG7	uncultured_virus	45.3	8.3e-08
WP_000043044.1|730388_731075_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_076611834.1|731600_732395_+|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
WP_000174927.1|733230_733626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018555.1|733666_735601_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_002000140.1|735614_736343_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_085916994.1|736575_737367_+	cation transporter	NA	NA	NA	NA	NA
WP_000312237.1|737516_737837_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000927482.1|737848_738328_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.9	4.5e-25
WP_000268130.1|738464_739685_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_001278262.1|739831_740896_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_000629041.1|741628_742624_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000843791.1|743025_744201_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_001232140.1|744305_745253_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001016269.1|745498_746719_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001058259.1|746944_748267_+	MFS transporter	NA	NA	NA	NA	NA
WP_000501144.1|748319_749549_+	CoA transferase	NA	NA	NA	NA	NA
WP_000994352.1|749653_750787_-	tricarballylate utilization 4Fe-4S protein TcuB	NA	NA	NA	NA	NA
WP_000543965.1|750776_752183_-	FAD-dependent tricarballylate dehydrogenase TcuA	NA	NA	NA	NA	NA
WP_000421125.1|752286_753216_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_169538971.1|753348_754122_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000383637.1|754235_755546_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.9	1.5e-49
WP_000403826.1|755824_756754_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001012244.1|757053_758439_+	long-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_001033443.1|758472_759840_+	amidohydrolase	NA	NA	NA	NA	NA
WP_001136630.1|759896_760904_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_081400949.1|761119_762145_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_000807285.1|762246_762855_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000572816.1|763110_763983_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000031355.1|764349_765336_+	DUF1852 domain-containing protein	NA	NA	NA	NA	NA
WP_000735356.1|765357_766401_+	methionine synthase	NA	NA	NA	NA	NA
WP_000249482.1|766586_767078_+	flavin reductase	NA	NA	NA	NA	NA
WP_002019316.1|767760_768315_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001019260.1|768490_771178_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001103908.1|771759_772623_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000208331.1|772847_773741_+	PhzF family isomerase	NA	NA	NA	NA	NA
WP_000470118.1|774055_776980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001083481.1|778044_778404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|778528_779458_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_069597324.1|779493_780321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102827.1|780505_782917_-	membrane-bound PQQ-dependent dehydrogenase, glucose/quinate/shikimate family	NA	NA	NA	NA	NA
WP_000999624.1|783221_783566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000820340.1|784221_785226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|786053_786983_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_001090935.1|787089_787269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001156616.1|787343_789350_-	TniQ family protein	NA	NA	NA	NA	NA
WP_076611834.1|790118_790914_-|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	989247	1003778	4178958		Acinetobacter_phage(61.54%)	23	NA	NA
WP_000660939.1|989247_989946_-	LexA family transcriptional regulator	NA	A0A0P0IYD9	Acinetobacter_phage	35.8	7.8e-26
WP_000335916.1|990082_990316_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000818521.1|990348_990723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290738.1|990756_990957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200037.1|990953_991139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000575725.1|991135_991591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001205618.1|991587_992226_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	46.2	1.1e-47
WP_001092750.1|992231_993902_+	DNA cytosine methyltransferase	NA	Q5QF27	Pseudomonas_virus	46.2	2.4e-153
WP_020752534.1|993898_994945_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	57.9	4.5e-110
WP_001110396.1|994941_995892_+	YdaU family protein	NA	A0A0P0I481	Acinetobacter_phage	64.2	2.9e-100
WP_000544506.1|995884_996634_+	hypothetical protein	NA	A0A0N7IRF0	Acinetobacter_phage	98.4	1.2e-136
WP_001031749.1|996630_996765_+	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
WP_000648413.1|996751_997174_+	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_095357150.1|997223_997586_+	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	3.3e-68
WP_002052057.1|997657_998728_+	site-specific DNA-methyltransferase	NA	A0A1B0VM49	Pseudomonas_phage	59.6	4.6e-110
WP_000124472.1|998804_999848_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	52.8	4.3e-28
WP_000994861.1|999844_1000609_+	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	48.8	1.0e-63
WP_000991088.1|1000605_1001139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836736.1|1001135_1001867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000977810.1|1001863_1002235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000995576.1|1002231_1002639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875513.1|1002635_1002920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172116.1|1002998_1003778_+	hypothetical protein	NA	A0A0P0J0C5	Acinetobacter_phage	32.4	3.8e-29
>prophage 3
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	1088971	1157439	4178958	holin,transposase,protease	Vibrio_phage(20.0%)	58	NA	NA
WP_001021934.1|1088971_1090630_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.1	2.7e-56
WP_001286309.1|1090725_1092198_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001985959.1|1092190_1092826_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000243382.1|1093078_1094701_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.6	1.8e-20
WP_000179784.1|1094818_1096885_+|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	25.1	2.0e-16
WP_000254582.1|1096896_1097511_+	MarC family protein	NA	NA	NA	NA	NA
WP_001142469.1|1097772_1098288_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000761577.1|1098398_1098599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000766464.1|1099097_1100096_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_001091151.1|1100822_1101752_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_001185269.1|1102616_1103147_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000627259.1|1103233_1103575_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000632823.1|1103811_1105806_+	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000151613.1|1105819_1107079_+	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_002000370.1|1107176_1107581_+	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000070455.1|1107683_1108472_-	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_001091151.1|1108565_1109495_-|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000074692.1|1109751_1110333_+	nicotinamide mononucleotide transporter	NA	A0A2H4YHF9	Raoultella_phage	28.6	1.4e-07
WP_000927126.1|1110347_1110647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000051057.1|1110692_1111505_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000118514.1|1111778_1112084_+	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_000714349.1|1112111_1112411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991783.1|1112427_1113495_+	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_000627776.1|1114263_1115193_+	VOC family protein	NA	NA	NA	NA	NA
WP_000411870.1|1115222_1116434_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000064049.1|1116476_1117700_+	MFS transporter	NA	NA	NA	NA	NA
WP_000211626.1|1117723_1118245_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000988614.1|1118280_1119105_+	alpha/beta hydrolase	NA	A0A249XPN5	Mycobacterium_phage	31.3	5.2e-13
WP_000009973.1|1119120_1119915_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.6	8.6e-13
WP_000735778.1|1119930_1120722_+	aspartate dehydrogenase	NA	NA	NA	NA	NA
WP_001040562.1|1120735_1122202_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000140233.1|1122240_1123881_+	thiamine pyrophosphate-binding protein	NA	E5EQ70	Micromonas_sp._RCC1109_virus	23.8	9.1e-25
WP_002000879.1|1124057_1125233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371873.1|1125295_1126594_-	MFS transporter	NA	NA	NA	NA	NA
WP_000117812.1|1126828_1127311_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.7	3.7e-19
WP_000856712.1|1127489_1128812_+	glutaminase	NA	NA	NA	NA	NA
WP_001285132.1|1128778_1129567_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002000875.1|1129691_1130894_+	MFS transporter	NA	NA	NA	NA	NA
WP_000731749.1|1130961_1132107_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_001016338.1|1132298_1132745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002000873.1|1132756_1133632_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000926498.1|1133816_1134566_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002027382.1|1134614_1135943_+	MFS transporter	NA	NA	NA	NA	NA
WP_000935661.1|1135962_1136808_+	transketolase	NA	NA	NA	NA	NA
WP_000080253.1|1136818_1137823_+	transketolase	NA	NA	NA	NA	NA
WP_000105333.1|1137903_1141590_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	60.0	3.3e-14
WP_115423553.1|1142153_1143683_+	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_000994873.1|1143849_1145184_+	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000098357.1|1145227_1146775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854551.1|1147311_1147476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085917000.1|1147585_1148485_-	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_000875353.1|1148589_1150266_-	arylsulfatase	NA	NA	NA	NA	NA
WP_000902940.1|1150436_1151054_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000102721.1|1151211_1151850_+	Fe-S biogenesis protein NfuA	NA	NA	NA	NA	NA
WP_000044170.1|1152019_1154284_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_000107246.1|1154306_1155314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197531.1|1155340_1156366_-	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	31.0	6.5e-05
