The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	240697	353788	6002284	tRNA,head,integrase,terminase,transposase,portal,tail,capsid,protease	Bacillus_phage(61.36%)	80	263779:263798	300618:300637
WP_000908526.1|240697_241270_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_000583419.1|241363_241723_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002094231.1|241879_242830_+	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000390593.1|242947_244117_+	alanine racemase	NA	NA	NA	NA	NA
WP_000004570.1|244425_244713_+	antitoxin EndoAI	NA	NA	NA	NA	NA
WP_000635965.1|244717_245068_+	type II toxin-antitoxin system endoribonuclease NdoA	NA	A0A2P0ZKX3	Lactobacillus_phage	37.7	1.7e-13
WP_000426207.1|245136_247305_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_001143640.1|247362_247479_-	cortex morphogenetic protein CmpA	NA	NA	NA	NA	NA
WP_000503730.1|247674_248133_+	SprT family protein	NA	NA	NA	NA	NA
WP_000049640.1|254624_255098_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_023520858.1|255078_255771_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000367207.1|255785_256229_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_000414595.1|256228_257245_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	43.1	4.1e-68
WP_043924594.1|257729_259718_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.5	2.3e-54
WP_000372699.1|259850_260480_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_001246201.1|260509_260701_-	YdiK family protein	NA	NA	NA	NA	NA
WP_000745323.1|260697_261447_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000917311.1|261838_262123_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029992.1|262161_263796_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.3e-156
263779:263798	attL	ATGGGCGGAATGATGTAATT	NA	NA	NA	NA
WP_023520860.1|263873_265055_-|integrase	site-specific integrase	integrase	A0A1W6JPB2	Staphylococcus_phage	50.5	4.8e-100
WP_023520861.1|265071_265683_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023520862.1|265867_266092_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_175056338.1|266148_266409_+	excisionase family DNA-binding protein	NA	A0A1W6JPE8	Staphylococcus_phage	66.2	1.6e-24
WP_023520864.1|266749_269143_+	DNA primase	NA	A0A1B1IMF8	Lactococcus_phage	42.1	1.3e-104
WP_023520865.1|269437_269848_+	hypothetical protein	NA	A0A2H4J819	uncultured_Caudovirales_phage	59.8	1.8e-51
WP_023520866.1|269861_269987_+	Fur-regulated basic protein FbpA	NA	NA	NA	NA	NA
WP_175056339.1|270958_271354_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023520868.1|271447_271831_+	hypothetical protein	NA	A0A288WFT8	Bacillus_phage	70.2	2.2e-46
WP_023520869.1|272293_273865_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	32.4	1.6e-39
WP_023520870.1|274064_274457_+	HNH endonuclease	NA	A0A2H4JFG4	uncultured_Caudovirales_phage	93.1	4.9e-70
WP_000104850.1|274542_274980_+|terminase	P27 family phage terminase small subunit	terminase	A0A2H4JFK0	uncultured_Caudovirales_phage	93.8	3.6e-69
WP_000572796.1|274976_276704_+|terminase	terminase large subunit	terminase	A0A2H4JDG5	uncultured_Caudovirales_phage	97.7	0.0e+00
WP_001009049.1|276718_276991_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	82.2	1.4e-42
WP_023520871.1|276990_277248_+	hypothetical protein	NA	A0A1B1P7N4	Bacillus_phage	64.7	9.2e-25
WP_023520872.1|277296_278481_+|portal	phage portal protein	portal	A0A1B1P7N5	Bacillus_phage	97.5	4.6e-220
WP_023520873.1|278470_279052_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B1P7P1	Bacillus_phage	95.3	7.0e-97
WP_023520874.1|279053_280370_+|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	97.2	3.4e-208
WP_043924595.1|280371_280632_+	phage protein	NA	A0A1B0T690	Bacillus_phage	100.0	8.4e-42
WP_043924596.1|280606_280942_+	phage protein	NA	A0A1C8E986	Bacillus_phage	97.2	5.5e-54
WP_023520877.1|280931_281261_+	hypothetical protein	NA	A0A1C8E981	Bacillus_phage	99.1	4.0e-57
WP_000157915.1|281260_281638_+	HK97 gp10 family phage protein	NA	A0A1B1P7P3	Bacillus_phage	98.4	8.7e-64
WP_000151366.1|281649_282285_+	hypothetical protein	NA	A0A1C8E980	Bacillus_phage	99.1	1.6e-115
WP_000113340.1|282296_282683_+	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	99.2	3.6e-65
WP_006927278.1|282721_282910_+	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	98.4	8.2e-31
WP_023520878.1|282926_286451_+|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	95.0	0.0e+00
WP_023520879.1|286451_287135_+|tail	phage tail family protein	tail	A0A1B0T6A0	Bacillus_phage	96.5	1.1e-125
WP_023520880.1|287131_289474_+|tail	phage tail protein	tail	A0A1B0T695	Bacillus_phage	98.2	0.0e+00
WP_023520881.1|290817_291048_+	hypothetical protein	NA	A0A1B1P7Q9	Bacillus_phage	97.4	4.8e-33
WP_023520882.1|291044_292097_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	92.2	5.6e-185
WP_023520883.1|292471_294715_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	28.5	1.0e-47
WP_080448637.1|294815_295178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023520885.1|295192_296314_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_023520886.1|296529_296865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023520887.1|296955_297819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023520888.1|298277_298616_-	hypothetical protein	NA	A0A1B1P7R0	Bacillus_phage	86.6	2.0e-43
WP_023520889.1|298754_298973_+	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	91.7	3.6e-30
WP_023520890.1|298996_299290_+	YolD-like family protein	NA	A0A1C8E992	Bacillus_phage	85.6	4.7e-41
WP_167332619.1|301038_302580_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.9e-22
300618:300637	attR	ATGGGCGGAATGATGTAATT	NA	NA	NA	NA
WP_000833096.1|302966_304292_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_023520893.1|304437_305139_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_023520894.1|305122_306628_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	5.4e-32
WP_043924598.1|312221_313124_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000687922.1|313323_314055_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_023520896.1|319180_320257_-	glycoside hydrolase family 99-like domain-containing protein	NA	NA	NA	NA	NA
WP_023520897.1|320489_321362_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000405127.1|321389_322112_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023520898.1|322327_323122_-	sulfotransferase family 2 domain-containing protein	NA	A0A288WG17	Bacillus_phage	50.8	3.3e-65
WP_001230828.1|323414_324359_+	GDP-mannose 4,6-dehydratase	NA	L7RCI0	Acanthamoeba_polyphaga_moumouvirus	31.3	1.6e-26
WP_023520899.1|324399_325176_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023520900.1|325242_327174_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_023520901.1|332664_334077_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_023520902.1|334194_335154_+	proline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_001072428.1|341284_341743_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_001279951.1|342099_342897_-	undecaprenyl-diphosphate phosphatase UppP	NA	NA	NA	NA	NA
WP_000247717.1|342914_343652_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000074583.1|343644_344574_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.8	3.0e-41
WP_000845349.1|344642_345656_-	HAMP domain-containing histidine kinase	NA	A0A2K9L4R6	Tupanvirus	23.4	1.6e-08
WP_000652004.1|345645_346359_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.2	3.8e-36
WP_000658281.1|351876_352797_+	DMT family transporter	NA	NA	NA	NA	NA
WP_023520903.1|352918_353788_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	362208	370584	6002284		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|362208_363516_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170549.1|363604_364324_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.8	8.0e-50
WP_000278823.1|364316_364571_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666785.1|364567_365251_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000055559.1|365234_367454_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	2.0e-163
WP_000879026.1|367438_368854_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262441.1|368959_370000_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	2.1e-67
WP_000088590.1|369996_370584_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 3
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	397435	436801	6002284	tRNA,head,integrase,terminase,portal,tail,capsid,protease	Bacillus_phage(94.59%)	51	415154:415182	450120:450148
WP_000086999.1|397435_397726_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_000051441.1|397741_399199_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_001047685.1|399213_400641_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_000977679.1|401199_402105_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	30.8	4.1e-27
WP_000416662.1|402245_402992_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_023520919.1|403146_404511_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	NA	NA	NA	NA
WP_000225140.1|404626_405994_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_023520920.1|405986_407438_+	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000263262.1|407485_407809_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000915109.1|407941_408433_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_000007349.1|408478_409708_-	aminopeptidase	NA	NA	NA	NA	NA
WP_023520921.1|409824_410907_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000643594.1|411054_411228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023520922.1|411444_412152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001200491.1|412198_413395_-	NupC family nucleoside transporter	NA	NA	NA	NA	NA
WP_023520923.1|413820_415200_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	46.4	1.9e-116
415154:415182	attL	ATACGACGCATGTGGAGTGTGTGGCTTGG	NA	NA	NA	NA
WP_023520924.1|415258_416383_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	100.0	5.5e-215
WP_023520925.1|416555_416714_+	hypothetical protein	NA	A0A1B0T6B0	Bacillus_phage	100.0	3.9e-18
WP_023520926.1|417381_417708_-	TM2 domain-containing protein	NA	A0A1B0T6B3	Bacillus_phage	98.1	6.3e-55
WP_023520927.1|418753_419899_+	hypothetical protein	NA	A0A1B0T6A5	Bacillus_phage	100.0	2.4e-213
WP_157762857.1|420251_420422_+	hypothetical protein	NA	A0A1B0T6D8	Bacillus_phage	100.0	7.4e-15
WP_023520928.1|420468_420822_-	helix-turn-helix transcriptional regulator	NA	A0A1B0T6A7	Bacillus_phage	100.0	1.9e-57
WP_023520929.1|421046_421268_+	helix-turn-helix transcriptional regulator	NA	A0A1B0T6B2	Bacillus_phage	100.0	2.7e-33
WP_023520930.1|421286_421637_+	helix-turn-helix domain-containing protein	NA	A0A1B0T6C2	Bacillus_phage	100.0	5.8e-62
WP_157762858.1|421633_421801_+	hypothetical protein	NA	A0A1B0T6C1	Bacillus_phage	100.0	1.2e-22
WP_023520932.1|422013_422733_+	DnaD domain protein	NA	A0A1B0T6C0	Bacillus_phage	100.0	2.5e-104
WP_023520933.1|422680_423544_+	ATP-binding protein	NA	A0A1B0T6C3	Bacillus_phage	98.8	1.1e-138
WP_023520934.1|423546_423741_+	hypothetical protein	NA	A0A1B0T6B4	Bacillus_phage	100.0	4.9e-31
WP_023520935.1|423765_423939_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	100.0	4.7e-25
WP_023520936.1|423953_424208_+	hypothetical protein	NA	A0A1B0T6B9	Bacillus_phage	100.0	1.3e-42
WP_023520938.1|424663_424855_+	hypothetical protein	NA	A0A1B0T6B5	Bacillus_phage	100.0	3.9e-28
WP_023520939.1|424913_425312_+	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	99.2	2.5e-69
WP_142326415.1|425989_426121_+	DUF3983 domain-containing protein	NA	A0A1B0T6D3	Bacillus_phage	100.0	4.8e-14
WP_000645943.1|426225_426387_+	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	100.0	4.4e-17
WP_023520941.1|426412_426901_+	epimerase/dehydratase	NA	A0A1B0T6C9	Bacillus_phage	100.0	1.2e-86
WP_023520942.1|426897_427440_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	96.7	7.5e-93
WP_023520943.1|427648_427894_+	hypothetical protein	NA	A0A1B0T6C4	Bacillus_phage	100.0	1.4e-38
WP_023520944.1|428245_428560_+	phage protein	NA	A0A1B0T6C6	Bacillus_phage	100.0	1.1e-51
WP_023520945.1|428556_428949_+	HNH endonuclease	NA	A0A1B0T6C5	Bacillus_phage	100.0	1.0e-75
WP_023520946.1|429031_429457_+|terminase	P27 family phage terminase small subunit	terminase	A0A1B0T688	Bacillus_phage	100.0	4.0e-73
WP_023520947.1|429453_431178_+|terminase	terminase large subunit	terminase	A0A1B0T685	Bacillus_phage	99.1	0.0e+00
WP_023520948.1|431193_432378_+|portal	phage portal protein	portal	A0A1B0T684	Bacillus_phage	100.0	2.8e-225
WP_023520949.1|432367_432949_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B0T687	Bacillus_phage	100.0	1.8e-100
WP_023520950.1|432950_434261_+|capsid	phage major capsid protein	capsid	A0A1B0T682	Bacillus_phage	100.0	7.9e-197
WP_043924595.1|434262_434523_+	phage protein	NA	A0A1B0T690	Bacillus_phage	100.0	8.4e-42
WP_043924601.1|434497_434833_+|head,tail	head-tail adaptor protein	head,tail	A0A1B0T691	Bacillus_phage	100.0	2.2e-55
WP_001167233.1|434822_435152_+	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	100.0	3.1e-57
WP_000168639.1|435151_435529_+	HK97 gp10 family phage protein	NA	A0A1B0T694	Bacillus_phage	100.0	6.6e-64
WP_023520952.1|435540_436176_+	phage protein	NA	A0A1B0T693	Bacillus_phage	99.5	3.7e-115
WP_023520953.1|436187_436574_+	hypothetical protein	NA	A0A1B1P7Q6	Bacillus_phage	98.4	4.0e-64
WP_000383691.1|436612_436801_+	hypothetical protein	NA	A0A1B0T6A1	Bacillus_phage	100.0	1.6e-31