WP_001091151.1|1156509_1157439_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	1219347	1231695	4178958		Acinetobacter_phage(95.65%)	24	NA	NA
WP_000004579.1|1219347_1220070_-	hypothetical protein	NA	A0A0P0HSE1	Acinetobacter_phage	88.2	1.7e-55
WP_000147323.1|1220066_1220474_-	hypothetical protein	NA	A0A0P0IRG7	Acinetobacter_phage	52.2	7.5e-13
WP_000654846.1|1220474_1220726_-	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	6.4e-39
WP_000698529.1|1220727_1221660_-	hypothetical protein	NA	A0A0P0I438	Acinetobacter_phage	80.0	2.2e-137
WP_001207474.1|1221656_1222778_-	ATP-binding protein	NA	A0A0N7IRE0	Acinetobacter_phage	99.5	2.8e-211
WP_000064463.1|1222789_1223113_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	95.3	4.8e-55
WP_000656405.1|1223105_1223396_-	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_001101038.1|1223395_1223839_-	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000051960.1|1224032_1224275_+	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_000845537.1|1224281_1224485_-	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_001129676.1|1224623_1225127_-	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000048052.1|1225128_1226136_-	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_000370485.1|1226187_1226403_-	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000052252.1|1226417_1227170_-	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000703023.1|1227274_1227463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000048916.1|1227473_1227794_+	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_001180660.1|1227855_1228128_+	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	90.0	7.2e-36
WP_000602535.1|1228199_1228424_+	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	97.3	3.2e-34
WP_000064627.1|1228416_1229298_+	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	95.2	3.3e-138
WP_001003671.1|1229300_1230101_+	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	95.5	2.8e-144
WP_000647826.1|1230097_1230436_+	hypothetical protein	NA	A0A0P0IKW4	Acinetobacter_phage	56.3	1.1e-30
WP_000462878.1|1230428_1230821_+	hypothetical protein	NA	J7HXM5	Acinetobacter_phage	57.8	1.2e-07
WP_000100162.1|1230820_1231222_+	DUF559 domain-containing protein	NA	A0A0P0I8E8	Acinetobacter_phage	96.2	2.6e-66
WP_001277128.1|1231218_1231695_+	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	40.3	1.2e-25
>prophage 5
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	1235653	1264327	4178958	capsid,terminase	Acinetobacter_phage(93.55%)	38	NA	NA
WP_001136773.1|1235653_1236109_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	95.4	2.7e-80
WP_000378523.1|1236169_1236604_+	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	84.7	7.4e-67
WP_000435230.1|1236572_1237214_+	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	88.7	6.3e-115
WP_000729387.1|1237272_1237788_+	DUF2280 domain-containing protein	NA	A0A1B1P9C2	Acinetobacter_phage	61.3	3.2e-45
WP_001132930.1|1237747_1239040_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	86.0	6.4e-215
WP_000301495.1|1239079_1240420_+	DUF4055 domain-containing protein	NA	A0A0P0IDW1	Acinetobacter_phage	92.2	3.4e-235
WP_000146970.1|1240429_1241536_+|capsid	minor capsid protein	capsid	A0A0P0IR98	Acinetobacter_phage	90.2	2.1e-190
WP_000004550.1|1241532_1241763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291451.1|1241778_1241931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000589038.1|1241982_1242297_+	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	50.5	5.2e-14
WP_000056390.1|1242383_1243175_+	hypothetical protein	NA	A0A0P0J090	Acinetobacter_phage	74.2	2.3e-90
WP_000852265.1|1243188_1244139_+	hypothetical protein	NA	A0A0P0HSG2	Acinetobacter_phage	94.9	3.7e-172
WP_000524488.1|1244183_1244519_+	hypothetical protein	NA	A0A0N7IRE4	Acinetobacter_phage	100.0	2.7e-53
WP_000008459.1|1244522_1244903_+	hypothetical protein	NA	A0A0P0IVQ3	Acinetobacter_phage	84.9	6.9e-53
WP_000524257.1|1244903_1245272_+	hypothetical protein	NA	J7I467	Acinetobacter_phage	92.6	8.7e-61
WP_000540685.1|1245340_1245538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000235282.1|1245545_1245839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000248411.1|1245890_1246301_+	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	73.3	7.7e-50
WP_000539749.1|1246272_1246641_+	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	82.8	2.0e-52
WP_001984404.1|1246597_1247041_+	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	94.6	2.0e-75
WP_001277696.1|1247042_1247261_+	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_000749909.1|1247369_1247891_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000064593.1|1247987_1248341_+	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000002408.1|1248340_1249519_+	hypothetical protein	NA	A0A0D4DCQ4	Acinetobacter_phage	66.3	1.2e-103
WP_000094278.1|1249571_1250489_+	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_001185585.1|1250558_1251074_+	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000335868.1|1251576_1251876_+	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_000274931.1|1251884_1252343_+	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000721572.1|1252447_1253128_+	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_001275792.1|1253129_1253393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000046573.1|1253520_1257831_+	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	98.3	0.0e+00
WP_000721057.1|1257921_1258509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277448.1|1258601_1259000_+	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	97.7	4.1e-72
WP_000368388.1|1258999_1259506_+	DUF1833 family protein	NA	J7HXQ5	Acinetobacter_phage	97.0	1.5e-90
WP_000835160.1|1259502_1259865_+	hypothetical protein	NA	A0A0P0J0A2	Acinetobacter_phage	79.2	8.1e-51
WP_000598554.1|1259857_1263283_+	hypothetical protein	NA	A0A0P0HSH9	Acinetobacter_phage	94.2	0.0e+00
WP_000433907.1|1263350_1263740_+	hypothetical protein	NA	A0A0P0I8L9	Acinetobacter_phage	99.2	3.3e-66
WP_001019739.1|1263781_1264327_+	N-acetylmuramidase	NA	A0A0B5L5G7	Acinetobacter_phage	100.0	4.7e-103
>prophage 6
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	1308932	1373201	4178958	tRNA,integrase,transposase	Escherichia_phage(38.89%)	55	1308750:1308769	1349323:1349342
1308750:1308769	attL	TCACCGCTTCCGCCAAATTC	NA	NA	NA	NA
WP_000213120.1|1308932_1310147_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	38.0	6.9e-62
WP_001046004.1|1312438_1313260_-	carbapenem-hydrolyzing class D beta-lactamase OXA-23	NA	NA	NA	NA	NA
WP_085940648.1|1313358_1314448_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_076611834.1|1314821_1315616_+|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
WP_069597335.1|1316186_1316663_+	AAC(3)-I family aminoglycoside N-acetyltransferase	NA	NA	NA	NA	NA
WP_000782440.1|1317795_1318149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000888567.1|1318269_1318536_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000253101.1|1318555_1318846_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_000862187.1|1319044_1320022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003115445.1|1320131_1321064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115446.1|1321688_1322567_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000104071.1|1322892_1323150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457345.1|1323181_1323937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887398.1|1324049_1324430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001982733.1|1324504_1324771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001982734.1|1324837_1325584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115447.1|1325642_1326377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003115448.1|1326456_1327101_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000940839.1|1327968_1329009_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	39.8	2.5e-60
WP_001069149.1|1329097_1330189_+	YqaJ viral recombinase family protein	NA	A0A139ZPJ9	Marinitoga_camini_virus	36.6	3.6e-46
WP_003115449.1|1330328_1331225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003115451.1|1331579_1332176_-	putative adenosine monophosphate-protein transferase Fic	NA	NA	NA	NA	NA
WP_000935322.1|1332188_1332359_-	DUF2559 family protein	NA	NA	NA	NA	NA
WP_003115452.1|1332660_1334946_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	25.3	2.0e-30
WP_069597337.1|1334945_1336298_+	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	35.2	2.6e-09
WP_003114529.1|1336294_1339543_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_003114527.1|1339591_1341652_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_003114525.1|1341670_1342402_+	OmpA family protein	NA	NA	NA	NA	NA
WP_003114524.1|1342407_1343778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233088.1|1347251_1347908_+	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_003112112.1|1347907_1348993_+	macro domain-containing protein	NA	B0FIJ9	Escherichia_phage	41.5	8.4e-19
WP_001067855.1|1350025_1350730_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
1349323:1349342	attR	TCACCGCTTCCGCCAAATTC	NA	NA	NA	NA
WP_001277461.1|1350741_1351050_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000281124.1|1351067_1352750_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.0	7.4e-38
WP_000523860.1|1352788_1353196_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732277.1|1353223_1353505_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294665.1|1353520_1353871_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429724.1|1353942_1354398_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_075911820.1|1354464_1355553_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_000983249.1|1355539_1356325_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_000376623.1|1356500_1357001_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|1357128_1357968_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|1357961_1358309_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001067855.1|1358976_1359681_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001109644.1|1360550_1361102_+	AAC(6')-Ia family aminoglycoside 6'-N-acetyltransferase AacA16	NA	NA	NA	NA	NA
WP_001067855.1|1361633_1362338_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067858.1|1363178_1363883_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|1364564_1365425_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_050582401.1|1365607_1366123_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.8	9.3e-85