450120:450148	attR	ATACGACGCATGTGGAGTGTGTGGCTTGG	NA	NA	NA	NA
>prophage 4
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	440342	449446	6002284	plate,tail	Bacillus_phage(100.0%)	7	NA	NA
WP_023520954.1|440342_441026_+|tail	phage tail family protein	tail	A0A1B0T6A0	Bacillus_phage	98.7	8.2e-129
WP_023520955.1|443379_444648_+|plate	BppU family phage baseplate upper protein	plate	A0A1B0T696	Bacillus_phage	100.0	1.2e-239
WP_023520956.1|444708_444939_+	hypothetical protein	NA	A0A1B0T697	Bacillus_phage	98.7	2.8e-33
WP_023520957.1|444935_445988_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	99.1	6.6e-202
WP_023520958.1|446023_446221_-	hypothetical protein	NA	A0A1B0T6A3	Bacillus_phage	100.0	2.4e-25
WP_023520959.1|446880_448071_-	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	98.5	7.9e-220
WP_023520961.1|448810_449446_-	hypothetical protein	NA	A0A1B0T6B1	Bacillus_phage	100.0	3.4e-97
>prophage 5
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	752242	760400	6002284		Bacillus_phage(66.67%)	8	NA	NA
WP_023521050.1|752242_753196_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.9	3.1e-17
WP_023521051.1|753300_753822_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_000822580.1|753987_755379_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.5	3.1e-34
WP_023521052.1|755390_756068_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.6	1.4e-32
WP_000738870.1|756243_757491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277054.1|757624_758155_+	DUF4352 domain-containing protein	NA	A0A0S2MVG4	Bacillus_phage	33.5	2.5e-16
WP_000831286.1|758167_758512_+	DUF4064 domain-containing protein	NA	A0A0S2MVJ2	Bacillus_phage	78.1	8.5e-42
WP_000487919.1|758948_760400_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	54.4	5.8e-140
>prophage 6
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	772057	790921	6002284	integrase	Bacillus_phage(66.67%)	28	773523:773538	789672:789687
WP_001132859.1|772057_772954_+	ribokinase	NA	A0A0K0KW05	Prochlorococcus_phage	30.9	1.5e-05
WP_000716151.1|772950_773346_+	D-ribose pyranase	NA	NA	NA	NA	NA
773523:773538	attL	AAAAGATGGTGGAACA	NA	NA	NA	NA
WP_023521054.1|773750_774911_-|integrase	site-specific integrase	integrase	A0A1C8E994	Bacillus_phage	93.0	1.4e-205
WP_023521055.1|774989_775448_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0S2MV59	Bacillus_phage	40.5	6.5e-21
WP_023521056.1|775476_775914_-	helix-turn-helix transcriptional regulator	NA	A0A1C8E9A4	Bacillus_phage	47.3	7.3e-30
WP_023521057.1|776185_776371_+	helix-turn-helix transcriptional regulator	NA	A0A0M3ULF9	Bacillus_phage	80.4	1.3e-17
WP_023521058.1|776370_776643_+	DUF771 domain-containing protein	NA	A0A1C8E9B3	Bacillus_phage	88.9	5.7e-41
WP_157762859.1|776671_776842_+	hypothetical protein	NA	A0A1B1P7M3	Bacillus_phage	57.4	2.4e-05
WP_023521059.1|776858_777644_+	antA/AntB antirepressor family protein	NA	A0A0B5D0I2	Listeria_phage	39.4	1.7e-24
WP_043924609.1|777721_778072_+	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	80.2	1.3e-45
WP_043924749.1|778167_778368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167332609.1|778369_778546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023521063.1|778542_778734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043924610.1|778739_779411_+	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	91.0	1.9e-114
WP_023521065.1|779432_779909_+	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	47.5	3.3e-28
WP_023521066.1|779981_782336_+	hypothetical protein	NA	A0A1B2AQ05	Phage_Wrath	78.2	0.0e+00
WP_043924611.1|782818_783247_+	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	71.8	2.8e-58
WP_023521068.1|783249_783789_+	ERCC4 domain-containing protein	NA	A0A0S2SXQ1	Bacillus_phage	52.0	3.6e-47
WP_023521069.1|784308_784545_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_023521070.1|784551_784800_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023521071.1|784893_785289_+	phage protein	NA	A0A288WFT8	Bacillus_phage	84.7	8.8e-59
WP_023521072.1|785537_785852_+	phage protein	NA	A0A1B0T6C6	Bacillus_phage	83.7	2.4e-43
WP_000872551.1|785848_786241_+	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	93.1	6.4e-70
WP_000827883.1|788335_788560_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	44.8	2.8e-09
WP_023521073.1|788598_789216_-	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	41.0	1.1e-31
WP_023521074.1|789154_790336_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	56.2	7.8e-127
789672:789687	attR	TGTTCCACCATCTTTT	NA	NA	NA	NA
WP_023521075.1|790437_790623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023521076.1|790624_790921_-	hypothetical protein	NA	H0USY0	Bacillus_phage	43.7	5.8e-15
>prophage 7
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	820399	922673	6002284	head,integrase,terminase,plate,transposase,portal,tail,capsid,bacteriocin,protease	Bacillus_phage(84.06%)	98	838641:838657	915832:915848
WP_023520903.1|820399_821269_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_023521098.1|821914_822487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023521099.1|822514_823765_+	replication/maintenance protein RepL	NA	NA	NA	NA	NA
WP_000431537.1|823796_823967_-	ribbon-helix-helix domain-containing protein	NA	B5LPT4	Bacillus_virus	53.7	3.7e-06
WP_043924613.1|824076_824613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023521101.1|824659_824818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157762860.1|824843_824987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006920904.1|825069_825378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006920905.1|825496_826156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080672338.1|826205_828338_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	33.6	2.9e-63
WP_043924614.1|828865_829648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023521104.1|829953_830139_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_023521105.1|830261_830543_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	55.7	7.0e-10
WP_023521106.1|830564_830753_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_023521107.1|830850_831129_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	61.8	4.3e-20
WP_023521109.1|831601_831910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023521110.1|832341_833283_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_023521111.1|833329_833617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023521113.1|834380_835835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080672461.1|836062_836740_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	36.6	1.1e-21
WP_023521115.1|837609_839193_+	amidase	NA	NA	NA	NA	NA
838641:838657	attL	TGAGAAAATAAAAGTAG	NA	NA	NA	NA
WP_023521119.1|841214_841778_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	37.8	7.4e-27
WP_157762861.1|845085_845526_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	4.9e-34
WP_023521123.1|845567_846347_-	RNA polymerase sigma factor SigB	NA	A0A0Y0ATF9	Bacillus_phage	30.4	8.2e-16
WP_023521124.1|846312_846801_-	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_023521125.1|846808_847129_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_000022437.1|847319_848462_+	fused response regulator/phosphatase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	30.1	7.0e-08
WP_023521126.1|848634_851343_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.3	9.1e-38
WP_023521128.1|853858_854440_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1B0T687	Bacillus_phage	94.3	6.2e-93
WP_023521129.1|854441_855752_+|capsid	phage major capsid protein	capsid	A0A1C8E976	Bacillus_phage	95.3	5.9e-200
WP_023521130.1|855753_856014_+|head,tail	phage head-tail connector protein	head,tail	A0A1B1P7M9	Bacillus_phage	95.3	6.0e-40
WP_043924615.1|855988_856324_+|head,tail	head-tail adaptor protein	head,tail	A0A1C8E986	Bacillus_phage	98.2	1.5e-54
WP_023521132.1|856313_856643_+	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	97.2	9.9e-56
WP_023521133.1|856642_857020_+	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	98.4	1.5e-63
WP_023521134.1|857031_857667_+	phage protein	NA	A0A1B1P7Q4	Bacillus_phage	97.6	1.4e-114
WP_023521135.1|857678_858065_+	hypothetical protein	NA	A0A1B1P7Q6	Bacillus_phage	98.4	6.1e-65
WP_006927278.1|858103_858292_+	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	98.4	8.2e-31
WP_023521136.1|858308_861830_+|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	95.6	0.0e+00
WP_023521137.1|861831_862515_+|tail	phage tail family protein	tail	A0A1B1P7Q0	Bacillus_phage	96.0	6.1e-124
WP_023521138.1|862511_864854_+|tail	phage tail protein	tail	A0A1B0T695	Bacillus_phage	95.6	0.0e+00
WP_023521139.1|864868_866044_+|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	77.1	2.2e-166
WP_033692567.1|866107_866338_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	97.4	3.7e-33
WP_023521140.1|866334_867396_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B1P878	Bacillus_phage	80.5	6.2e-168
WP_023521141.1|867832_871570_-	pesticidal crystal protein cry5Ba	NA	NA	NA	NA	NA
WP_023521142.1|871887_872955_-	hypothetical protein	NA	A0A0S2MVF4	Bacillus_phage	40.8	2.0e-09
WP_001074641.1|874477_875413_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_000758975.1|875427_876354_+	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_000667666.1|876388_877036_+	fructose-6-phosphate aldolase	NA	G8EY84	Synechococcus_phage	48.8	5.1e-48
WP_023520903.1|879168_880038_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_021036119.1|881139_881481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000873271.1|881516_882671_-	MFS transporter	NA	NA	NA	NA	NA
WP_000645827.1|882896_883949_+	(R,R)-butanediol dehydrogenase	NA	E3SJ82	Synechococcus_phage	27.6	3.9e-21
WP_023521146.1|884067_884412_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_000730997.1|884665_885517_+	phospholipase C	NA	NA	NA	NA	NA
WP_023521147.1|885593_886640_+	sphingomyelin phosphodiesterase	NA	A0A1P8L6H7	Staphylococcus_phage	59.0	3.1e-87
WP_000262043.1|886578_887679_-|integrase	site-specific integrase	integrase	A0A0S2GLI2	Bacillus_phage	96.7	1.4e-199
WP_023521148.1|888505_889708_+	hypothetical protein	NA	W8CYT9	Bacillus_phage	43.1	6.8e-86
WP_000511081.1|890050_890395_-	helix-turn-helix transcriptional regulator	NA	W8CZ48	Bacillus_phage	100.0	1.9e-57
WP_023521149.1|890543_890780_+	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	97.4	8.1e-36
WP_023521150.1|890812_891001_+	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	96.8	4.6e-26
WP_023521151.1|891025_891181_+	hypothetical protein	NA	I7J4K2	Bacillus_phage	94.1	1.7e-21
WP_023521152.1|891226_892006_+	ORF6C domain-containing protein	NA	A0A0S2GLP8	Bacillus_phage	99.2	2.0e-139
WP_023521153.1|892169_892484_+	hypothetical protein	NA	H0USU0	Bacillus_phage	93.3	3.6e-47
WP_023521154.1|892757_893405_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2GLJ1	Bacillus_phage	96.3	1.1e-111
WP_023521155.1|893646_894663_+	hypothetical protein	NA	A0A0S2GLI6	Bacillus_phage	96.2	1.2e-181
WP_016098382.1|894625_895438_+	ATP-binding protein	NA	A0A0S2GLK2	Bacillus_phage	99.6	1.0e-154
WP_000436951.1|895479_895746_+	hypothetical protein	NA	A0A0S2GLK4	Bacillus_phage	100.0	7.7e-43
WP_016098383.1|895817_895982_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	98.1	2.9e-24
WP_023521156.1|896281_896689_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_023521157.1|896877_897126_-	hypothetical protein	NA	A0A288WFY7	Bacillus_phage	92.7	8.5e-36
WP_023521158.1|898224_898383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023521159.1|898520_898802_+	hypothetical protein	NA	A0A0S2GLD3	Bacillus_phage	97.8	2.2e-43
WP_023521160.1|899163_899649_+	phage transcriptional regulator, ArpU family protein	NA	H0USV3	Bacillus_phage	80.1	1.2e-70
WP_023521161.1|899645_900188_+|integrase	site-specific integrase	integrase	H0USV4	Bacillus_phage	98.9	1.0e-94
WP_043924616.1|900394_900640_+	hypothetical protein	NA	W8CYG8	Bacillus_phage	96.3	1.0e-36
WP_023521163.1|901038_901326_+	hypothetical protein	NA	H0USV6	Bacillus_phage	96.8	8.1e-46
WP_023521164.1|901362_901590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023521165.1|901635_901821_+	hypothetical protein	NA	A0A0S2GLH7	Bacillus_phage	96.7	1.6e-23
WP_023521166.1|901849_902089_+	hypothetical protein	NA	A0A0S2GLE8	Bacillus_phage	97.5	2.6e-21
WP_000773601.1|902105_902318_+	hypothetical protein	NA	H0USV9	Bacillus_phage	97.1	1.0e-29
WP_023521168.1|902696_903074_+	HNH endonuclease	NA	H0USW1	Bacillus_phage	97.6	9.9e-68
WP_000233390.1|903202_903706_+|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	99.4	1.0e-88
WP_043924758.1|903707_905402_+|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	99.1	0.0e+00
WP_023521170.1|905681_906875_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.8	1.0e-25
WP_023521171.1|907173_908427_+|portal	phage portal protein	portal	H0USW4	Bacillus_phage	99.5	2.9e-241
WP_023521172.1|908413_909124_+|protease	Clp protease ClpP	protease	H0USW5	Bacillus_phage	99.2	3.6e-127
WP_023521173.1|909161_910328_+|capsid	phage major capsid protein	capsid	W8CYN2	Bacillus_phage	96.6	1.5e-207
WP_023521174.1|910348_910636_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0S2GLH6	Bacillus_phage	97.9	2.0e-44
WP_023521175.1|910622_910946_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	96.3	1.8e-54
WP_000763224.1|910938_911376_+	HK97 gp10 family phage protein	NA	A0A0S2GLH3	Bacillus_phage	99.3	1.8e-76
WP_023521176.1|911372_911732_+	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	96.6	1.9e-60
WP_023521177.1|911732_912341_+|tail	phi13 family phage major tail protein	tail	W8CYT6	Bacillus_phage	96.0	5.1e-98
WP_023521178.1|912389_912707_+	hypothetical protein	NA	Q2I8F1	Bacillus_phage	88.6	4.7e-47
WP_023521179.1|912736_912913_+	hypothetical protein	NA	W8CYG0	Bacillus_phage	98.3	1.5e-26
WP_043924617.1|912927_914244_+|tail	phage tail tape measure protein	tail	W8CZ45	Bacillus_phage	98.2	1.7e-167
WP_043924618.1|914425_917119_+|tail	phage tail tape measure protein	tail	A0A0S2GLG8	Bacillus_phage	96.3	5.9e-255
915832:915848	attR	TGAGAAAATAAAAGTAG	NA	NA	NA	NA
WP_043924619.1|917130_918615_+|tail	phage tail family protein	tail	W8CYY9	Bacillus_phage	99.4	1.2e-294
WP_023521181.1|918611_922673_+|tail	tail fiber domain-containing protein	tail	W8CYT7	Bacillus_phage	96.6	0.0e+00
>prophage 8
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	1808675	1838567	6002284	integrase,terminase,plate,transposase,tail	Bacillus_phage(70.0%)	49	1800634:1800650	1838292:1838308
1800634:1800650	attL	GAGAAGTTGATTGATTT	NA	NA	NA	NA
WP_052364207.1|1808675_1809977_+	hypothetical protein	NA	A0A288WG12	Bacillus_phage	88.9	2.3e-225
WP_080672358.1|1810300_1810657_-	helix-turn-helix transcriptional regulator	NA	Q2I8D5	Bacillus_phage	90.7	5.5e-52
WP_023521536.1|1810817_1811045_+	helix-turn-helix transcriptional regulator	NA	A0A288WG39	Bacillus_phage	88.0	6.4e-30
WP_023521537.1|1811083_1811242_+	hypothetical protein	NA	A0A288WGC5	Bacillus_phage	88.5	1.9e-17
WP_023521538.1|1811314_1811470_+	hypothetical protein	NA	A0A288WFZ6	Bacillus_phage	80.4	1.2e-16
WP_023521539.1|1811525_1811846_+	germination protein PF	NA	A0A0S2GLB6	Bacillus_phage	62.7	1.6e-26
WP_023521540.1|1811973_1812966_+	DnaD domain protein	NA	D2XR43	Bacillus_phage	52.2	4.0e-60
WP_023521541.1|1812969_1813248_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	62.7	8.7e-13
WP_023521542.1|1813240_1813600_+	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	52.5	1.4e-31
WP_023521543.1|1813618_1813783_+	DUF3954 domain-containing protein	NA	A0A0S2GLF5	Bacillus_phage	48.1	1.5e-09
WP_023521544.1|1813808_1814282_+	hypothetical protein	NA	A0A1B1P7W1	Bacillus_phage	36.9	5.1e-05
WP_023521545.1|1814307_1814817_+	dUTP diphosphatase	NA	A0A1L2JY27	Aeribacillus_phage	45.1	3.9e-27
WP_023521546.1|1814820_1815294_+	hypothetical protein	NA	A0A288WFT9	Bacillus_phage	70.5	7.5e-65
WP_023521547.1|1815373_1815559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043924639.1|1815595_1815994_+	hypothetical protein	NA	A0A1B0T6B6	Bacillus_phage	97.7	8.0e-68
WP_023521549.1|1816077_1816368_+	hypothetical protein	NA	A0A1B1P8C3	Bacillus_phage	62.5	3.9e-24
WP_023521550.1|1816412_1816787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023521551.1|1816829_1817372_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1I9KKE7	Lactobacillus_phage	56.2	9.9e-53
WP_167332613.1|1817271_1817754_+	DNA cytosine methyltransferase	NA	A0A218MND0	uncultured_virus	48.1	9.5e-23
WP_023521553.1|1817791_1817917_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_023521554.1|1818032_1818203_+	hypothetical protein	NA	A0A1B0T6D0	Bacillus_phage	71.4	3.9e-08
WP_023521555.1|1818229_1818712_+	conjugal transfer protein TraR	NA	H0USV3	Bacillus_phage	84.4	3.4e-73
WP_099046434.1|1818780_1819570_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_043924640.1|1819565_1820105_+|integrase	site-specific integrase	integrase	A0A0S2GLG4	Bacillus_phage	88.4	2.0e-77
WP_023521558.1|1820314_1821280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023521559.1|1821627_1821846_+	cell division protein FtsK	NA	A0A160DCQ1	Gordonia_phage	48.1	2.1e-06
WP_023521560.1|1821867_1822281_+	HNH endonuclease	NA	Q0SPJ9	Clostridium_phage	43.0	3.6e-23
WP_023521561.1|1822381_1822903_+|terminase	phage terminase small subunit P27 family	terminase	Q9ZXG2	Bacillus_phage	66.1	2.3e-54
WP_023521562.1|1822911_1823070_+	hypothetical protein	NA	A0A286QRG1	Streptococcus_phage	64.1	3.3e-09
WP_023520826.1|1823547_1824822_+	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_080672360.1|1824882_1825293_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_023521564.1|1825310_1826165_+	hypothetical protein	NA	A0A0K2CY64	Paenibacillus_phage	36.9	2.1e-20
WP_023521565.1|1826181_1827303_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	37.4	2.0e-63
WP_023521566.1|1827349_1829953_+|plate	BppU family phage baseplate upper protein	plate	U5Q0T6	Bacillus_phage	57.0	1.2e-239
WP_023521567.1|1830025_1830262_+	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	96.2	2.2e-17
WP_023521568.1|1830261_1830501_+	hypothetical protein	NA	A0A2H4J378	uncultured_Caudovirales_phage	92.4	8.0e-31
WP_023521569.1|1830497_1831562_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	89.8	2.7e-187
WP_023521570.1|1831669_1832209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023521571.1|1832262_1832616_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	29.8	2.0e-09
WP_023521572.1|1832688_1832883_-	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	46.0	5.9e-08
WP_023521573.1|1833046_1833349_+	hypothetical protein	NA	Q2I8E3	Bacillus_phage	95.0	4.8e-49
WP_023521574.1|1833351_1833534_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	4.6e-23
WP_023521575.1|1833649_1834831_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	82.2	2.7e-188
WP_043924642.1|1834772_1835393_+	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	78.6	1.5e-92
WP_023521577.1|1835407_1835620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023521578.1|1835647_1835884_-	helix-turn-helix domain-containing protein	NA	Q2I8D9	Bacillus_phage	94.9	2.2e-33
WP_023521579.1|1836047_1836167_+	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	69.2	4.0e-07
WP_023521580.1|1836182_1837046_+	helix-turn-helix domain-containing protein	NA	A0A288WFX2	Bacillus_phage	90.9	1.6e-142
WP_080672361.1|1837112_1838567_+	recombinase family protein	NA	Q3HKZ2	Bacillus_phage	93.4	1.1e-260
1838292:1838308	attR	GAGAAGTTGATTGATTT	NA	NA	NA	NA
>prophage 9
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	2147131	2156430	6002284		Bacillus_phage(71.43%)	9	NA	NA
WP_000755523.1|2147131_2148424_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.3	5.0e-10
WP_023521720.1|2148523_2149288_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453879.1|2149528_2151289_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.0	1.8e-273
WP_015055113.1|2151329_2152007_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.5e-122
WP_001231619.1|2152003_2153077_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.8	8.8e-186
WP_003270270.1|2153101_2153695_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|2153885_2154605_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000014165.1|2154752_2155424_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	92.0	1.8e-64
WP_023521721.1|2155557_2156430_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	44.0	9.0e-64
>prophage 10
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	4229760	4306739	6002284	tRNA,head,integrase,holin,terminase,transposase,portal,tail,capsid,protease	Bacillus_phage(63.04%)	85	4229388:4229404	4307130:4307146
4229388:4229404	attL	CTATTTCCATTTTAAAT	NA	NA	NA	NA
WP_023522858.1|4229760_4232526_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	28.2	5.4e-86
WP_001131611.1|4232872_4233379_-	septum site-determining protein DivIVA	NA	NA	NA	NA	NA
WP_023522859.1|4233468_4234236_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_000214324.1|4234251_4234515_-	YggT family protein	NA	NA	NA	NA	NA
WP_000119129.1|4234521_4234992_-	cell division protein SepF	NA	NA	NA	NA	NA
WP_023522860.1|4235011_4235686_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_001209012.1|4235682_4236501_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_000236749.1|4236620_4236902_-	YlmC/YmxH family sporulation protein	NA	NA	NA	NA	NA
WP_000197755.1|4237065_4237845_-	RNA polymerase sporulation sigma factor SigG	NA	A0A0Y0AU18	Bacillus_phage	43.9	3.4e-46
WP_000976948.1|4238002_4238722_-	RNA polymerase sporulation sigma factor SigE	NA	A0A2H4JC68	uncultured_Caudovirales_phage	42.9	3.3e-19
WP_023522861.1|4238741_4239659_-	sigma-E processing peptidase SpoIIGA	NA	NA	NA	NA	NA
WP_000888984.1|4239919_4241074_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_001087557.1|4241113_4242421_-	cell division protein FtsA	NA	NA	NA	NA	NA
WP_001065789.1|4242820_4243591_-	cell division protein DivIB	NA	NA	NA	NA	NA
WP_023522862.1|4243689_4244595_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_023522863.1|4244808_4245903_-	undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_000753524.1|4246006_4247098_-	stage V sporulation protein E	NA	NA	NA	NA	NA
WP_000860103.1|4247188_4248541_-	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_023522864.1|4248541_4249516_-	phospho-N-acetylmuramoyl-pentapeptide- transferase	NA	NA	NA	NA	NA
WP_000766289.1|4249538_4251014_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_023522865.1|4251199_4253116_-	stage V sporulation protein D	NA	NA	NA	NA	NA
WP_043924825.1|4253197_4255297_-	penicillin-binding protein	NA	NA	NA	NA	NA
WP_000182804.1|4255369_4255732_-	cell division protein FtsL	NA	NA	NA	NA	NA
WP_000472508.1|4255747_4256680_-	16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH	NA	NA	NA	NA	NA
WP_023522867.1|4257049_4258666_-	bacillithiol biosynthesis cysteine-adding enzyme BshC	NA	NA	NA	NA	NA
WP_014482115.1|4258745_4259630_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_000506690.1|4259925_4260399_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000246469.1|4260434_4260941_-	RsfA family transcriptional regulator	NA	G3MB11	Bacillus_virus	34.7	3.0e-11
WP_001984764.1|4261070_4261244_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_000872146.1|4261305_4261806_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_023522868.1|4262397_4262910_+	hypothetical protein	NA	D2XR34	Bacillus_phage	87.1	1.7e-41
WP_023522869.1|4263288_4264062_-	N-acetylmuramoyl-L-alanine amidase	NA	S5M842	Bacillus_phage	60.7	1.1e-76
WP_023522870.1|4264061_4264502_-|holin	phage holin family protein	holin	A0A1B1P7S2	Bacillus_phage	92.5	6.5e-71
WP_023520826.1|4265576_4266851_-	group II intron reverse transcriptase/maturase	NA	NA	NA	NA	NA
WP_023522873.1|4267367_4273172_-|tail	phage tail protein	tail	D2XR28	Bacillus_phage	43.7	0.0e+00
WP_023522874.1|4273168_4274644_-|tail	phage tail family protein	tail	A0A1Z1LZM7	Bacillus_phage	55.8	4.2e-162
WP_080672425.1|4274685_4278312_-	DUF2207 domain-containing protein	NA	A0A2H4JAI2	uncultured_Caudovirales_phage	86.0	1.0e-185
WP_023522876.1|4278324_4278900_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	70.6	2.4e-41
WP_023522877.1|4278906_4279500_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	91.3	1.4e-100
WP_023522878.1|4279500_4279830_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	95.4	5.4e-54
WP_023522879.1|4279829_4280171_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	87.6	1.9e-49
WP_023522880.1|4280172_4280523_-|head	phage head closure protein	head	D2XR20	Bacillus_phage	87.8	1.9e-52
WP_023522881.1|4280524_4280818_-	hypothetical protein	NA	D2XR19	Bacillus_phage	89.7	2.9e-43
WP_023522882.1|4280830_4281994_-|capsid	phage major capsid protein	capsid	A0A2H4JH29	uncultured_Caudovirales_phage	95.6	6.8e-208
WP_023522883.1|4282013_4282790_-|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	53.7	4.6e-59
WP_023521170.1|4283090_4284284_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.8	1.0e-25
WP_043924828.1|4284377_4285463_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	90.5	2.4e-183
WP_023522885.1|4285528_4287187_-|terminase	terminase large subunit	terminase	A0A2H4JHE9	uncultured_Caudovirales_phage	79.0	8.6e-257
WP_043924700.1|4287183_4287519_-	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	31.2	2.3e-07
WP_023522887.1|4287672_4288008_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	83.8	2.7e-48
WP_023522888.1|4288023_4288332_-	hypothetical protein	NA	A0A288WFY9	Bacillus_phage	45.8	1.2e-15
WP_023522889.1|4288814_4289027_-	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	84.3	2.0e-25
WP_023522890.1|4290133_4290325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023522891.1|4290800_4291022_-	hypothetical protein	NA	A0A1B0T6C4	Bacillus_phage	43.8	2.2e-11
WP_006929356.1|4291238_4291781_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	95.0	1.7e-92
WP_023522892.1|4291780_4292263_-	ArpU family phage transcriptional regulator	NA	H0USV3	Bacillus_phage	83.1	2.0e-73
WP_000645584.1|4292542_4292665_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_001013298.1|4292917_4293163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023522893.1|4294033_4294438_+	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	57.8	1.8e-06
WP_023522894.1|4295033_4295309_-	hypothetical protein	NA	J9PL99	Bacillus_phage	70.0	4.1e-31
WP_023522895.1|4295492_4295975_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	48.2	1.2e-20
WP_023522896.1|4295994_4296246_-	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	8.4e-07
WP_000717826.1|4296271_4296439_-	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	62.3	1.4e-13
WP_023522897.1|4296457_4296817_-	hypothetical protein	NA	A0A1B1P7A1	Bacillus_phage	52.5	3.2e-31
WP_023522898.1|4296809_4297088_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	57.6	5.7e-12
WP_023522899.1|4297104_4297299_-	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	87.5	5.3e-25
WP_023522900.1|4297379_4297604_+	hypothetical protein	NA	Q9T1I9	Lactobacillus_phage	61.4	2.6e-15