WP_001067858.1|1366181_1366886_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000735756.1|1367626_1368016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000495837.1|1368081_1368648_+	ribonuclease HII	NA	E3T5H8	Cafeteria_roenbergensis_virus	41.9	7.0e-25
WP_000906487.1|1368717_1368972_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	8.8e-12
WP_001185176.1|1369218_1370499_-	aspartate kinase	NA	NA	NA	NA	NA
WP_000199457.1|1370564_1373201_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	38.6	1.8e-75
>prophage 7
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	1424185	1480503	4178958	tRNA,transposase	Acinetobacter_phage(33.33%)	59	NA	NA
WP_001091151.1|1424185_1425115_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_148661298.1|1425126_1425336_-	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	61.5	7.2e-12
WP_000253377.1|1425777_1426371_+	LysE family transporter	NA	NA	NA	NA	NA
WP_000825869.1|1426421_1426646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000998196.1|1426870_1427065_-	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_001283231.1|1427057_1428320_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	23.8	1.9e-14
WP_000636785.1|1428825_1429059_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001185374.1|1429210_1429882_-	LexA family transcriptional regulator	NA	A0A1B1P9J5	Acinetobacter_phage	55.2	3.1e-64
WP_000016214.1|1430117_1430315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000427184.1|1430482_1430872_+	hypothetical protein	NA	A0A0P0IVR6	Acinetobacter_phage	74.4	1.1e-48
WP_001019691.1|1430909_1431455_+	N-acetylmuramidase	NA	A0A0N7IRF5	Acinetobacter_phage	72.9	7.8e-74
WP_000015964.1|1431521_1432139_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000072673.1|1432658_1432874_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	65.0	7.7e-17
WP_000350297.1|1433077_1433302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932369.1|1433581_1434397_+	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001982898.1|1434553_1434673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|1435553_1436483_-|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_171259283.1|1436498_1436648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004676.1|1436939_1437284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940413.1|1437546_1438636_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_000648017.1|1439671_1440886_-	MFS transporter	NA	NA	NA	NA	NA
WP_001133965.1|1440997_1441444_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001210983.1|1441530_1441860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000157563.1|1441873_1442020_+	hypothetical protein	NA	A0A0B5KTG2	Acinetobacter_phage	100.0	3.4e-08
WP_000644342.1|1442599_1443193_+	DUF4142 domain-containing protein	NA	NA	NA	NA	NA
WP_000248356.1|1443577_1444207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001182287.1|1444707_1446129_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	30.6	3.3e-55
WP_001133555.1|1446342_1447320_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	31.7	9.5e-38
WP_000179338.1|1447323_1447863_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_000381220.1|1447900_1448449_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000554244.1|1448432_1448981_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_001183458.1|1448980_1449727_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.9	3.1e-20
WP_015451474.1|1450244_1451468_+	TolC family protein	NA	NA	NA	NA	NA
WP_000988402.1|1451464_1453606_+	type I secretion system permease/ATPase	NA	W8CYL7	Bacillus_phage	24.7	2.7e-29
WP_000003555.1|1453602_1454793_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000885988.1|1454885_1455485_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.6	5.0e-21
WP_000132359.1|1455477_1456089_+	chloramphenicol acetyltransferase CAT	NA	M1HKK6	Paramecium_bursaria_Chlorella_virus	55.6	1.6e-11
WP_001082436.1|1456244_1457087_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	33.9	2.6e-36
WP_001186835.1|1457203_1457872_-	O-methyltransferase	NA	W8CYT3	Bacillus_phage	42.5	7.5e-26
WP_000232555.1|1458011_1458683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000144889.1|1458863_1459187_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_049081181.1|1459531_1460062_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001083258.1|1460126_1462772_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	24.9	1.5e-32
WP_001290075.1|1463046_1463514_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000972446.1|1463632_1464493_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000633291.1|1464999_1466349_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000165398.1|1466479_1467412_+	lauroyl acyltransferase	NA	A0A1W6JP29	Morganella_phage	34.7	1.0e-41
WP_001143900.1|1467998_1468640_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000659382.1|1468903_1470208_+	MFS transporter	NA	NA	NA	NA	NA
WP_000760336.1|1470302_1470740_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_000925260.1|1471077_1472106_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000185557.1|1472315_1473014_-	DUF1826 domain-containing protein	NA	NA	NA	NA	NA
WP_000398507.1|1473265_1474216_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001984101.1|1474373_1474568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001127331.1|1474820_1475279_+	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	45.1	6.9e-31
WP_000406277.1|1475372_1475801_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001091151.1|1476560_1477490_-|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_001989630.1|1477805_1479050_-	serine hydrolase	NA	NA	NA	NA	NA
WP_001091151.1|1479573_1480503_-|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	1511582	1543347	4178958	plate,transposase	Leptospira_phage(50.0%)	27	NA	NA
WP_001091151.1|1511582_1512512_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_001000631.1|1512688_1512814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118704.1|1512818_1513253_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000916831.1|1513265_1515077_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_000591252.1|1515073_1516096_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001000089.1|1516147_1517029_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.2	1.1e-37
WP_000542525.1|1517028_1517973_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000070792.1|1518068_1518470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000753551.1|1520143_1521703_-|transposase	IS66-like element ISAba24 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	4.0e-70
WP_000781558.1|1521795_1522152_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.9	1.6e-22
WP_000555098.1|1522154_1522439_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002029293.1|1523027_1523711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119042.1|1523727_1524231_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001066523.1|1524223_1525705_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000653195.1|1525754_1526258_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001047031.1|1526337_1526814_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000568832.1|1526830_1528642_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001190395.1|1528605_1529604_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000591882.1|1529600_1531013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000556914.1|1531043_1534868_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000557241.1|1534905_1535865_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_001072410.1|1535867_1536635_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000168112.1|1536651_1536915_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001091151.1|1537002_1537932_-|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_002001416.1|1538166_1540848_+	type VI secretion system ATPase TssH	NA	A0A248SJW6	Salicola_phage	30.8	1.3e-81
WP_000020713.1|1540871_1541966_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000471445.1|1541982_1543347_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 9
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	1667698	1726936	4178958	transposase	uncultured_Caudovirales_phage(20.0%)	56	NA	NA
WP_001091151.1|1667698_1668628_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_001091151.1|1668714_1669644_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000371197.1|1670101_1671208_+	stress-induced protein	NA	NA	NA	NA	NA
WP_000795915.1|1671268_1671505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001124846.1|1671787_1672399_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	57.9	2.2e-48
WP_000885229.1|1672469_1673081_-	LysE family translocator	NA	NA	NA	NA	NA
WP_000376215.1|1673237_1673693_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001990047.1|1673751_1675398_-	allantoin permease	NA	NA	NA	NA	NA
WP_001091151.1|1676239_1677169_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000107128.1|1680056_1681016_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_001025680.1|1681159_1681444_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_002017921.1|1681553_1681667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937460.1|1681755_1682391_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000418064.1|1682380_1683046_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001130362.1|1683048_1683780_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	5.6e-35
WP_000476783.1|1683810_1684671_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000209985.1|1684753_1685620_+	cysteine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001990052.1|1685670_1685790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001990053.1|1685867_1686803_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000267781.1|1686894_1687533_+	LysE family translocator	NA	NA	NA	NA	NA
WP_000211581.1|1687999_1689961_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.5	5.0e-94
WP_001107594.1|1689935_1690868_-	hypothetical protein	NA	A0A2K9L2D2	Tupanvirus	35.7	2.2e-44
WP_001990056.1|1691108_1692050_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000992243.1|1692068_1692578_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001027014.1|1692816_1693554_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000357072.1|1693679_1694600_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001285211.1|1694637_1695498_-	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_001058575.1|1695531_1696158_-	glutathione transferase	NA	NA	NA	NA	NA