WP_023522901.1|4297600_4297804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052364204.1|4297820_4298696_-	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	45.8	4.5e-63
WP_023522903.1|4298634_4299522_-	DnaD domain protein	NA	W8CYG5	Bacillus_phage	43.6	1.1e-43
WP_023522904.1|4299528_4299705_-	hypothetical protein	NA	A0A0U3SQC4	Bacillus_phage	94.7	1.4e-24
WP_023522905.1|4299734_4299899_-	hypothetical protein	NA	A0A0U3B230	Bacillus_phage	79.6	4.5e-17
WP_023522906.1|4299955_4300156_-	helix-turn-helix domain-containing protein	NA	A0A0U4IIS1	Bacillus_phage	48.0	1.5e-06
WP_023522907.1|4300214_4300436_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023522908.1|4300656_4301025_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	38.7	7.0e-10
WP_023522910.1|4301292_4301442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023522911.1|4301454_4302552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023522912.1|4302989_4303334_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	37.5	2.1e-16
WP_023522913.1|4303423_4303585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000924328.1|4303581_4303740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023522914.1|4303741_4303900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023522915.1|4303922_4304072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000511407.1|4304181_4304487_-	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	45.2	4.8e-12
WP_023522916.1|4304477_4305380_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_023522917.1|4305608_4306739_+|integrase	site-specific integrase	integrase	A0A0U4JNS1	Bacillus_phage	38.8	6.9e-64
4307130:4307146	attR	CTATTTCCATTTTAAAT	NA	NA	NA	NA
>prophage 11
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	4595449	4647036	6002284	terminase,plate,transposase,portal,tail,capsid,protease	Bacillus_phage(62.96%)	47	NA	NA
WP_023523017.1|4595449_4596580_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	D2XQ03	Bacillus_virus	42.7	4.0e-72
WP_023523018.1|4597475_4600874_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	51.7	4.8e-12
WP_023523019.1|4600873_4602706_-	bifunctional homocysteine S-methyltransferase/methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_000103889.1|4603294_4604407_+	cystathionine gamma-synthase/O-acetylhomoserine thiolyase	NA	A0A0B5JD48	Pandoravirus	28.2	4.4e-15
WP_023523020.1|4604403_4605567_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_000379154.1|4605731_4606244_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000894377.1|4606677_4606968_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023523021.1|4607110_4608223_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000871225.1|4608232_4608862_-	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	38.2	5.4e-34
WP_000524852.1|4609032_4609206_+	DUF2759 domain-containing protein	NA	NA	NA	NA	NA
WP_000391701.1|4609286_4610270_-	glucokinase	NA	NA	NA	NA	NA
WP_000253699.1|4610289_4610490_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_023523022.1|4610592_4611171_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_001265616.1|4611275_4611425_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_023523023.1|4611494_4613849_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	32.5	2.8e-19
WP_023523024.1|4614189_4614846_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_023523025.1|4615135_4615951_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.2	3.5e-17
WP_023523026.1|4615979_4616846_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_023523027.1|4616847_4617798_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_000871814.1|4617825_4618743_-	PstS family phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023523028.1|4619196_4621326_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_023523029.1|4621785_4622862_+	hypothetical protein	NA	A0A0S2MVF4	Bacillus_phage	40.0	2.5e-07
WP_023523030.1|4623182_4624880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043924707.1|4626152_4626416_+	hypothetical protein	NA	A0A1B0T6A3	Bacillus_phage	82.5	1.3e-18
WP_023523032.1|4626381_4627425_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	82.0	1.3e-165
WP_023523033.1|4627484_4627688_-	hypothetical protein	NA	D2XR32	Bacillus_phage	60.6	1.1e-17
WP_023523034.1|4627690_4627972_-	hypothetical protein	NA	D2XR31	Bacillus_phage	74.2	8.5e-32
WP_001113017.1|4628044_4628263_-	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	67.6	2.7e-17
WP_000389748.1|4628469_4628694_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	77.0	1.4e-21
WP_023523035.1|4629318_4630407_-|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	60.3	8.2e-123
WP_023523036.1|4630396_4632763_-|tail	phage tail protein	tail	A0A1C8E983	Bacillus_phage	89.2	0.0e+00
WP_023523037.1|4632759_4633443_-|tail	phage tail family protein	tail	A0A1C8EA72	Bacillus_phage	68.6	6.3e-89
WP_023523038.1|4633444_4636870_-	phage protein	NA	A0A0S2SXL7	Bacillus_phage	36.9	3.1e-83
WP_000180528.1|4637052_4637409_-	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	32.7	8.3e-08
WP_001143441.1|4637468_4638038_-	hypothetical protein	NA	Q858W9	Listeria_phage	42.2	6.8e-36
WP_023523039.1|4638038_4638449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523040.1|4638438_4638819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963828.1|4638796_4639162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523041.1|4639161_4639473_-	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	40.5	2.2e-12
WP_023523042.1|4639486_4640608_-|capsid	phage major capsid protein	capsid	R4IBU5	Listeria_phage	49.7	6.7e-96
WP_004410858.1|4640621_4641254_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	49.4	1.9e-34
WP_023523043.1|4641270_4642512_-|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	39.1	2.5e-75
WP_023521170.1|4642809_4644003_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.8	1.0e-25
WP_023523044.1|4644113_4645781_-|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	57.8	1.4e-182
WP_023523045.1|4645764_4646217_-|terminase	P27 family phage terminase small subunit	terminase	A0A1S7FYW6	Listeria_phage	38.8	6.6e-10
WP_000377852.1|4646394_4646703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523046.1|4646709_4647036_-	HNH endonuclease	NA	A0A1S7FZ53	Listeria_phage	47.6	3.6e-18
>prophage 12
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	4908630	4916313	6002284		Bacillus_phage(33.33%)	10	NA	NA
WP_000221100.1|4908630_4909554_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.0	6.9e-46
WP_000247669.1|4909680_4910616_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	4.9e-23
WP_000018060.1|4910617_4911310_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	6.3e-36
WP_001293585.1|4911478_4911652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|4911652_4911847_+	YwbE family protein	NA	NA	NA	NA	NA
WP_023523139.1|4911887_4913087_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	7.3e-72
WP_000587824.1|4913381_4913705_+	heme oxygenase	NA	NA	NA	NA	NA
WP_000095598.1|4913773_4914538_-	class B sortase	NA	NA	NA	NA	NA
WP_000403738.1|4914569_4915340_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.6	1.3e-13
WP_023523140.1|4915329_4916313_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.9	7.1e-17
>prophage 13
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	5283417	5376004	6002284	tRNA,head,integrase,terminase,transposase,coat,portal,tail,capsid,protease	Bacillus_phage(42.86%)	92	5277976:5277999	5378058:5378081
5277976:5277999	attL	TTTTGTCGGTAAGTCGATATATTT	NA	NA	NA	NA
WP_000287154.1|5283417_5284794_+|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	28.1	3.4e-49
WP_001140612.1|5284833_5285217_-	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_000810334.1|5285312_5286056_+	DUF3298 and DUF4163 domain-containing protein	NA	NA	NA	NA	NA
WP_001253379.1|5286106_5286700_+	biotin transporter BioY	NA	NA	NA	NA	NA
WP_000757822.1|5286745_5287633_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	54.1	1.2e-79
WP_023523269.1|5287740_5289465_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.7	1.2e-176
WP_023523270.1|5289608_5290214_+	DNA integrity scanning protein DisA nucleotide-binding domain protein	NA	NA	NA	NA	NA
WP_023523271.1|5290627_5291875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523272.1|5291890_5292313_-	divergent PAP2 family protein	NA	NA	NA	NA	NA
WP_001183889.1|5292324_5292669_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001206694.1|5292771_5293659_-	decaprenyl-phosphate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023523274.1|5294214_5295699_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.4	2.5e-58
WP_002094181.1|5295844_5296471_-	3D domain-containing protein	NA	A0A0H3UZG2	Geobacillus_virus	43.0	2.1e-14
WP_000027016.1|5296556_5296874_-	YuiB family protein	NA	NA	NA	NA	NA
WP_023523275.1|5296870_5297377_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000856602.1|5297694_5298903_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_043924718.1|5299365_5300355_+	NAD(P)/FAD-dependent oxidoreductase	NA	Q9JRK7	Streptococcus_phage	51.6	2.3e-31
WP_023523277.1|5300423_5310245_-	DUF11 domain-containing protein	NA	NA	NA	NA	NA
WP_023523278.1|5310708_5311188_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391931.1|5311406_5312654_+	MFS transporter	NA	NA	NA	NA	NA
WP_023523279.1|5312671_5313553_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000635489.1|5313633_5314095_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_023523280.1|5314420_5315497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523281.1|5315697_5316000_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.2	5.9e-15
WP_167332625.1|5316309_5317350_-	collagen-like protein	NA	NA	NA	NA	NA
WP_023523283.1|5318224_5318689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523284.1|5318700_5319204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523285.1|5319685_5320786_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JAS1	uncultured_Caudovirales_phage	85.0	1.4e-175
WP_023523286.1|5320782_5321022_-	hypothetical protein	NA	A0A2H4J378	uncultured_Caudovirales_phage	93.7	5.5e-32
WP_023523287.1|5321021_5321258_-	hemolysin XhlA family protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	85.9	4.3e-13
WP_023523289.1|5323316_5326487_-|tail	phage tail protein	tail	W8CYT7	Bacillus_phage	71.9	0.0e+00
WP_043924619.1|5326483_5327968_-|tail	phage tail family protein	tail	W8CYY9	Bacillus_phage	99.4	1.2e-294
WP_023523290.1|5327979_5331906_-|tail	phage tail tape measure protein	tail	A0A0S2GLG8	Bacillus_phage	90.4	0.0e+00
WP_023523291.1|5332126_5332444_-	hypothetical protein	NA	A0A0S2GLH2	Bacillus_phage	95.2	1.6e-50
WP_023523292.1|5332490_5333081_-|tail	phi13 family phage major tail protein	tail	W8CYT6	Bacillus_phage	97.4	2.1e-93
WP_023523293.1|5333081_5333441_-	DUF3168 domain-containing protein	NA	H0USX0	Bacillus_phage	97.5	4.2e-60
WP_023523294.1|5333437_5333872_-	HK97 gp10 family phage protein	NA	W8CZ44	Bacillus_phage	91.0	8.4e-71
WP_023523295.1|5333864_5334188_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	91.6	3.8e-52
WP_023523296.1|5334174_5334462_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	86.2	1.1e-37
WP_023523297.1|5334482_5335655_-|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	87.7	3.6e-193
WP_080672440.1|5335692_5336403_-|protease	Clp protease ClpP	protease	A0A0S2GLD5	Bacillus_phage	89.8	4.4e-117
WP_023523299.1|5336386_5337637_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	88.0	9.5e-216
WP_023523300.1|5337823_5339518_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	95.7	6.2e-311
WP_023523301.1|5339519_5340023_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	94.6	2.9e-83
WP_043924719.1|5340319_5340697_-	HNH endonuclease	NA	A0A2H4J3B4	uncultured_Caudovirales_phage	84.8	1.6e-57
WP_023523303.1|5340686_5340917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523304.1|5340923_5341142_-	hypothetical protein	NA	H0USV9	Bacillus_phage	92.8	1.3e-27
WP_023523307.1|5341481_5341721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523308.1|5341881_5342628_+|protease	zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_023523309.1|5342983_5343358_-	phage transcriptional regulator, ArpU family protein	NA	D2XQ27	Bacillus_virus	34.4	7.1e-10
WP_023523311.1|5344022_5344826_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	52.1	4.1e-71
WP_043924720.1|5344925_5345351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080672441.1|5345360_5346101_-	zinc-finger domain-containing protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	34.3	5.4e-09
WP_023523314.1|5346066_5346774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523315.1|5346773_5347205_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	51.1	3.6e-29
WP_052364205.1|5347211_5347475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523317.1|5347479_5348781_-	AAA family ATPase	NA	A0A1B1P7G6	Bacillus_phage	41.9	5.4e-89
WP_080672442.1|5348780_5349656_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023523319.1|5349691_5350489_-	recombination protein RecT	NA	S6AVW6	Thermus_phage	65.0	2.3e-90
WP_023523320.1|5350509_5351445_-	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	59.2	1.3e-100
WP_023523321.1|5351523_5351718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523322.1|5351718_5352021_-	hypothetical protein	NA	H0USU0	Bacillus_phage	65.7	8.0e-28
WP_023523323.1|5352254_5352443_-	helix-turn-helix transcriptional regulator	NA	A0A0S2GLE9	Bacillus_phage	77.4	1.2e-18
WP_023523324.1|5352467_5352785_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023523325.1|5352964_5353303_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	37.1	3.8e-10
WP_023523326.1|5353322_5353499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523327.1|5353773_5354904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523328.1|5355556_5356618_+|integrase	site-specific integrase	integrase	A0A1B2AQ00	Phage_Wrath	84.7	7.1e-172
WP_000833148.1|5356707_5357061_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	40.2	1.3e-13
WP_003272374.1|5357167_5357353_-	methyltransferase	NA	NA	NA	NA	NA
WP_023523329.1|5357756_5358527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523330.1|5359438_5360002_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000573830.1|5360107_5360461_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	42.3	8.2e-16
WP_000077392.1|5360502_5361369_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_000595026.1|5361615_5361855_-	YuzB family protein	NA	NA	NA	NA	NA
WP_000682065.1|5362207_5363278_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001054089.1|5363511_5363685_+	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_023523331.1|5363739_5364399_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	4.9e-22
WP_000679254.1|5364382_5365180_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_023523332.1|5365401_5365743_-	alkylphosphonate utilization operon protein PhnA	NA	NA	NA	NA	NA
WP_141526248.1|5366253_5367051_-	DUF2628 domain-containing protein	NA	NA	NA	NA	NA
WP_023523335.1|5367377_5368055_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_043924852.1|5368152_5368947_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_000248588.1|5368999_5369308_-	YuzD family protein	NA	NA	NA	NA	NA
WP_000431159.1|5369503_5369740_+	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	46.6	2.0e-10
WP_001125507.1|5369935_5370151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000614216.1|5370212_5371214_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665103.1|5371334_5371826_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.8	3.5e-41
WP_023523337.1|5371849_5372329_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023523338.1|5372491_5373595_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_023523339.1|5373539_5374886_+	phosphoribosyltransferase family protein	NA	NA	NA	NA	NA
WP_000241506.1|5374891_5376004_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
5378058:5378081	attR	AAATATATCGACTTACCGACAAAA	NA	NA	NA	NA
>prophage 14
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	5483780	5557767	6002284	tRNA,head,integrase,holin,terminase,transposase,portal,tail,capsid,protease	Bacillus_phage(69.05%)	74	5514661:5514681	5555471:5555491
WP_099046439.1|5483780_5484570_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000760481.1|5486027_5486372_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001115309.1|5486808_5487249_+	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_000043199.1|5487293_5488472_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023523376.1|5488667_5489927_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.4	4.0e-89
WP_001057105.1|5490296_5491214_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000573647.1|5491596_5491992_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_000455088.1|5492200_5493703_-	DUF4077 domain-containing protein	NA	NA	NA	NA	NA
WP_023523377.1|5493735_5494794_-	endonuclease/exonuclease/phosphatase	NA	NA	NA	NA	NA
WP_000639312.1|5495140_5495545_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_000568581.1|5495541_5495898_+	fluoride efflux transporter CrcB	NA	NA	NA	NA	NA
WP_023523378.1|5495967_5496207_-	DUF3947 family protein	NA	NA	NA	NA	NA
WP_078994137.1|5496286_5496538_-	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_023523380.1|5496655_5497177_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000834709.1|5497318_5497723_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001001091.1|5499164_5499722_+	cysteine hydrolase	NA	A0A1V0SL12	Klosneuvirus	28.3	2.2e-07
WP_000460485.1|5499762_5500191_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_023523381.1|5500553_5501519_+	DUF4822 domain-containing protein	NA	NA	NA	NA	NA
WP_000608841.1|5501617_5502049_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000409981.1|5502038_5502335_-	transporter suffix domain-containing protein	NA	NA	NA	NA	NA
WP_000576726.1|5502530_5504069_-	anthrolysin O/cereolysin O family cholesterol-dependent cytolysin	NA	NA	NA	NA	NA
WP_000590061.1|5504504_5505257_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_000631247.1|5505253_5506318_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_000042077.1|5506314_5507331_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	36.8	3.0e-58
WP_000749445.1|5507350_5508367_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000815803.1|5508752_5509430_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016123739.1|5509926_5510694_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001123920.1|5511501_5511969_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	63.2	5.4e-47
WP_023523382.1|5512095_5514528_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.4	3.2e-90
5514661:5514681	attL	CAACTAGATCTTACCAATCTA	NA	NA	NA	NA
WP_023523383.1|5515013_5516090_+	replication protein	NA	A0A0S2MVF4	Bacillus_phage	39.3	1.1e-10
WP_023523384.1|5516335_5517394_-	glycosyltransferase family 2 protein	NA	S5WBE2	Pseudomonas_phage	22.6	2.6e-09
WP_023523385.1|5517647_5520023_-	collagen-like triple helix repeat-containing protein	NA	NA	NA	NA	NA
WP_043924707.1|5521295_5521559_+	hypothetical protein	NA	A0A1B0T6A3	Bacillus_phage	82.5	1.3e-18
WP_023523032.1|5521524_5522568_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	82.0	1.3e-165
WP_023523386.1|5522627_5522831_-	hypothetical protein	NA	D2XR32	Bacillus_phage	63.6	4.5e-19
WP_000151299.1|5522833_5523115_-	hypothetical protein	NA	D2XR31	Bacillus_phage	76.9	1.0e-32
WP_023523388.1|5524053_5525538_-|tail	phage tail family protein	tail	W8CYY9	Bacillus_phage	94.3	3.8e-280
WP_023523389.1|5525549_5529401_-|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	87.7	0.0e+00
WP_000344051.1|5529415_5529592_-	hypothetical protein	NA	I3WTY5	Bacillus_phage	91.4	5.9e-23
WP_023523390.1|5529621_5529939_-	hypothetical protein	NA	W8CYN3	Bacillus_phage	88.6	2.1e-47
WP_023523391.1|5529987_5530590_-|tail	phi13 family phage major tail protein	tail	W8CYT6	Bacillus_phage	97.0	2.1e-96
WP_023523392.1|5530590_5530950_-	DUF3168 domain-containing protein	NA	W8CYY6	Bacillus_phage	95.0	3.6e-59
WP_023523393.1|5530946_5531384_-	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	98.6	3.0e-76
WP_023523394.1|5531376_5531700_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	90.7	6.5e-52
WP_023523395.1|5531686_5531974_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	81.9	1.3e-35
WP_023523396.1|5531994_5533167_-|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	90.5	8.6e-195
WP_023523397.1|5533204_5533915_-|protease	Clp protease ClpP	protease	H0USW5	Bacillus_phage	95.3	5.3e-123
WP_023521170.1|5534204_5535398_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.8	1.0e-25
WP_023523398.1|5535457_5536738_-|portal	phage portal protein	portal	A0A0S2GLJ4	Bacillus_phage	97.1	6.7e-233
WP_023523399.1|5536925_5538620_-|terminase	terminase large subunit	terminase	A0A0S2GLF0	Bacillus_phage	93.4	0.0e+00
WP_023523400.1|5538621_5539125_-|terminase	phage terminase small subunit P27 family	terminase	A0A0S2GLF2	Bacillus_phage	97.6	2.0e-87
WP_023523401.1|5539437_5539815_-	HNH endonuclease	NA	H0USW1	Bacillus_phage	95.2	8.4e-67
WP_023523402.1|5539804_5540059_-	hypothetical protein	NA	A0A0S2GLL6	Bacillus_phage	88.1	4.2e-38
WP_023523403.1|5540192_5540405_-	hypothetical protein	NA	A0A0S2MV92	Bacillus_phage	95.7	1.7e-29
WP_023523405.1|5541069_5541444_-	phage transcriptional regulator, ArpU family protein	NA	D2XQ27	Bacillus_virus	34.4	1.9e-10
WP_023523406.1|5541838_5542642_-	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVZ8	Staphylococcus_phage	50.2	1.9e-68
WP_157762868.1|5543743_5544010_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_080672445.1|5544019_5544739_-	zinc-finger domain-containing protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	35.2	2.3e-09
WP_023523315.1|5545411_5545843_-	DUF1064 domain-containing protein	NA	A0A2P1JTY5	Anoxybacillus_phage	51.1	3.6e-29
WP_052364205.1|5545849_5546113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523413.1|5546117_5547419_-	AAA family ATPase	NA	A0A1B1P7G6	Bacillus_phage	42.1	1.3e-90
WP_080672446.1|5547418_5548294_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023523415.1|5548329_5549127_-	recombination protein RecT	NA	S6AVW6	Thermus_phage	67.5	7.6e-94
WP_023523416.1|5549147_5550083_-	YqaJ viral recombinase family protein	NA	S6C475	Thermus_phage	59.2	8.4e-100
WP_023523418.1|5550355_5550658_-	hypothetical protein	NA	H0USU0	Bacillus_phage	68.6	2.7e-28
WP_023523419.1|5551030_5551219_-	helix-turn-helix transcriptional regulator	NA	W8CYN7	Bacillus_phage	90.3	5.7e-24
WP_023523420.1|5551297_5551501_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	59.1	4.0e-15
WP_023523421.1|5551661_5552021_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	38.5	3.3e-12
WP_043924862.1|5552536_5553697_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVK2	Bacillus_phage	59.9	1.0e-123
WP_043924722.1|5554357_5555419_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	75.9	1.9e-156
WP_000761986.1|5555480_5556221_-	carboxylesterase	NA	NA	NA	NA	NA
5555471:5555491	attR	CAACTAGATCTTACCAATCTA	NA	NA	NA	NA
WP_000557266.1|5556381_5556615_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078304.1|5556709_5557402_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|5557398_5557767_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
>prophage 15
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	5584617	5684179	6002284	head,holin,terminase,plate,transposase,portal,tail,capsid,bacteriocin,protease	Bacillus_phage(44.07%)	111	NA	NA
WP_023523437.1|5584617_5585007_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	55.5	1.5e-34
WP_006921851.1|5585024_5585147_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_023523438.1|5585315_5585510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523439.1|5585964_5586510_-	ERCC4 domain-containing protein	NA	A0A0S2SXQ1	Bacillus_phage	53.1	9.6e-48
WP_023523440.1|5586500_5586935_-	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	64.5	1.8e-52
WP_023523441.1|5586922_5587147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523442.1|5587417_5589772_-	hypothetical protein	NA	A0A1B2AQ05	Phage_Wrath	79.4	0.0e+00
WP_023523443.1|5589844_5590321_-	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	48.4	1.9e-31
WP_043924723.1|5590341_5591013_-	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	91.9	6.0e-116
WP_023521063.1|5591018_5591210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157447755.1|5591206_5591392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523445.1|5591680_5592028_-	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	88.6	3.1e-52
WP_023521170.1|5592326_5593520_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.8	1.0e-25
WP_043924724.1|5593599_5593779_-	hypothetical protein	NA	A0A1B2APZ0	Phage_Wrath	76.9	4.3e-13
WP_023523446.1|5593837_5594071_-	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	43.5	5.6e-05
WP_023523447.1|5594105_5594336_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023523448.1|5594500_5594893_+	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	58.5	2.5e-13
WP_043924725.1|5594903_5595371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000216166.1|5596951_5597158_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_001228545.1|5597251_5597737_+	YhcN/YlaJ family sporulation lipoprotein	NA	NA	NA	NA	NA
WP_000095399.1|5597766_5598243_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_000938970.1|5598243_5599260_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_000575919.1|5599256_5599607_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_000215897.1|5599618_5599825_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_000018924.1|5599845_5600715_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001049162.1|5600955_5601537_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.3e-55
WP_000250307.1|5601869_5602118_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000006566.1|5602141_5603092_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.4	1.3e-52
WP_000712187.1|5603180_5604134_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.1	2.6e-64
WP_000138459.1|5604137_5605019_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.9	4.6e-07
WP_001190080.1|5605039_5605498_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_023523450.1|5605727_5606534_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_001288078.1|5606699_5607656_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.6	1.4e-89
WP_000517723.1|5607741_5609253_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001255077.1|5609392_5609905_-	acyltransferase	NA	NA	NA	NA	NA
WP_001222403.1|5609938_5610589_-	pyrophosphatase PpaX	NA	NA	NA	NA	NA
WP_000924240.1|5610656_5611469_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_001127251.1|5611493_5612423_-	HPr(Ser) kinase/phosphatase	NA	NA	NA	NA	NA