WP_000949917.1|1696277_1697183_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014538333.1|1697341_1697725_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_001028710.1|1697738_1698428_+	LrgB family protein	NA	NA	NA	NA	NA
WP_000113406.1|1698435_1699926_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	29.4	4.2e-21
WP_000275765.1|1700041_1700677_+	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_000060340.1|1700719_1701313_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000941182.1|1701320_1702508_-	MFS transporter	NA	NA	NA	NA	NA
WP_000399243.1|1702912_1704592_+	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_000968300.1|1704591_1705476_+	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_000448953.1|1705478_1705778_+	malonate decarboxylase subunit delta	NA	NA	NA	NA	NA
WP_000129859.1|1705770_1706622_+	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_001017580.1|1706618_1707446_+	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_000245150.1|1707436_1708045_+	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_000146913.1|1708057_1708996_+	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_000587906.1|1709044_1709464_+	malonate transporter subunit MadL	NA	NA	NA	NA	NA
WP_000229914.1|1709456_1710221_+	malonate transporter subunit MadM	NA	NA	NA	NA	NA
WP_000401807.1|1710270_1711188_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000278269.1|1711285_1712704_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000749814.1|1712802_1712937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000566431.1|1712951_1713956_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000052002.1|1713948_1715394_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_000471028.1|1716047_1716866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000183279.1|1716984_1718280_+	monooxygenase	NA	NA	NA	NA	NA
WP_001091151.1|1719744_1720674_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000107057.1|1721076_1722543_+	MFS transporter	NA	NA	NA	NA	NA
WP_076611834.1|1723745_1724541_-|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
WP_148661299.1|1725106_1726090_+	taurine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_076611834.1|1726141_1726936_+|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	1736803	1795345	4178958	transposase	uncultured_Caudovirales_phage(28.57%)	54	NA	NA
WP_076611834.1|1736803_1737599_-|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
WP_000784879.1|1737729_1737891_+	DUF1427 family protein	NA	NA	NA	NA	NA
WP_000138008.1|1737959_1738388_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	59.1	2.6e-40
WP_000610147.1|1738472_1738802_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.2	5.8e-24
WP_001990083.1|1738906_1739941_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_069597345.1|1740031_1740934_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001017024.1|1741035_1741596_+	chromate transporter	NA	NA	NA	NA	NA
WP_000501457.1|1741595_1742117_+	chromate transporter	NA	NA	NA	NA	NA
WP_000558747.1|1742273_1743860_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JK46	Lactococcus_phage	30.8	1.4e-25
WP_000498041.1|1743913_1745920_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_001988472.1|1746036_1746918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917698.1|1747081_1747897_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_014462776.1|1747889_1748705_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_001160989.1|1748743_1752307_-	DNA polymerase III subunit alpha	NA	A0A291AVG1	Streptomyces_phage	34.6	6.7e-174
WP_000956444.1|1752521_1753589_-	type II asparaginase	NA	NA	NA	NA	NA
WP_000810598.1|1754271_1755579_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_000078703.1|1756045_1757476_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_000521160.1|1757716_1758136_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000066032.1|1758132_1758618_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	39.6	3.0e-24
WP_000535310.1|1758617_1759463_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000451663.1|1759527_1760160_+	LysE family translocator	NA	NA	NA	NA	NA
WP_001983957.1|1760217_1761387_-	succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000611178.1|1761412_1764076_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_002000338.1|1764103_1765321_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000084510.1|1765423_1765813_-	tautomerase family protein	NA	NA	NA	NA	NA
WP_001091151.1|1765868_1766798_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_001047279.1|1766973_1767315_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000741226.1|1767316_1768039_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_000477056.1|1768158_1768629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000736695.1|1768701_1769037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348839.1|1769209_1769920_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000067187.1|1770012_1770534_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_000506572.1|1770578_1771670_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001153955.1|1771763_1772423_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001986595.1|1772403_1773480_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.8	1.7e-35
WP_001007359.1|1773485_1774319_-	methionine transporter	NA	NA	NA	NA	NA
WP_000079412.1|1774332_1775163_-	methionine transporter	NA	NA	NA	NA	NA
WP_000753083.1|1775177_1776590_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000205204.1|1776589_1777813_-	SfnB family sulfur acquisition oxidoreductase	NA	NA	NA	NA	NA
WP_000125339.1|1777825_1779061_-	SfnB family sulfur acquisition oxidoreductase	NA	NA	NA	NA	NA
WP_001265503.1|1779406_1780171_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_001091151.1|1780284_1781214_-|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000830362.1|1781740_1782634_+	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000110649.1|1782728_1783571_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001132006.1|1784263_1785007_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.2	8.0e-29
WP_138140449.1|1785058_1786354_-	DcaP-like protein	NA	NA	NA	NA	NA
WP_000418050.1|1786720_1787191_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000907230.1|1787221_1787971_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000713973.1|1788133_1788679_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_000037157.1|1788864_1789425_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001091151.1|1790041_1790971_-|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_079882011.1|1791043_1791577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|1791603_1792533_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_001091151.1|1794415_1795345_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	1870286	1918955	4178958	integrase,tRNA,capsid,tail,terminase,portal,protease,head	uncultured_Caudovirales_phage(31.25%)	64	1880378:1880399	1919066:1919087
WP_000033178.1|1870286_1870790_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	A0A0B5J096	Pandoravirus	31.3	6.5e-06
WP_001246675.1|1870859_1871303_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_000218018.1|1871310_1871997_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140309.1|1872101_1873775_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000205997.1|1873931_1874234_+	integration host factor subunit beta	NA	B5TA87	Burkholderia_phage	42.9	5.6e-13
WP_001269278.1|1874258_1874624_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_000392928.1|1874789_1875488_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_014538345.1|1876444_1877992_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_085917006.1|1878155_1879133_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000933387.1|1879216_1880359_+	cell division protein ZapE	NA	NA	NA	NA	NA
1880378:1880399	attL	CGCTCTAGATTGAGCGCTTTTT	NA	NA	NA	NA
WP_000190202.1|1880535_1881495_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	35.4	4.5e-48
WP_000141159.1|1881460_1881712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597347.1|1881708_1881999_-	hypothetical protein	NA	A0A2I7R567	Vibrio_phage	41.3	1.3e-06
WP_069597348.1|1881995_1882478_-	methyltransferase domain-containing protein	NA	A0A0N7IRF6	Acinetobacter_phage	73.6	1.8e-69
WP_000130782.1|1882474_1882864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597349.1|1882875_1883139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597351.1|1883361_1883841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001071959.1|1883843_1884575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006581783.1|1884824_1885517_-	S24 family peptidase	NA	A0A0P0J076	Acinetobacter_phage	48.3	7.4e-53
WP_000576486.1|1885588_1885831_+	hypothetical protein	NA	A0A2H4JCB6	uncultured_Caudovirales_phage	52.6	8.7e-09
WP_069597352.1|1885889_1886186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017724769.1|1886185_1887070_+	DUF1376 domain-containing protein	NA	A0A2I7RGZ2	Vibrio_phage	62.4	1.7e-30
WP_017724768.1|1887069_1888401_+	AAA family ATPase	NA	A0A0P0IVX0	Acinetobacter_phage	55.1	1.2e-128
WP_017724767.1|1888397_1888676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017724766.1|1888672_1888843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069597414.1|1888842_1889340_+	antitermination protein	NA	A0A0P0IY98	Acinetobacter_phage	33.5	1.5e-15
WP_031963733.1|1889804_1890041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050590660.1|1890388_1890589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000238616.1|1890783_1891002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856318.1|1891077_1891476_+	hypothetical protein	NA	T1S9H7	Salmonella_phage	38.0	4.8e-12
WP_032021383.1|1891491_1892022_+	hypothetical protein	NA	A0A2H4JB76	uncultured_Caudovirales_phage	43.4	1.7e-36
WP_032021382.1|1892011_1892236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032021381.1|1892241_1892532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032021380.1|1892461_1892761_+	HNH endonuclease	NA	A0A0R6PHK1	Moraxella_phage	56.4	5.0e-22
WP_157010686.1|1892757_1892919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165860146.1|1893142_1893298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069597353.1|1893288_1893771_+|terminase	terminase small subunit	terminase	A0A2H4J8R0	uncultured_Caudovirales_phage	48.4	7.8e-25
WP_069597354.1|1893879_1894605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069597415.1|1894875_1896570_+|terminase	terminase large subunit	terminase	A0A2H4J559	uncultured_Caudovirales_phage	61.4	3.4e-192
WP_000108390.1|1896566_1897793_+|portal	phage portal protein	portal	A0A2H4J6S3	uncultured_Caudovirales_phage	75.9	3.9e-182