WP_001267308.1|5612579_5612960_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_000394744.1|5613075_5613525_-	DUF4275 family protein	NA	NA	NA	NA	NA
WP_000045587.1|5613584_5616461_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
WP_000400989.1|5616466_5618443_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_023523451.1|5618595_5619027_-	DUF4362 domain-containing protein	NA	NA	NA	NA	NA
WP_000025200.1|5619071_5619692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260341.1|5619688_5620450_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000524131.1|5620550_5620778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523452.1|5620794_5621190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001150199.1|5621186_5621408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538364.1|5621457_5621655_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023523453.1|5621972_5622995_-	YeiH family putative sulfate export transporter	NA	NA	NA	NA	NA
WP_023523454.1|5623146_5624040_+	LysR family transcriptional regulator	NA	A0A2H4J8I9	uncultured_Caudovirales_phage	42.5	2.5e-08
WP_001219209.1|5624091_5624460_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023523455.1|5624464_5625004_+	flavodoxin family protein	NA	NA	NA	NA	NA
WP_023523456.1|5625012_5625372_+	macrolide efflux pump	NA	NA	NA	NA	NA
WP_023523457.1|5625472_5625784_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000944629.1|5625849_5627565_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.4	9.1e-60
WP_043924726.1|5627835_5629038_-	membrane protein	NA	NA	NA	NA	NA
WP_002094199.1|5629129_5630614_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	27.4	1.1e-21
WP_000645028.1|5630684_5631578_-	cell division ABC transporter permease FtsX	NA	NA	NA	NA	NA
WP_000594326.1|5631567_5632254_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	37.4	2.0e-26
WP_000727975.1|5632538_5632862_-	cytochrome c-551	NA	NA	NA	NA	NA
WP_096001455.1|5633301_5634400_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_000579372.1|5634544_5637052_-	preprotein translocase subunit SecA	NA	NA	NA	NA	NA
WP_000671189.1|5637325_5637868_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001990088.1|5638191_5638389_-	cold shock protein CspC	NA	Q9AZD3	Lactococcus_phage	67.7	9.8e-19
WP_023523465.1|5642248_5643082_+	winged helix-turn-helix domain-containing protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	78.3	7.9e-118
WP_080672494.1|5643173_5644670_+	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	34.1	2.8e-49
WP_098856440.1|5646728_5647424_+	geobacillin-26 family protein	NA	NA	NA	NA	NA
WP_000392440.1|5648604_5648835_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	98.7	1.7e-33
WP_023523471.1|5650756_5652097_-|plate	BppU family phage baseplate upper protein	plate	A0A1C8E978	Bacillus_phage	52.6	5.4e-116
WP_023523472.1|5652111_5654463_-|tail	phage tail protein	tail	A0A1B0T695	Bacillus_phage	96.7	0.0e+00
WP_023523473.1|5654459_5655143_-|tail	phage tail family protein	tail	A0A1C8EA72	Bacillus_phage	97.4	1.4e-125
WP_023523474.1|5655144_5658435_-|tail	phage tail tape measure protein	tail	A0A1B0T698	Bacillus_phage	82.6	3.5e-302
WP_000383689.1|5658451_5658640_-	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	100.0	1.6e-31
WP_023523475.1|5658678_5659065_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	96.1	1.5e-63
WP_001121185.1|5659076_5659733_-	hypothetical protein	NA	A0A1B1P7Q4	Bacillus_phage	88.2	1.0e-104
WP_023523476.1|5659744_5660122_-	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	87.2	5.1e-56
WP_001167235.1|5660121_5660451_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	98.2	2.6e-56
WP_000824247.1|5660440_5660770_-	hypothetical protein	NA	A0A1C8E986	Bacillus_phage	100.0	2.9e-55
WP_023523477.1|5660750_5661011_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0T690	Bacillus_phage	93.0	6.6e-39
WP_002179411.1|5661025_5661343_-	collagen-like protein	NA	NA	NA	NA	NA
WP_023523478.1|5661411_5662710_-|capsid	phage major capsid protein	capsid	A0A2H4JFZ3	uncultured_Caudovirales_phage	94.7	3.4e-208
WP_000687904.1|5662711_5663293_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J861	uncultured_Caudovirales_phage	93.8	1.5e-94
WP_023523479.1|5663255_5664467_-|portal	phage portal protein	portal	A0A1B1P7N5	Bacillus_phage	96.2	1.1e-216
WP_023523480.1|5664482_5666207_-|terminase	terminase large subunit	terminase	A0A1C8E985	Bacillus_phage	94.3	0.0e+00
WP_002179416.1|5666203_5666629_-|terminase	P27 family phage terminase small subunit	terminase	A0A1C8E969	Bacillus_phage	92.9	5.9e-69
WP_000872551.1|5666712_5667105_-	HNH endonuclease	NA	A0A1B1P7N1	Bacillus_phage	93.1	6.4e-70
WP_023523482.1|5667101_5667416_-	Rho termination factor N-terminal domain-containing protein	NA	A0A1B0T6C6	Bacillus_phage	88.5	4.7e-47
WP_167332617.1|5668278_5668428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523483.1|5669059_5669452_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	59.2	1.0e-38
WP_023523484.1|5669469_5669592_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_023523485.1|5669760_5669955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523486.1|5670459_5670999_-	ERCC4 domain-containing protein	NA	A0A0S2SXQ1	Bacillus_phage	53.7	3.9e-49
WP_043924727.1|5670995_5671436_-	hypothetical protein	NA	A0A2H4JFQ6	uncultured_Caudovirales_phage	65.7	3.9e-55
WP_023523488.1|5671741_5674117_-	hypothetical protein	NA	A0A1B2AQ05	Phage_Wrath	70.8	0.0e+00
WP_000007638.1|5674189_5674666_-	DUF669 domain-containing protein	NA	A0A1B2AQ07	Phage_Wrath	45.3	7.4e-28
WP_080672496.1|5674667_5675183_-	hypothetical protein	NA	A0A2R4P8H7	Staphylococcus_phage	48.2	9.8e-42
WP_043924729.1|5675298_5675979_-	AAA family ATPase	NA	A0A1B2AQ06	Phage_Wrath	92.7	3.3e-114
WP_023521063.1|5675984_5676176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167332609.1|5676172_5676349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523491.1|5676646_5676997_-	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	86.2	2.3e-50
WP_167332618.1|5676997_5677165_-	hypothetical protein	NA	A0A2H4J829	uncultured_Caudovirales_phage	78.2	6.8e-13
WP_023523492.1|5677171_5677405_-	hypothetical protein	NA	A0A1B1P7N2	Bacillus_phage	73.3	4.1e-24
WP_023523493.1|5677424_5677655_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JE95	uncultured_Caudovirales_phage	90.3	5.5e-29
WP_023523494.1|5677851_5678508_+	helix-turn-helix domain-containing protein	NA	A0A1B1P7L1	Bacillus_phage	89.4	2.2e-110
WP_023523495.1|5678526_5679882_+	recombinase family protein	NA	A0A2H4J992	uncultured_Caudovirales_phage	82.5	3.1e-212
WP_006917658.1|5679914_5680316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043924731.1|5680443_5681829_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.8	1.3e-11
WP_000400857.1|5681977_5682292_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000684727.1|5682464_5683307_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.8	6.1e-17
WP_023523497.1|5683543_5684179_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	40.6	4.7e-38
>prophage 16
NC_022873	Bacillus thuringiensis YBT-1518, complete sequence	6002284	5759751	5766640	6002284		Enterobacteria_phage(50.0%)	8	NA	NA
WP_023523530.1|5759751_5760744_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	39.3	1.8e-52
WP_023523531.1|5760833_5761652_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_023523532.1|5761750_5762665_-	LytR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023523533.1|5762766_5763159_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	41.5	2.2e-17
WP_023523534.1|5763293_5764325_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.3	8.1e-80
WP_023523535.1|5764326_5765181_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	38.7	2.4e-37
WP_023523536.1|5765185_5765746_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A218MN57	uncultured_virus	48.1	1.8e-41
WP_023523537.1|5765761_5766640_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	1.6e-108
>prophage 1
NC_022874	Bacillus thuringiensis YBT-1518 plasmid pBMB0229, complete sequence	45206	8322	32021	45206	plate,terminase,portal,capsid,protease,tail,transposase	Bacillus_phage(71.43%)	27	NA	NA
WP_023523046.1|8322_8649_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	50.5	2.1e-21
WP_000377852.1|8655_8964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523045.1|9141_9594_+|terminase	P27 family phage terminase small subunit	terminase	E2ELI1	Clostridium_phage	43.5	1.8e-23
WP_023523044.1|9577_11245_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	57.8	1.4e-182
WP_023521170.1|11355_12549_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	26.8	1.0e-25
WP_023523043.1|12846_14088_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	39.1	2.5e-75
WP_004410858.1|14104_14737_+|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	49.4	1.9e-34
WP_023523042.1|14750_15872_+|capsid	phage major capsid protein	capsid	R4IBU5	Listeria_phage	49.7	6.7e-96
WP_023523041.1|15885_16197_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	40.5	2.2e-12
WP_000963828.1|16196_16562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523040.1|16539_16920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523039.1|16909_17320_+	hypothetical protein	NA	Q8W600	Listeria_phage	34.8	3.2e-11
WP_001143441.1|17320_17890_+	hypothetical protein	NA	Q858W9	Listeria_phage	42.2	6.8e-36
WP_000180528.1|17949_18306_+	hypothetical protein	NA	A0A1S7FZ84	Listeria_phage	32.7	8.3e-08
WP_023524120.1|18488_21914_+	phage protein	NA	A0A0S2SXL7	Bacillus_phage	36.9	3.1e-83
WP_023523037.1|21915_22599_+|tail	phage tail family protein	tail	A0A1C8EA72	Bacillus_phage	68.6	6.3e-89
WP_023523036.1|22595_24962_+|tail	phage tail protein	tail	A0A1C8E983	Bacillus_phage	89.2	0.0e+00
WP_023523035.1|24951_26040_+|plate	BppU family phage baseplate upper protein	plate	A0A1B1P768	Bacillus_phage	60.3	8.2e-123
WP_000389748.1|26664_26889_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	77.0	1.4e-21
WP_001113017.1|27095_27314_+	hemolysin XhlA family protein	NA	A0A1B1P780	Bacillus_phage	67.6	2.7e-17
WP_023523034.1|27386_27668_+	hypothetical protein	NA	D2XR31	Bacillus_phage	74.2	8.5e-32
WP_000159479.1|27670_27877_+	hypothetical protein	NA	D2XR32	Bacillus_phage	84.8	3.5e-27
WP_000501724.1|27876_28656_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1D6X870	Bacillus_phage	43.7	4.2e-44
WP_023524122.1|28932_29118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524123.1|29145_29490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524124.1|29464_30265_-	ParA family protein	NA	NA	NA	NA	NA
WP_023524125.1|30713_32021_+	replication protein	NA	B5LPT8	Bacillus_virus	58.7	5.9e-144
>prophage 1
NC_022875	Bacillus thuringiensis YBT-1518 plasmid pBMB0230, complete sequence	49195	0	6411	49195		Bacillus_phage(80.0%)	7	NA	NA
WP_023523637.1|1111_1330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523638.1|2189_2414_+	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	50.7	7.8e-12
WP_043924922.1|2431_3049_-	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	44.7	2.1e-35
WP_023523640.1|2987_4169_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	55.8	5.4e-128
WP_000156991.1|4270_4456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523641.1|4457_4754_-	hypothetical protein	NA	H0USY0	Bacillus_phage	44.3	4.2e-13
WP_023523642.1|5310_6411_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	39.7	1.9e-63
>prophage 2
NC_022875	Bacillus thuringiensis YBT-1518 plasmid pBMB0230, complete sequence	49195	11148	11778	49195		Staphylococcus_phage(100.0%)	1	NA	NA
WP_023523647.1|11148_11778_-	helix-turn-helix domain-containing protein	NA	A0A1W6JPS3	Staphylococcus_phage	36.0	1.1e-05
>prophage 3
NC_022875	Bacillus thuringiensis YBT-1518 plasmid pBMB0230, complete sequence	49195	16390	19148	49195		Streptococcus_phage(50.0%)	2	NA	NA
WP_023523655.1|16390_16792_+	PrgI family protein	NA	E4ZFJ8	Streptococcus_phage	37.0	5.9e-10
WP_023523656.1|16733_19148_+	TrsE-like protein	NA	G3MBM1	Bacillus_virus	23.6	2.3e-08
>prophage 4
NC_022875	Bacillus thuringiensis YBT-1518 plasmid pBMB0230, complete sequence	49195	31224	31506	49195		Paenibacillus_phage(100.0%)	1	NA	NA
WP_023523669.1|31224_31506_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	67.2	4.0e-13
>prophage 5
NC_022875	Bacillus thuringiensis YBT-1518 plasmid pBMB0230, complete sequence	49195	35428	38222	49195		Bacillus_phage(66.67%)	4	NA	NA
WP_175056343.1|35428_36202_-	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	80.9	1.6e-112
WP_023523677.1|36210_36357_-	hypothetical protein	NA	A0A1C8E9B6	Bacillus_phage	66.7	2.6e-08
WP_023523678.1|36400_37096_-	DUF1282 family protein	NA	NA	NA	NA	NA
WP_023523679.1|37583_38222_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	36.1	6.5e-19
>prophage 1
NC_022876	Bacillus thuringiensis YBT-1518 plasmid pBMB0231, complete sequence	146276	0	21163	146276	transposase	Bacillus_phage(28.57%)	18	NA	NA
WP_000340569.1|647_1925_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023523695.1|2076_2268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000701946.1|2772_3885_-	Ger(x)C family spore germination protein	NA	NA	NA	NA	NA
WP_000847769.1|3887_4973_-	GerAB/ArcD/ProY family transporter	NA	NA	NA	NA	NA
WP_000151175.1|4991_6440_-	spore germination protein	NA	NA	NA	NA	NA
WP_001107533.1|6672_6885_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	58.2	6.0e-14
WP_023523697.1|8713_9793_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	38.5	1.4e-18
WP_001036869.1|10417_11209_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002180773.1|11302_11932_-	class D sortase	NA	NA	NA	NA	NA
WP_001009788.1|11936_12644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000684117.1|12771_14094_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.9	1.5e-89
WP_001171822.1|14172_15330_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L470	Tupanvirus	35.3	1.6e-31
WP_000820821.1|15362_15986_-	acetyltransferase	NA	NA	NA	NA	NA
WP_142307213.1|15982_16606_-	sugar transferase	NA	NA	NA	NA	NA
WP_001023051.1|16602_17814_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001227670.1|17874_19005_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	61.7	1.3e-131
WP_000699475.1|19010_20117_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0P0YMY1	Yellowstone_lake_phycodnavirus	26.1	3.7e-06
WP_000475911.1|20113_21163_-	polysaccharide biosynthesis protein	NA	M4QPK0	Synechococcus_phage	29.8	2.8e-11
>prophage 2
NC_022876	Bacillus thuringiensis YBT-1518 plasmid pBMB0231, complete sequence	146276	25580	27401	146276		Catovirus(100.0%)	1	NA	NA
WP_000221321.1|25580_27401_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.3	2.2e-27
>prophage 3
NC_022876	Bacillus thuringiensis YBT-1518 plasmid pBMB0231, complete sequence	146276	46313	107579	146276	transposase	Bacillus_phage(33.33%)	54	NA	NA
WP_085962062.1|46313_47103_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000085120.1|47242_47539_+	hypothetical protein	NA	H0USY0	Bacillus_phage	44.3	1.9e-13
WP_023523707.1|47540_47726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000492092.1|47827_49009_+	cell division protein FtsK	NA	H0USY1	Bacillus_phage	55.3	3.9e-126
WP_043924932.1|48947_49565_+	replication-relaxation family protein	NA	Q2LIA9	Bacillus_phage	44.7	1.5e-33
WP_001145764.1|49569_49794_-	hypothetical protein	NA	A0A0A7AR43	Bacillus_phage	50.0	5.9e-12
WP_002180785.1|55073_55361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118152.1|55494_57306_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	36.0	3.4e-41
WP_000291038.1|57926_58112_+	YqbF domain-containing protein	NA	NA	NA	NA	NA
WP_043924940.1|58789_59077_-	adhesin	NA	NA	NA	NA	NA
WP_000173394.1|59715_60297_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_023523713.1|60329_62084_+	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	28.5	2.6e-38
WP_002180787.1|62322_62544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000360819.1|63193_64288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836692.1|66084_66324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023520903.1|67221_68091_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000654556.1|68367_69558_-	C1 family peptidase	NA	A0A2K9L9R4	Tupanvirus	25.9	9.6e-16
WP_002180792.1|69756_70416_+	recombinase family protein	NA	A0A1B0VBM1	Salmonella_phage	32.1	1.6e-12
WP_000217104.1|70728_71424_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	4.3e-24
WP_000267188.1|71420_72233_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000865197.1|72315_72816_-	nitrous oxide reductase accessory protein NosL	NA	NA	NA	NA	NA
WP_000725500.1|72812_74093_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_000509207.1|74463_74604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523714.1|74737_75136_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	65.9	8.3e-49
WP_023523715.1|75147_76269_+	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.4	8.3e-78
WP_000750747.1|76479_76746_+	AbrB family transcriptional regulator	NA	A0A2I7SC16	Paenibacillus_phage	42.9	5.8e-06
WP_023523716.1|76865_77648_-	RNA polymerase sigma factor SigB	NA	A0A0Y0ATF9	Bacillus_phage	30.4	4.8e-16
WP_023521124.1|77613_78102_-	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_023521125.1|78109_78430_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_000022437.1|78620_79763_+	fused response regulator/phosphatase	NA	NA	NA	NA	NA
WP_023523717.1|79935_82644_-	response regulator	NA	A0A1V0SGX0	Hokovirus	29.3	5.3e-38
WP_001249914.1|82835_83348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000402411.1|83761_84148_+	general stress protein	NA	NA	NA	NA	NA
WP_000167282.1|84229_84436_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000522907.1|84509_84761_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_023523718.1|84819_85230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523719.1|85267_86284_+	ParM/StbA family protein	NA	A0A0S2MVG2	Bacillus_phage	43.3	6.3e-77
WP_023523720.1|86582_87263_-	TrkA C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023523721.1|87392_88343_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_023523722.1|88439_89747_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_023523723.1|90115_90553_+	DUF3290 family protein	NA	NA	NA	NA	NA
WP_023523724.1|90571_91261_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_023523725.1|91694_92045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523726.1|92268_93924_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_052364211.1|97066_97579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043924941.1|98167_98869_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_023523731.1|99145_99532_+	UDP-N-acetylglucosamine 2-epimerase	NA	NA	NA	NA	NA
WP_023523363.1|99646_101059_-|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_023523732.1|101122_101887_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	NA	NA	NA	NA
WP_023523733.1|102253_103051_+	FkbM family methyltransferase	NA	A0A291AUV0	Sinorhizobium_phage	25.7	6.9e-10
WP_023523734.1|103432_103783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523735.1|103967_104366_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	65.9	4.9e-49
WP_023523736.1|104377_105490_+	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.4	4.4e-79
WP_000070739.1|106667_107579_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 4
NC_022876	Bacillus thuringiensis YBT-1518 plasmid pBMB0231, complete sequence	146276	118789	119767	146276		Catovirus(100.0%)	1	NA	NA
WP_001023155.1|118789_119767_-	SPFH/Band 7/PHB domain protein	NA	A0A1V0SB59	Catovirus	31.8	2.1e-16
>prophage 5
NC_022876	Bacillus thuringiensis YBT-1518 plasmid pBMB0231, complete sequence	146276	123956	132180	146276	transposase	Acinetobacter_phage(25.0%)	6	NA	NA
WP_004410060.1|123956_124208_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	54.3	3.1e-17
WP_000843033.1|124790_125072_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	67.2	4.0e-13
WP_023523748.1|126065_126686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523749.1|126920_127256_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_001065234.1|128032_128644_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	32.0	6.4e-16
WP_023523753.1|130965_132180_-	peptidase S8	NA	A0A1B0T6A2	Bacillus_phage	47.2	2.3e-89
>prophage 6
NC_022876	Bacillus thuringiensis YBT-1518 plasmid pBMB0231, complete sequence	146276	135983	136595	146276		Paenibacillus_phage(100.0%)	1	NA	NA
WP_000770552.1|135983_136595_-	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	48.4	2.0e-30
>prophage 7
NC_022876	Bacillus thuringiensis YBT-1518 plasmid pBMB0231, complete sequence	146276	142784	145607	146276	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_001043043.1|142784_143063_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	62.2	6.7e-21
WP_000448508.1|143115_143349_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000648299.1|143300_143651_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A1B1P791	Bacillus_phage	31.9	2.7e-11
WP_023523736.1|144084_145197_-	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.4	4.4e-79
WP_023523758.1|145208_145607_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	65.2	2.4e-48
>prophage 1
NC_022877	Bacillus thuringiensis YBT-1518 plasmid pBMB0232, complete sequence	171593	292	82927	171593	integrase,transposase	Bacillus_phage(42.86%)	54	41200:41216	89491:89507
WP_099046446.1|292_1082_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080672502.1|2435_2615_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_023523828.1|4344_4749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523829.1|4763_5594_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	40.4	1.5e-39
WP_023523833.1|9298_9532_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_023523834.1|9595_9871_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	60.7	4.6e-22
WP_043924963.1|10013_10304_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023523837.1|11050_11968_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_023523839.1|13345_13555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523840.1|13932_14559_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	37.6	9.4e-23
WP_023520903.1|15074_15944_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_023523841.1|16069_16432_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023523843.1|17523_18327_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_043924945.1|18409_19465_-	phosphodiester glycosidase family protein	NA	NA	NA	NA	NA
WP_023523845.1|20979_22161_-	replication initiation protein	NA	E5FFJ0	Burkholderia_phage	25.0	3.5e-10
WP_023523846.1|22272_23712_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080672503.1|24765_25074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142307149.1|25132_25483_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043924947.1|25922_26297_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_023523849.1|26648_26903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523850.1|27608_28718_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023523857.1|32476_32695_+	hypothetical protein	NA	H0USV5	Bacillus_phage	63.5	5.8e-20
WP_023523859.1|35045_35321_+	hypothetical protein	NA	H0USV6	Bacillus_phage	54.9	2.3e-18
WP_023523860.1|35662_36016_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0P0I4A4	Acinetobacter_phage	46.2	4.4e-17
WP_023523861.1|38190_38526_+	hypothetical protein	NA	A0A0A7AR67	Bacillus_phage	36.9	5.8e-11
WP_043924949.1|38922_40368_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_099046434.1|40782_41572_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
41200:41216	attL	GCCTTTTTCATCAGCTA	NA	NA	NA	NA
WP_157762874.1|42807_43005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523865.1|43479_43740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523866.1|44846_45068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043924967.1|45952_46240_-	adhesin	NA	NA	NA	NA	NA
WP_023523868.1|46880_47462_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_023523869.1|47489_49166_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.8	1.8e-31
WP_023523873.1|52051_52645_-	camelysin	NA	NA	NA	NA	NA
WP_023523874.1|52966_53221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099046447.1|55258_56048_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_023523877.1|57929_58388_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_023523878.1|59098_60118_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023523881.1|61621_61990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023520903.1|62343_63213_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_023523882.1|63635_64547_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	32.6	4.3e-08
WP_023523883.1|64528_65638_-	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_099046435.1|66946_67735_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_023523885.1|67732_68077_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_023523887.1|69047_70055_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023523888.1|70457_71633_+|integrase	site-specific integrase	integrase	A0A142F1N9	Bacillus_phage	24.4	4.0e-06
WP_023523889.1|73956_74400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523890.1|75106_75313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052364212.1|75946_76258_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	55.6	1.6e-18
WP_023523893.1|78005_78425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523894.1|78452_79619_-	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_099046439.1|79933_80722_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_023523895.1|80962_81583_+	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	58.7	4.9e-48
WP_023523896.1|81994_82927_-|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	45.8	5.1e-73
89491:89507	attR	TAGCTGATGAAAAAGGC	NA	NA	NA	NA
>prophage 1
NC_022882	Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence	240661	237	64637	240661	transposase,integrase	Bacillus_phage(35.71%)	57	17517:17571	45709:45763
WP_023523974.1|237_1125_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_023523975.1|1302_1989_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	59.8	2.1e-71
WP_080672514.1|2606_3050_-	replication-relaxation family protein	NA	H0USY2	Bacillus_phage	45.9	3.5e-24
WP_023523978.1|2988_3261_-	hypothetical protein	NA	H0USY1	Bacillus_phage	50.0	2.5e-12
WP_175056344.1|3630_3828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523981.1|4018_5077_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_167332627.1|6838_8416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099046450.1|8724_9514_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_000410775.1|9912_10116_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.6	1.5e-17
WP_142322468.1|11164_11284_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_023523987.1|11577_11799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523988.1|12036_12213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000157958.1|12209_12449_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_023523989.1|12438_12675_-	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	36.7	4.2e-08