WP_000375469.1|1897785_1898448_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JAI0	uncultured_Caudovirales_phage	62.3	6.2e-73
WP_069597355.1|1898440_1899613_+|capsid	phage major capsid protein	capsid	A0A2H4JD98	uncultured_Caudovirales_phage	47.5	2.4e-88
WP_000666093.1|1899660_1899837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000631204.1|1899833_1900121_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	46.5	9.3e-18
WP_017724754.1|1900122_1900479_+|head	phage head closure protein	head	G3ENA2	Psychrobacter_phage	40.0	5.9e-14
WP_017724753.1|1900482_1900968_+	HK97 gp10 family phage protein	NA	A0A2H4JB20	uncultured_Caudovirales_phage	44.7	4.9e-27
WP_017724752.1|1900967_1901339_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	45.4	4.4e-20
WP_017724751.1|1901415_1901889_+	hypothetical protein	NA	A0A2H4JBZ0	uncultured_Caudovirales_phage	60.0	7.3e-52
WP_069597356.1|1901888_1902404_+|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_025468566.1|1902439_1902655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001031956.1|1902731_1903061_+	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	43.1	2.9e-15
WP_069597357.1|1903126_1906813_+	transglycosylase SLT domain-containing protein	NA	A0A0U4JEA4	Pseudomonas_phage	40.4	6.1e-45
WP_032067321.1|1906855_1907215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017724746.1|1907207_1907549_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_069597358.1|1907601_1908906_+|tail	phage tail protein	tail	U5PW98	Acinetobacter_phage	53.0	1.2e-51
WP_017724744.1|1908889_1909699_+|tail	phage minor tail protein L	tail	A0A0R6PIJ5	Moraxella_phage	63.6	9.5e-92
WP_017724743.1|1909705_1910461_+	C40 family peptidase	NA	A0A0R6PIM4	Moraxella_phage	56.6	1.6e-85
WP_017724742.1|1910444_1911101_+|tail	tail assembly protein	tail	A0A0R6PIF0	Moraxella_phage	46.8	2.8e-41
WP_069597359.1|1911157_1917139_+|tail	phage tail protein	tail	A0A0R6PIC9	Moraxella_phage	63.8	0.0e+00
WP_000323007.1|1917138_1917318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005351.1|1917384_1917660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000066823.1|1917643_1918153_+	lysozyme	NA	A0A0B5L5F7	Acinetobacter_phage	58.6	5.8e-47
WP_017724740.1|1918152_1918521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001186628.1|1918757_1918955_+	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	57.1	6.2e-13
1919066:1919087	attR	CGCTCTAGATTGAGCGCTTTTT	NA	NA	NA	NA
>prophage 12
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	2121906	2170538	4178958	plate,transposase	Leptospira_phage(28.57%)	40	NA	NA
WP_001091151.1|2121906_2122836_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_001002901.1|2123938_2125198_-	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_000377263.1|2125295_2125985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059825.1|2125971_2127345_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_000217818.1|2127702_2128308_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091115.1|2128742_2129990_+	saccharopine dehydrogenase NADP-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000759719.1|2129986_2131294_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001080623.1|2131299_2132841_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000427715.1|2133606_2134521_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000047249.1|2134613_2136011_-	multidrug efflux RND transporter outer membrane channel subunit AdeC	NA	NA	NA	NA	NA
WP_000987613.1|2136087_2139198_-	multidrug efflux RND transporter permease subunit AdeB	NA	S5VTK5	Leptospira_phage	24.4	6.1e-62
WP_001169094.1|2139194_2140385_-	multidrug efflux RND transporter periplasmic adaptor subunit AdeA	NA	S5VL44	Leptospira_phage	22.4	8.1e-07
WP_000459542.1|2140530_2141274_+	efflux system response regulator transcription factor AdeR	NA	W8CYM9	Bacillus_phage	30.2	7.5e-27
WP_000837467.1|2141305_2142379_+	two-component sensor histidine kinase AdeS	NA	NA	NA	NA	NA
WP_000373596.1|2142502_2143498_+	putative multidrug efflux protein AdeT1	NA	NA	NA	NA	NA
WP_001013804.1|2143571_2144597_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000520419.1|2144788_2145703_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000872850.1|2145733_2146594_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000049721.1|2146639_2147482_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000834644.1|2147583_2147880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211331.1|2148094_2148934_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_001080407.1|2148930_2149632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|2149875_2150805_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000193121.1|2150991_2151432_+	HD domain-containing protein	NA	A0A0B5H2U9	Vibrio_phage	35.5	6.2e-13
WP_000817319.1|2151466_2152111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002001022.1|2152122_2153094_-	acid phosphatase	NA	NA	NA	NA	NA
WP_079882002.1|2153220_2153592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597335.1|2154433_2154910_-	AAC(3)-I family aminoglycoside N-acetyltransferase	NA	NA	NA	NA	NA
WP_076611834.1|2155479_2156275_-|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
WP_050682064.1|2157118_2158357_-	TolC family protein	NA	NA	NA	NA	NA
WP_000841495.1|2158443_2160030_-	GH3 auxin-responsive promoter family protein	NA	NA	NA	NA	NA
WP_075874782.1|2160026_2160815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002144.1|2161002_2162550_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_001091151.1|2163554_2164484_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_069597416.1|2165329_2166790_-	indoleacetamide hydrolase	NA	NA	NA	NA	NA
WP_000821013.1|2166834_2168106_-	hypothetical protein	NA	E5EYU2	Acinetobacter_phage	40.4	9.6e-06
WP_000142498.1|2168102_2168639_-	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_000331147.1|2168635_2169682_-|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	28.0	3.1e-26
WP_001284173.1|2169685_2170048_-	phage GP46 family protein	NA	NA	NA	NA	NA
WP_000978262.1|2170055_2170538_-|plate	phage baseplate assembly protein	plate	A0A0M3LPA3	Mannheimia_phage	41.1	4.4e-12
>prophage 13
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	2177523	2244723	4178958	transposase,integrase,head	Pseudomonas_phage(30.3%)	77	2195600:2195615	2201880:2201895
WP_000235452.1|2177523_2179545_-	hypothetical protein	NA	I3PV04	Vibrio_phage	34.1	7.2e-48
WP_002096154.1|2179556_2179904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029749180.1|2179903_2180521_-	DUF1834 family protein	NA	NA	NA	NA	NA
WP_000271339.1|2180514_2180943_-	DUF1320 domain-containing protein	NA	A0A0M3LP98	Mannheimia_phage	37.3	2.6e-16
WP_000587359.1|2180954_2181887_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A2P9JZJ2	Alteromonadaceae_phage	55.1	2.5e-88
WP_000127534.1|2181886_2182309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125727.1|2182305_2183406_-	hypothetical protein	NA	A0A0M5N0Q6	Ralstonia_phage	33.5	3.1e-37
WP_000009284.1|2183495_2183993_-	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_001143727.1|2184087_2185404_-	hypothetical protein	NA	I6PBD2	Pseudomonas_phage	36.8	1.5e-78
WP_001074444.1|2185403_2186984_-	DUF935 domain-containing protein	NA	A0A1C6ZDK1	Pseudomonas_phage	44.0	8.9e-110
WP_000850826.1|2187196_2187964_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	60.9	6.4e-90
WP_001181092.1|2188147_2188936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000214229.1|2188932_2190495_-	hypothetical protein	NA	A0A2H4JF57	uncultured_Caudovirales_phage	60.0	1.2e-159
WP_000090432.1|2190491_2191040_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	50.6	2.9e-44
WP_000006950.1|2191048_2191360_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	52.0	8.5e-25
WP_000151295.1|2191356_2191701_-	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	37.5	3.7e-13
WP_000039665.1|2191697_2192075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000047471.1|2192071_2192572_-	glycoside hydrolase family 108 protein	NA	A0A0M3LSH2	Mannheimia_phage	50.0	9.8e-39
WP_000719902.1|2192654_2193227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000579781.1|2193228_2193882_-	helix-turn-helix transcriptional regulator	NA	A7Y8H7	Pseudomonas_virus	32.1	3.9e-19
WP_001244919.1|2193986_2194193_+	DNA-binding protein	NA	J9RW65	Pseudomonas_phage	49.2	1.3e-08
WP_000127695.1|2194377_2194695_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	46.8	1.1e-14
WP_001292068.1|2194697_2195654_+	hypothetical protein	NA	J9SND0	Pseudomonas_phage	41.3	2.9e-23
2195600:2195615	attL	TCAAGATGAGCTTCAA	NA	NA	NA	NA
WP_000184211.1|2195656_2197399_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q5ZR04	Pseudomonas_phage	36.4	1.4e-100
WP_001275020.1|2197402_2198590_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	49.4	9.0e-91
WP_000227381.1|2198681_2198900_+	TraR/DksA C4-type zinc finger protein	NA	G3EN77	Psychrobacter_phage	40.8	2.5e-07
WP_001093362.1|2198896_2199121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000857163.1|2199110_2199815_+	hypothetical protein	NA	A0A2H4JFV8	uncultured_Caudovirales_phage	46.4	1.1e-27
WP_000193364.1|2199811_2200426_+	DUF3164 family protein	NA	A0A0M3LQ92	Mannheimia_phage	52.0	1.3e-56
WP_000287594.1|2200437_2200614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000073328.1|2200606_2200891_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	53.9	1.6e-17
WP_000370224.1|2200883_2201210_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	65.7	4.1e-30
WP_000726064.1|2201347_2202073_+	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	37.1	7.6e-24
2201880:2201895	attR	TTGAAGCTCATCTTGA	NA	NA	NA	NA
WP_000909450.1|2202066_2202270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000510841.1|2202271_2202478_+	hypothetical protein	NA	K4IBU9	Acinetobacter_phage	57.1	2.0e-06
WP_000671215.1|2202481_2202925_+	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	33.3	1.1e-12
WP_000323306.1|2202934_2203384_+	transcriptional regulator	NA	A0A0N7AEB9	Bacillus_phage	33.8	3.7e-05
WP_069597361.1|2204592_2204889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|2204917_2205847_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_001287993.1|2206002_2206803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001989376.1|2206902_2207457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000424150.1|2207667_2207967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001180995.1|2208034_2208226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000110646.1|2208234_2208588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344757.1|2208807_2209077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000370160.1|2209784_2210492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000332182.1|2210569_2211268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|2211371_2212301_-|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000312355.1|2212501_2212750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000675786.1|2212760_2213105_-	hypothetical protein	NA	A0A2H4J548	uncultured_Caudovirales_phage	39.3	2.0e-14