WP_023523990.1|12750_12978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523991.1|13170_13320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523992.1|13380_13710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523993.1|14012_15761_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	26.4	1.6e-40
WP_023523994.1|15788_16364_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_023523995.1|16996_17473_+	hypothetical protein	NA	NA	NA	NA	NA
17517:17571	attL	TTTAACGAATTTCCCGAAAGAATTCTCCTTCCTCAAGCGTGTGAAGGGCGTAGCC	NA	NA	NA	NA
WP_023520903.1|18976_19846_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_023523998.1|20246_20951_-	endonuclease	NA	NA	NA	NA	NA
WP_023523999.1|21006_21546_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_023524001.1|22817_24671_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_043924996.1|24687_25449_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.5	1.1e-33
WP_023524003.1|25803_26868_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	27.7	4.7e-22
WP_023524004.1|26864_27551_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.1	5.3e-43
WP_099046451.1|27997_28787_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_023524007.1|29444_30035_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023524010.1|31784_32753_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_023524011.1|32801_33011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524012.1|33360_33600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524013.1|34625_35234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524014.1|35367_35979_-	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	49.2	7.0e-31
WP_004409736.1|36520_37030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000744474.1|37946_39230_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_023524015.1|39281_40484_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_000616859.1|40667_41762_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_001097548.1|41937_43050_+	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_023524017.1|44078_45191_-	helix-turn-helix domain-containing protein	NA	A0A288TXV8	Enterococcus_phage	47.1	3.3e-79
WP_000762754.1|45202_45601_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	68.2	6.8e-51
WP_099046452.1|46023_46813_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
45709:45763	attR	GGCTACGCCCTTCACACGCTTGAGGAAGGAGAATTCTTTCGGGAAATTCGTTAAA	NA	NA	NA	NA
WP_023524020.1|48045_48213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157412330.1|48216_48342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080672498.1|48326_48890_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_023523578.1|49519_49735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001065234.1|51160_51772_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	32.0	6.4e-16
WP_023523749.1|52548_52884_+	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_023524022.1|53118_53739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023524023.1|54124_54736_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023524024.1|56228_56591_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023524026.1|57695_57956_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_157762876.1|58044_58221_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_023520826.1|58654_59929_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	2.7e-32
WP_023524027.1|60440_61451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524028.1|63020_63308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099046435.1|63848_64637_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_022882	Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence	240661	72648	156881	240661	transposase,holin	Bacillus_phage(28.57%)	57	NA	NA
WP_142307242.1|72648_72822_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_099046449.1|74320_75110_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_023523959.1|75536_76748_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	35.9	4.3e-64
WP_023523958.1|76966_77815_-	ADP-ribosyltransferase	NA	Q331X8	Clostridium_botulinum_C_phage	33.3	1.2e-17
WP_099046434.1|79993_80782_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_023523954.1|82779_83004_-	hypothetical protein	NA	A0A0S2GLK0	Bacillus_phage	70.3	8.0e-25
WP_043924954.1|83695_84565_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_023523945.1|91577_91898_+	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_023520826.1|92856_94131_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	2.7e-32
WP_023523943.1|96282_96507_+	hemolysin XhlA family protein	NA	H0USX6	Bacillus_phage	78.9	1.1e-21
WP_023523942.1|96587_96941_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	67.5	1.2e-35
WP_023523940.1|97480_97627_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A2P1JUJ2	Bacillus_phage	55.3	3.1e-09
WP_023523939.1|98617_98848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523938.1|98973_99843_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_157762875.1|99993_100152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523936.1|100978_102169_-	C1 family peptidase	NA	A0A2K9L9R4	Tupanvirus	26.0	1.2e-15
WP_099046435.1|102488_103278_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_023523935.1|103768_104767_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_023523934.1|104729_105827_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_023523933.1|108054_108795_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_023523932.1|108814_110929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023523931.1|110961_111930_+	SDR family NAD(P)-dependent oxidoreductase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	28.6	4.0e-20
WP_023523930.1|111945_113022_+	CDP-glucose 4,6-dehydratase	NA	J7Q7J8	Aeropyrum_coil-shaped_virus	37.3	4.4e-12
WP_023523929.1|113182_113989_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_023523928.1|115375_115777_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	68.2	1.9e-48
WP_023523927.1|116183_116396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523925.1|117080_118310_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	47.5	4.4e-80
WP_023523922.1|119233_119818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523921.1|119842_120970_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2D0ZM66	Rhodococcus_phage	39.8	1.1e-16
WP_023520826.1|121233_122508_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	2.7e-32
WP_023524036.1|125955_126465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080672513.1|126523_127537_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	34.7	2.0e-38
WP_023523916.1|127620_129447_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	27.0	2.5e-31
WP_023523914.1|131745_132297_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000281809.1|132324_132576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523913.1|132585_133563_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_023524037.1|133576_133831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524038.1|134059_134902_-	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_023523909.1|134907_135843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523908.1|135969_137859_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.8	7.0e-29
WP_000517898.1|140522_140762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523906.1|140821_141004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023523905.1|141064_141601_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023523904.1|141633_141819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524039.1|141853_144118_-	Cys-Gln thioester bond-forming surface protein	NA	NA	NA	NA	NA
WP_023524040.1|144299_144533_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023524041.1|144650_144995_+	helix-turn-helix domain-containing protein	NA	A0A0A7RUJ5	Clostridium_phage	41.7	6.6e-10
WP_000728845.1|145008_145164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524042.1|145435_146560_-	helix-turn-helix transcriptional regulator	NA	D2XQ10	Bacillus_virus	34.1	2.1e-52
WP_023524043.1|147088_148093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023524046.1|150476_151637_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_023524047.1|151636_152020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023524048.1|152128_152686_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023524049.1|152704_153175_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000466107.1|153554_153776_+	helix-turn-helix transcriptional regulator	NA	A0A0S2GLH4	Bacillus_phage	50.7	3.8e-11
WP_043924984.1|153804_154458_-	replication-relaxation family protein	NA	A0A1B1P7T2	Bacillus_phage	63.9	7.0e-77
WP_023524052.1|155375_156881_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NC_022882	Bacillus thuringiensis YBT-1518 plasmid pBMB0233, complete sequence	240661	167103	237614	240661	transposase,protease	Bacillus_phage(33.33%)	51	NA	NA
WP_085962062.1|167103_167893_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_023524062.1|168404_168803_+|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	65.2	5.4e-48
WP_085962062.1|170022_170811_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157762877.1|171267_171858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023524060.1|171994_173350_+	DUF393 domain-containing protein	NA	NA	NA	NA	NA
WP_023524059.1|173647_174070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425127.1|175781_176117_-	DUF4257 domain-containing protein	NA	NA	NA	NA	NA
WP_023520826.1|177522_178797_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	2.7e-32
WP_023524063.1|179060_180173_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2D0ZM66	Rhodococcus_phage	41.0	9.5e-18
WP_023524068.1|182324_183908_-	amidase	NA	NA	NA	NA	NA
WP_023524062.1|186486_186885_-|transposase	IS200/IS605 family transposase	transposase	A0A286QN76	Streptococcus_phage	65.2	5.4e-48
WP_000862390.1|187239_187797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080672520.1|187834_188302_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_023524071.1|189923_190631_-|transposase	IS6 family transposase	transposase	A0A1X9I6E7	Streptococcus_phage	42.5	9.0e-38
WP_023524072.1|190789_191215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043924989.1|191443_194164_-	collagenase	NA	NA	NA	NA	NA
WP_157762878.1|195247_196447_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023524077.1|196785_197079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_142322459.1|197264_197525_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_001256731.1|197909_198101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524078.1|198951_199140_-	DUF2187 family protein	NA	NA	NA	NA	NA
WP_000991919.1|199388_199706_+	hypothetical protein	NA	A0A2H4JAV2	uncultured_Caudovirales_phage	43.0	4.3e-16
WP_052364214.1|199943_200387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099046454.1|201001_202051_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	38.5	1.8e-18
WP_023524081.1|202086_202488_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	68.9	3.8e-49
WP_023524082.1|202801_203245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000872573.1|203774_205373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023520826.1|208030_209305_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	32.2	2.7e-32
WP_023524087.1|209935_211006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023524089.1|212587_213769_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_023524090.1|213867_215085_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_023524091.1|215119_216193_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_023524092.1|216189_217143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023524093.1|217165_218425_-	S-adenosylmethionine synthetase	NA	NA	NA	NA	NA
WP_023524094.1|218408_219434_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_023524095.1|219750_220617_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_023524096.1|220613_221480_+	TIM barrel protein	NA	NA	NA	NA	NA
WP_023524097.1|221469_222273_+	coenzyme F420-0:L-glutamate ligase	NA	NA	NA	NA	NA
WP_023524098.1|222394_223717_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.4	5.0e-90
WP_023524099.1|223785_224331_+	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	42.1	6.7e-33
WP_023524100.1|224597_226382_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.7	2.8e-51
WP_097984874.1|226374_228087_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	25.6	2.3e-18
WP_023524102.1|229174_229993_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_000540299.1|230454_231141_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	60.3	4.1e-72
WP_023524103.1|231629_231926_+	hypothetical protein	NA	H0USY0	Bacillus_phage	45.1	1.2e-12
WP_000152452.1|231927_232113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023524104.1|232213_233395_+	cell division protein FtsK	NA	A0A288WGQ0	Bacillus_phage	54.0	7.0e-120
WP_043924990.1|233333_233951_+	replication-relaxation family protein	NA	Q2LIA9	Bacillus_phage	48.1	6.4e-40
WP_023524106.1|234029_234257_-	helix-turn-helix transcriptional regulator	NA	A0A0S2MVM0	Bacillus_phage	50.0	1.1e-13
WP_023524107.1|234614_235619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099046453.1|236824_237614_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