WP_000959831.1|2213659_2215012_-	methylenetetrahydrofolate reductase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000155202.1|2215127_2215895_-	NUDIX hydrolase	NA	G3MA14	Bacillus_virus	32.2	1.5e-25
WP_000152964.1|2215955_2217449_-	nicotinate phosphoribosyltransferase	NA	A0A1W6DY18	Aeromonas_phage	51.1	6.3e-142
WP_001007527.1|2217460_2218345_-	ribose-phosphate pyrophosphokinase	NA	A0A076G6G0	Escherichia_phage	39.0	1.2e-34
WP_000965123.1|2218526_2219336_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001244448.1|2219434_2220223_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000177605.1|2220217_2220706_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000614432.1|2220708_2221473_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.7	1.2e-16
WP_002001037.1|2221469_2222480_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000770288.1|2222482_2223502_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001091151.1|2223653_2224583_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000206303.1|2224964_2226017_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	45.1	2.8e-88
WP_001181580.1|2226072_2226711_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001989396.1|2226823_2227318_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000013631.1|2227526_2228411_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000090987.1|2228506_2229379_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000389442.1|2229378_2230755_-	MFS transporter	NA	NA	NA	NA	NA
WP_001101630.1|2230788_2231760_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000774594.1|2231970_2232906_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001011888.1|2233017_2234193_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000999650.1|2234280_2236068_+	dihydroxy-acid dehydratase family protein	NA	NA	NA	NA	NA
WP_000152484.1|2236084_2237662_+	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_001278392.1|2237740_2238361_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001026282.1|2238527_2240105_+	MFS transporter	NA	NA	NA	NA	NA
WP_000105392.1|2240101_2241190_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_001091151.1|2242837_2243767_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_076611834.1|2243927_2244723_-|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	2516501	2569253	4178958	terminase,capsid,transposase,integrase	Acinetobacter_phage(96.55%)	72	2514022:2514039	2569414:2569431
2514022:2514039	attL	ATAAAAGAAGTAGAATCC	NA	NA	NA	NA
WP_001091151.1|2516501_2517431_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_069597365.1|2517466_2518228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019718.1|2518372_2518918_-	N-acetylmuramidase	NA	A0A0P0IW03	Acinetobacter_phage	99.4	6.4e-100
WP_000096283.1|2519256_2520156_-	alpha/beta hydrolase	NA	A0A0P0J0J7	Acinetobacter_phage	85.4	4.2e-149
WP_000124482.1|2520321_2520582_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001226299.1|2520601_2521093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735265.1|2521149_2521476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720514.1|2521479_2521821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433918.1|2522019_2522409_-	hypothetical protein	NA	J7I481	Acinetobacter_phage	100.0	2.5e-66
WP_001091151.1|2525159_2526089_-|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000835168.1|2526947_2527310_-	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	100.0	5.2e-66
WP_000368375.1|2527306_2527813_-	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	100.0	1.2e-92
WP_000277443.1|2527812_2528211_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
WP_000246069.1|2528275_2528668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091151.1|2529091_2530021_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000046576.1|2530530_2534865_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	70.2	0.0e+00
WP_001275792.1|2534992_2535256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721572.1|2535257_2535938_-	hypothetical protein	NA	A0A0R6PJY5	Moraxella_phage	49.3	2.5e-53
WP_000966688.1|2536036_2536441_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0D4DCG1	Acinetobacter_phage	100.0	3.9e-70
WP_000838146.1|2536533_2536716_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	100.0	7.4e-29
WP_024616020.1|2537041_2537557_-	hypothetical protein	NA	J7I4Q2	Acinetobacter_phage	100.0	2.8e-73
WP_039100459.1|2537627_2537888_-	hypothetical protein	NA	A0A0D4DBN5	Acinetobacter_phage	100.0	4.9e-42
WP_171259284.1|2537949_2538546_-	hypothetical protein	NA	A0A0P0IL42	Acinetobacter_phage	98.5	3.0e-103
WP_000002415.1|2538598_2539954_-	hypothetical protein	NA	A0A0N7IRE5	Acinetobacter_phage	99.3	6.5e-202
WP_000064593.1|2539953_2540307_-	hypothetical protein	NA	A0A0D4DCF7	Acinetobacter_phage	96.6	3.3e-57
WP_000749909.1|2540403_2540925_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_001277696.1|2541033_2541252_-	hypothetical protein	NA	A0A0P0I8C2	Acinetobacter_phage	94.2	1.2e-28
WP_002016455.1|2541253_2541697_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	87.8	3.1e-68
WP_000539748.1|2541653_2542022_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	80.3	2.6e-52
WP_000247952.1|2541993_2542398_-	hypothetical protein	NA	A0A0P0IKR8	Acinetobacter_phage	91.7	2.2e-65
WP_000524213.1|2542406_2542775_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	95.1	1.2e-62
WP_076611834.1|2543029_2543825_-|transposase	IS5-like element ISAba15 family transposase	transposase	NA	NA	NA	NA
WP_069597367.1|2543859_2544042_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	85.2	2.3e-22
WP_000692540.1|2544046_2544712_-	stress-responsive nuclear envelope protein	NA	J7I4P7	Acinetobacter_phage	96.8	2.6e-111
WP_000214198.1|2544777_2545734_-	hypothetical protein	NA	A0A0D4DBM4	Acinetobacter_phage	97.5	4.8e-175
WP_000770049.1|2545761_2546529_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	100.0	4.6e-120
WP_001139861.1|2546642_2546834_-	hypothetical protein	NA	A0A0P0IKM2	Acinetobacter_phage	100.0	1.7e-28
WP_000004363.1|2547051_2547294_-	hypothetical protein	NA	A0A0D4DC19	Acinetobacter_phage	100.0	3.6e-39
WP_000965231.1|2547392_2547821_-	hypothetical protein	NA	J7I4P3	Acinetobacter_phage	100.0	5.2e-73
WP_000179763.1|2547829_2548933_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	100.0	2.7e-206
WP_001286355.1|2548934_2550386_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	100.0	1.0e-285
WP_000102080.1|2550382_2551810_-|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	100.0	7.6e-270
WP_000212566.1|2551799_2552270_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_000435252.1|2552328_2552970_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	98.1	6.7e-125
WP_000378508.1|2552938_2553373_-	hypothetical protein	NA	A0A0P0IVP9	Acinetobacter_phage	100.0	3.4e-80
WP_000195753.1|2553434_2553890_-	hypothetical protein	NA	A0A0P0HSF5	Acinetobacter_phage	100.0	3.1e-84
WP_000959662.1|2554311_2555064_-	hypothetical protein	NA	A0A0P0J081	Acinetobacter_phage	100.0	8.7e-140
WP_000100186.1|2555074_2555476_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	100.0	1.9e-69
WP_001288422.1|2555475_2555700_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_002018225.1|2555692_2556055_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	100.0	1.0e-69
WP_000648413.1|2556104_2556527_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_001031749.1|2556513_2556648_-	putative phage replication protein	NA	A0A0P0IR92	Acinetobacter_phage	100.0	1.1e-18
WP_001003675.1|2556644_2557445_-	hypothetical protein	NA	A0A0P0IDV1	Acinetobacter_phage	100.0	2.0e-150
WP_000064623.1|2557447_2558329_-	replication protein	NA	A0A0P0IKQ2	Acinetobacter_phage	100.0	9.8e-143
WP_002037796.1|2558321_2558546_-	hypothetical protein	NA	A0A0P0I444	Acinetobacter_phage	98.6	6.5e-35
WP_001095598.1|2558617_2558893_-	hypothetical protein	NA	A0A0P0IVP2	Acinetobacter_phage	100.0	8.9e-42
WP_000049334.1|2558948_2559269_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	100.0	4.6e-50
WP_000996063.1|2559279_2559531_-	hypothetical protein	NA	A0A0N7IRE1	Acinetobacter_phage	100.0	8.9e-41
WP_001093654.1|2559639_2560404_+	LexA family transcriptional regulator	NA	A0A0P0J076	Acinetobacter_phage	100.0	2.8e-146
WP_000370481.1|2560418_2560634_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	100.0	8.5e-32
WP_000048052.1|2560685_2561693_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_001129676.1|2561694_2562198_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_001101441.1|2562406_2562847_+	hypothetical protein	NA	A0A0P0IR91	Acinetobacter_phage	100.0	5.7e-75
WP_000656412.1|2562846_2563137_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	100.0	5.5e-50
WP_000064475.1|2563129_2563453_+	hypothetical protein	NA	A0A0P0IKP4	Acinetobacter_phage	100.0	5.1e-57
WP_001207477.1|2563464_2564586_+	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	100.0	2.6e-212
WP_001061217.1|2564582_2565545_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	78.1	5.3e-134
WP_000043826.1|2565544_2565841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000910240.1|2565841_2566111_+	DNA-binding protein	NA	A0A0N7IRE8	Acinetobacter_phage	96.6	1.9e-41
WP_000365983.1|2566248_2566860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001099514.1|2566896_2567979_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	28.6	1.2e-30
WP_000773631.1|2567990_2569253_-|integrase	integrase family protein	integrase	A0A0P0IKP2	Acinetobacter_phage	98.8	8.0e-247
2569414:2569431	attR	ATAAAAGAAGTAGAATCC	NA	NA	NA	NA
>prophage 15
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	2712951	2857191	4178958	integrase,tRNA,tail,terminase,transposase,protease,head	Acinetobacter_phage(17.78%)	142	2849436:2849449	2857926:2857939
WP_001091151.1|2712951_2713881_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000004354.1|2714654_2715491_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_000853480.1|2715637_2718025_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	37.1	6.3e-176
WP_001167811.1|2718089_2718845_+	RDD family protein	NA	NA	NA	NA	NA
WP_001250044.1|2719161_2720214_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000367186.1|2720217_2722209_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_000852577.1|2722213_2722834_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_000094534.1|2722833_2723163_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_000915319.1|2723173_2724052_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_001216679.1|2724236_2724620_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000090661.1|2724631_2724859_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_000382591.1|2724867_2725314_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000075891.1|2725514_2726960_+	replicative DNA helicase	NA	O80281	Escherichia_phage	51.7	5.6e-119
WP_001248169.1|2726992_2728063_+	alanine racemase	NA	NA	NA	NA	NA
WP_000434832.1|2728115_2728826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772588.1|2728866_2729646_-	transglutaminase family protein	NA	NA	NA	NA	NA
WP_000243521.1|2729648_2730245_-	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_001295011.1|2730267_2731818_-	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_138140454.1|2732481_2733051_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000559183.1|2733437_2735318_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_000859008.1|2735550_2735781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000871703.1|2735937_2736843_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001003277.1|2736856_2737699_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_001086304.1|2738075_2738345_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_000153210.1|2738434_2740009_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.6	7.1e-67
WP_001024112.1|2740134_2741421_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000733779.1|2741669_2742536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614025.1|2742611_2743637_+	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.0	9.1e-31
WP_001205190.1|2743633_2744329_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001270570.1|2744486_2745218_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000758190.1|2745574_2745778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347180.1|2746013_2747312_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_001151708.1|2747740_2748307_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012391947.1|2748528_2749647_+	MFS transporter	NA	NA	NA	NA	NA
WP_001067858.1|2749806_2750511_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000555098.1|2751786_2752071_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000781558.1|2752073_2752430_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.9	1.6e-22
WP_000753551.1|2752522_2754082_+|transposase	IS66-like element ISAba24 family transposase	transposase	S5VTD3	Leptospira_phage	34.2	4.0e-70
WP_000155092.1|2754725_2755610_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|2755665_2757141_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_002001451.1|2757539_2758724_-|transposase	IS4-like element ISEc29 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	35.4	4.5e-50
WP_002026779.1|2758772_2758958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077252464.1|2759177_2759459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000359986.1|2759439_2760213_-	ArmA family 16S rRNA (guanine(1405)-N(7))-methyltransferase	NA	NA	NA	NA	NA
WP_000050481.1|2761611_2763153_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000259031.1|2763557_2764397_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2764390_2764738_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206316.1|2764901_2765693_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_002075262.1|2765750_2766383_-	type B-3 chloramphenicol O-acetyltransferase CatB8	NA	A0A2R8FE91	Brazilian_cedratvirus	40.1	3.5e-25
WP_014454105.1|2766475_2767030_-	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001067858.1|2768059_2768764_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000018326.1|2768876_2769692_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.5	4.3e-161
WP_001067858.1|2769945_2770650_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001166572.1|2770686_2771124_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000957803.1|2771151_2772519_-	sorbosone dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000042002.1|2772869_2773781_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_000848609.1|2773795_2774524_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_000791373.1|2774716_2775427_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_002016783.1|2775416_2777084_-	MCE family protein	NA	NA	NA	NA	NA
WP_001062699.1|2777091_2777898_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_000768105.1|2777885_2778503_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_000574045.1|2779505_2781191_+	aspartate-alanine antiporter	NA	NA	NA	NA	NA
WP_000520927.1|2781247_2782846_+	bifunctional aspartate transaminase/aspartate 4-decarboxylase	NA	NA	NA	NA	NA
WP_000340895.1|2782896_2783799_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000792950.1|2784033_2784588_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001260530.1|2785746_2787234_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	32.9	6.1e-60
WP_001149936.1|2787773_2787893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032044651.1|2787950_2788970_-	Csu fimbrial tip adhesin CsuE	NA	NA	NA	NA	NA
WP_000603301.1|2788966_2791465_-	Csu fimbrial usher CsuD	NA	NA	NA	NA	NA
WP_001988023.1|2791461_2792295_-	Csu fimbrial biogenesis chaperone CsuC	NA	NA	NA	NA	NA
WP_000876480.1|2792288_2792807_-	Csu fimbrial biogenesis protein CsuB	NA	NA	NA	NA	NA
WP_075878554.1|2792812_2793268_-	Csu fimbrial biogenesis protein CsuA	NA	NA	NA	NA	NA
WP_000790104.1|2793435_2793972_-	Csu fimbrial major subunit CsuAB	NA	NA	NA	NA	NA
WP_001091151.1|2794688_2795618_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_001094391.1|2795720_2795954_+	DUF2171 domain-containing protein	NA	NA	NA	NA	NA
WP_001058168.1|2796101_2797499_-	amino acid permease	NA	NA	NA	NA	NA
WP_000181284.1|2797601_2799170_-	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001989184.1|2799280_2800663_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000802863.1|2800760_2801678_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000912071.1|2802304_2803108_-	protein kinase	NA	B6VC32	Iragoides_fasciata_nucleopolyhedrovirus	33.9	1.0e-05
WP_000461855.1|2803094_2804603_-	DUF3336 domain-containing protein	NA	NA	NA	NA	NA
WP_001091151.1|2805398_2806328_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_000744455.1|2806798_2807902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000636263.1|2807904_2808915_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	66.3	2.1e-125
WP_001136722.1|2809060_2809276_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000209410.1|2809302_2809749_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	40.8	1.9e-17
WP_002000697.1|2809839_2811267_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000758326.1|2811413_2812379_-	D-glycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	28.3	3.8e-15
WP_000580181.1|2812390_2813041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000665946.1|2813141_2815031_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000334670.1|2815109_2816651_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.8	1.5e-85
WP_001091968.1|2816676_2817264_-	CvpA family protein	NA	NA	NA	NA	NA
WP_000966986.1|2817270_2818275_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000783000.1|2818364_2818844_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_001989189.1|2818843_2819983_-	general secretion pathway protein GspL	NA	NA	NA	NA	NA
WP_069597369.1|2820120_2820315_-	hypothetical protein	NA	A0A1B1P9F8	Acinetobacter_phage	90.6	9.7e-27
WP_069597417.1|2820402_2820918_-	glycoside hydrolase family 108 protein	NA	A0A2H4J8Q8	uncultured_Caudovirales_phage	60.8	4.7e-60
WP_032009013.1|2820904_2821129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002058936.1|2821125_2821476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171259285.1|2821551_2822517_-	EpsG family protein	NA	NA	NA	NA	NA
WP_001091151.1|2822779_2823709_+|transposase	IS5-like element ISAba10 family transposase	transposase	NA	NA	NA	NA
WP_069597371.1|2823742_2824138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597372.1|2826609_2828295_-|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	45.5	1.3e-135
WP_001204068.1|2828294_2828603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597373.1|2828664_2831190_-	hypothetical protein	NA	A0A193GZ61	Enterobacter_phage	31.3	1.1e-106
WP_069597374.1|2831193_2834064_-	lytic transglycosylase domain-containing protein	NA	A0A222YY44	Escherichia_phage	34.5	2.6e-51
WP_069597375.1|2834060_2836127_-	methyl-coenzyme M reductase	NA	NA	NA	NA	NA
WP_069597376.1|2836126_2836552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597377.1|2836539_2837052_-	hypothetical protein	NA	A0A218MN86	uncultured_virus	35.8	4.5e-15
WP_017724830.1|2837044_2837500_-	GNAT family N-acetyltransferase	NA	X2L0B0	Vibrio_phage	32.0	4.6e-11
WP_069597378.1|2837502_2839581_-	carbohydrate-binding protein	NA	A0A2H4J6H2	uncultured_Caudovirales_phage	27.8	2.9e-68
WP_002010123.1|2839577_2840141_-	hypothetical protein	NA	A0A0F7LAN7	uncultured_marine_virus	37.1	5.9e-24
WP_057090925.1|2840202_2840529_-	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	71.0	4.7e-34
WP_059284191.1|2840601_2841510_-	hypothetical protein	NA	A0A2H4JC66	uncultured_Caudovirales_phage	31.7	1.6e-26
WP_069597379.1|2841524_2842190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597380.1|2842179_2842635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597381.1|2842631_2844293_-|head,tail	head-tail connector protein	head,tail	A0A2H4J3N6	uncultured_Caudovirales_phage	43.3	4.0e-121
WP_002010317.1|2844292_2844478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597382.1|2844480_2844816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001091361.1|2844896_2845091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597383.1|2845192_2845579_-	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	49.2	1.3e-25
WP_148661300.1|2845575_2846121_-	hypothetical protein	NA	A0A0D4DBZ8	Acinetobacter_phage	82.4	1.5e-11
WP_069597418.1|2846113_2846320_-	hypothetical protein	NA	A0A1X9SFB0	Acinetobacter_phage	72.1	2.7e-19
WP_069597384.1|2846414_2846753_-	hypothetical protein	NA	A0A0P0I8J0	Acinetobacter_phage	74.1	1.5e-38
WP_032033637.1|2846749_2847154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069597385.1|2847163_2847670_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1X9SFE9	Acinetobacter_phage	53.0	8.7e-27
WP_069597387.1|2847905_2848640_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	52.0	9.0e-65
WP_069597388.1|2848636_2849626_-	replication protein	NA	NA	NA	NA	NA
2849436:2849449	attL	GAAGTCTGACGAAT	NA	NA	NA	NA
WP_069597389.1|2849641_2849962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001197739.1|2849970_2850153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000096815.1|2850264_2850948_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	39.2	6.9e-27
WP_069597390.1|2850944_2851586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171259286.1|2851818_2852166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069597392.1|2852185_2852452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059264975.1|2852451_2853048_+	hypothetical protein	NA	A0A2C9CXX4	Yersinia_phage	34.5	1.8e-23
WP_059264973.1|2853057_2853996_+	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	82.3	7.5e-141
WP_000765551.1|2853992_2854652_+	hypothetical protein	NA	A0A2H4JDC0	uncultured_Caudovirales_phage	58.2	6.3e-78
WP_000132012.1|2854648_2855017_+	hypothetical protein	NA	A0A1B1P9I4	Acinetobacter_phage	96.7	2.2e-64
WP_000783308.1|2855389_2855692_+	hypothetical protein	NA	A0A2I7QNA8	Vibrio_phage	35.7	7.8e-07
WP_002045855.1|2855688_2855883_+	hypothetical protein	NA	A0A1B1P9G2	Acinetobacter_phage	100.0	2.2e-31
WP_000512310.1|2855884_2856175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069597393.1|2856171_2857191_-|integrase	site-specific integrase	integrase	A0A0R6PHH4	Moraxella_phage	43.4	1.1e-68
2857926:2857939	attR	ATTCGTCAGACTTC	NA	NA	NA	NA
>prophage 16
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	2958101	3012740	4178958	tail,integrase,capsid,terminase	Acinetobacter_phage(92.96%)	77	2961739:2961755	3009361:3009377
WP_000872622.1|2958101_2959643_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	100.0	3.9e-288
WP_000999148.1|2959639_2961442_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	100.0	0.0e+00
2961739:2961755	attL	ATGCTTCTAATGATCGA	NA	NA	NA	NA
WP_000947611.1|2961929_2963126_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0D4DBR3	Acinetobacter_phage	100.0	2.5e-226
WP_000098296.1|2963122_2963317_-	hypothetical protein	NA	A0A0D4DBH0	Acinetobacter_phage	100.0	3.8e-31
WP_001019392.1|2963750_2964293_-	N-acetylmuramidase	NA	A0A0D4DCJ5	Acinetobacter_phage	100.0	1.7e-100
WP_001100986.1|2964354_2964534_-	hypothetical protein	NA	A0A0D4DCA7	Acinetobacter_phage	100.0	9.2e-24
WP_001021568.1|2964559_2965102_-	hypothetical protein	NA	A0A0D4DBW7	Acinetobacter_phage	100.0	5.7e-101
WP_000433897.1|2965213_2965603_-	hypothetical protein	NA	A0A0D4DBQ9	Acinetobacter_phage	100.0	6.0e-68
WP_069597395.1|2965671_2969118_-	hypothetical protein	NA	J7HXG3	Acinetobacter_phage	99.0	0.0e+00
WP_000835168.1|2969110_2969473_-	hypothetical protein	NA	J7I4R1	Acinetobacter_phage	100.0	5.2e-66
WP_000368375.1|2969469_2969976_-	hypothetical protein	NA	J7HXQ5	Acinetobacter_phage	100.0	1.2e-92
WP_000277443.1|2969975_2970374_-	hypothetical protein	NA	J7I0X8	Acinetobacter_phage	100.0	1.3e-73
WP_000246069.1|2970438_2970831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000937383.1|2970834_2971587_-	hypothetical protein	NA	J7HXF9	Acinetobacter_phage	34.4	1.2e-32
WP_069597396.1|2971661_2975969_-	tape measure protein	NA	A0A0D4DC37	Acinetobacter_phage	97.4	0.0e+00
WP_000835645.1|2976038_2977031_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	46.9	9.7e-22
WP_001103649.1|2977027_2977183_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000763623.1|2977305_2977545_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000720608.1|2977593_2978388_-	hypothetical protein	NA	A0A2H4J0E0	uncultured_Caudovirales_phage	42.2	1.7e-05
WP_000523922.1|2978419_2978743_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_014466185.1|2978751_2978928_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.8e-09
WP_000274931.1|2979032_2979491_-	helix-turn-helix domain-containing protein	NA	A0A0P0IRJ4	Acinetobacter_phage	100.0	1.1e-84
WP_000335868.1|2979499_2979799_-	DUF4258 domain-containing protein	NA	A0A0P0IE58	Acinetobacter_phage	100.0	7.4e-50
WP_001185585.1|2980301_2980817_-	hypothetical protein	NA	A0A0N7IRG3	Acinetobacter_phage	96.6	2.5e-77
WP_000094278.1|2980886_2981804_-	hypothetical protein	NA	J7HXP7	Acinetobacter_phage	100.0	2.0e-170
WP_069597397.1|2981856_2983161_-|tail	phage tail protein	tail	A0A0D4DCQ4	Acinetobacter_phage	47.0	1.8e-87
WP_000064572.1|2983160_2983511_-	hypothetical protein	NA	A0A0P0IY61	Acinetobacter_phage	90.6	1.3e-53
WP_001277691.1|2983607_2983826_-	hypothetical protein	NA	A0A0D4DC29	Acinetobacter_phage	95.8	1.5e-31
WP_002039534.1|2983827_2984271_-	hypothetical protein	NA	A0A0D4DBX3	Acinetobacter_phage	88.4	3.9e-71
WP_000539744.1|2984227_2984596_-	hypothetical protein	NA	A0A0D4DBN1	Acinetobacter_phage	99.2	5.0e-64
WP_000043392.1|2984637_2985168_-	hypothetical protein	NA	A0A0D4DCP9	Acinetobacter_phage	100.0	3.4e-98
WP_014462814.1|2985229_2985598_-	hypothetical protein	NA	A0A0D4DCF3	Acinetobacter_phage	100.0	4.5e-65
WP_000008489.1|2985599_2985989_-	hypothetical protein	NA	A0A0D4DC24	Acinetobacter_phage	97.7	2.8e-65
WP_000645004.1|2985993_2986641_-	hypothetical protein	NA	A0A0D4DBW4	Acinetobacter_phage	94.2	2.3e-72
WP_001115624.1|2986684_2987641_-	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	66.0	1.7e-119
WP_000770063.1|2987658_2988414_-	hypothetical protein	NA	J7I0W4	Acinetobacter_phage	56.0	1.7e-66
WP_000589032.1|2988521_2988836_-	hypothetical protein	NA	A0A0S3UFT8	Pseudomonas_phage	49.5	8.9e-14
WP_000758136.1|2988885_2989029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000179759.1|2989025_2990129_-|capsid	minor capsid protein	capsid	A0A0D4DBL9	Acinetobacter_phage	95.1	1.3e-197
WP_001286345.1|2990135_2991578_-	DUF4055 domain-containing protein	NA	A0A0D4DCP1	Acinetobacter_phage	82.3	2.5e-236
WP_069597398.1|2991574_2993002_-|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	98.9	7.1e-268
WP_000212566.1|2992991_2993462_-	DUF2280 domain-containing protein	NA	A0A0D4DC15	Acinetobacter_phage	100.0	3.0e-82
WP_017725555.1|2993520_2994162_-	hypothetical protein	NA	A0A0D4DBV4	Acinetobacter_phage	100.0	9.4e-127
WP_000371306.1|2994130_2994565_-	hypothetical protein	NA	J7HXN1	Acinetobacter_phage	95.1	1.5e-75
WP_000134359.1|2994579_2994771_-	hypothetical protein	NA	J7I0V8	Acinetobacter_phage	100.0	1.0e-28
WP_000432381.1|2994892_2995189_-	hypothetical protein	NA	J7I457	Acinetobacter_phage	100.0	5.6e-58
WP_000959671.1|2995311_2996046_-	hypothetical protein	NA	J7HXD9	Acinetobacter_phage	100.0	5.1e-137
WP_000100186.1|2996056_2996458_-	DUF559 domain-containing protein	NA	A0A0P0IKL1	Acinetobacter_phage	100.0	1.9e-69
WP_001288422.1|2996457_2996682_-	hypothetical protein	NA	A0A0P0IY41	Acinetobacter_phage	100.0	9.4e-34
WP_095357150.1|2996674_2997037_-	hypothetical protein	NA	A0A0N7IRE2	Acinetobacter_phage	99.2	3.3e-68
WP_000648413.1|2997086_2997509_-	hypothetical protein	NA	A0A0P0I8A5	Acinetobacter_phage	100.0	1.0e-76
WP_000159938.1|2997495_2997630_-	putative phage replication protein	NA	A0A0D4DCC7	Acinetobacter_phage	100.0	5.6e-18
WP_002053037.1|2997626_2998397_-	ATP-binding protein	NA	A0A0D4DBZ2	Acinetobacter_phage	100.0	4.0e-148
WP_032059778.1|2998393_2999287_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	100.0	6.9e-160
WP_069597399.1|2999855_3000200_-	hypothetical protein	NA	A0A0P0IVS7	Acinetobacter_phage	96.4	5.9e-51
WP_001084132.1|3000196_3000493_-	hypothetical protein	NA	J7HXM0	Acinetobacter_phage	100.0	1.6e-49
WP_032045017.1|3000489_3000762_-	hypothetical protein	NA	J7I0V3	Acinetobacter_phage	91.1	1.4e-36
WP_000048916.1|3000823_3001144_-	hypothetical protein	NA	A0A0P0HSE9	Acinetobacter_phage	87.7	1.2e-42
WP_000703023.1|3001154_3001343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000052252.1|3001447_3002200_+	LexA family transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	74.3	5.5e-102
WP_000370485.1|3002214_3002430_+	hypothetical protein	NA	A0A0P0IKK4	Acinetobacter_phage	98.6	9.4e-31
WP_000048052.1|3002481_3003489_+	hypothetical protein	NA	A0A0P0IY33	Acinetobacter_phage	100.0	2.9e-183
WP_001129676.1|3003490_3003994_+	hypothetical protein	NA	A0A0P0I896	Acinetobacter_phage	100.0	1.1e-77
WP_000845537.1|3004132_3004336_+	hypothetical protein	NA	A0A0P0IKZ8	Acinetobacter_phage	100.0	1.2e-27
WP_000051960.1|3004342_3004585_-	hypothetical protein	NA	A0A0P0I4B0	Acinetobacter_phage	100.0	5.2e-38
WP_001101038.1|3004778_3005222_+	hypothetical protein	NA	A0A0N7IRF7	Acinetobacter_phage	94.5	1.7e-71
WP_000656405.1|3005221_3005512_+	hypothetical protein	NA	A0A0P0IDU2	Acinetobacter_phage	95.8	5.1e-48
WP_032001493.1|3005504_3005828_+	hypothetical protein	NA	A0A0D4DCB5	Acinetobacter_phage	98.1	2.0e-56
WP_001207477.1|3005838_3006960_+	ATP-binding protein	NA	A0A0D4DBX7	Acinetobacter_phage	100.0	2.6e-212
WP_001061230.1|3006956_3007916_+	hypothetical protein	NA	A0A0D4DBR8	Acinetobacter_phage	100.0	2.5e-176
WP_000654847.1|3007917_3008163_+	hypothetical protein	NA	A0A0P0IVN4	Acinetobacter_phage	100.0	1.5e-40
WP_014462820.1|3008165_3008567_+	hypothetical protein	NA	A0A0D4DBH6	Acinetobacter_phage	100.0	6.0e-71
WP_001286975.1|3008563_3008788_+	hypothetical protein	NA	A0A0D4DCJ9	Acinetobacter_phage	100.0	8.0e-33
WP_000096319.1|3008784_3008976_+	hypothetical protein	NA	A0A0D4DCB1	Acinetobacter_phage	100.0	5.4e-30
WP_000529848.1|3008976_3009246_+	hypothetical protein	NA	A0A0P0J067	Acinetobacter_phage	100.0	8.7e-42
WP_000566784.1|3009369_3009945_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	100.0	3.2e-110
3009361:3009377	attR	ATGCTTCTAATGATCGA	NA	NA	NA	NA
WP_000960548.1|3010040_3012740_-	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	100.0	0.0e+00
>prophage 17
NZ_CP017152	Acinetobacter baumannii DU202 chromosome, complete genome	4178958	3017096	3025355	4178958		Acinetobacter_phage(100.0%)	7	NA	NA
WP_001982145.1|3017096_3018146_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	100.0	9.8e-190
WP_000608304.1|3018155_3018962_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	100.0	7.9e-147
WP_000066126.1|3018971_3019667_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	100.0	5.8e-122
WP_001164226.1|3019677_3020661_-	xanthine dehydrogenase accessory protein XdhC	NA	A0A0P0IKN7	Acinetobacter_phage	100.0	2.0e-189
WP_001076817.1|3020667_3023043_-	xanthine dehydrogenase molybdopterin binding subunit	NA	A0A0P0I429	Acinetobacter_phage	100.0	0.0e+00
WP_000893683.1|3023044_3024544_-	xanthine dehydrogenase small subunit	NA	A0A0P0IVM8	Acinetobacter_phage	100.0	6.1e-286
WP_001187844.1|3024806_3025355_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	100.0	1.7e-97
