The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009974	Pseudomonas putida S12, complete genome	5798534	105	8190	5798534	transposase,protease	Acidithiobacillus_phage(33.33%)	9	NA	NA
WP_019437637.1|105_861_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	54.8	1.9e-73
WP_019437638.1|878_2393_-|transposase	IS21-like element ISPpu7 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.9	1.5e-146
WP_026031923.1|2806_3235_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	42.4	3.1e-17
WP_019438254.1|3304_3529_+	hypothetical protein	NA	A0A2H4JDJ8	uncultured_Caudovirales_phage	66.0	1.2e-09
WP_019438253.1|3833_4853_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	26.4	4.1e-23
WP_010954748.1|5050_5761_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_003251077.1|5817_6135_+	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014590426.1|6318_7386_+	phosphotransferase family protein	NA	NA	NA	NA	NA
WP_003251082.1|7422_8190_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	5.0e-18
>prophage 2
NZ_CP009974	Pseudomonas putida S12, complete genome	5798534	53181	65395	5798534	tRNA	uncultured_Caudovirales_phage(66.67%)	12	NA	NA
WP_019438229.1|53181_54507_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	36.1	2.2e-05
WP_014590387.1|55253_55718_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_014590385.1|56872_57544_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	91.5	9.6e-106
WP_019438226.1|57707_59087_+	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	51.1	1.3e-27
WP_019438225.1|59182_59575_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	79.8	1.1e-53
WP_014590382.1|59576_59936_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	66.7	3.9e-37
WP_014590381.1|59935_60232_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	58.6	5.8e-23
WP_010954804.1|60228_60564_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	7.5e-43
WP_019438224.1|60560_61562_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	80.5	8.0e-157
WP_019438223.1|61656_62616_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_019438222.1|62722_64114_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_019438221.1|64114_65395_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	54.1	3.5e-96
>prophage 3
NZ_CP009974	Pseudomonas putida S12, complete genome	5798534	988589	996368	5798534		Planktothrix_phage(16.67%)	10	NA	NA
WP_010952150.1|988589_989399_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.5	5.9e-25
WP_014589829.1|989647_990622_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	33.4	1.9e-38
WP_014589828.1|990634_991159_+	HAD family hydrolase	NA	A0A140XBD6	Dickeya_phage	48.1	5.3e-27
WP_019438078.1|991167_991740_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_003255131.1|991726_992251_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_003255132.1|992251_992977_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.5	8.4e-23
WP_026031904.1|993152_994646_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_003255135.1|994725_995034_+	ribosome hibernation promoting factor	NA	A0A0M7QH33	Escherichia_phage	34.1	4.4e-05
WP_003255137.1|995046_995511_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_010952145.1|995513_996368_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	32.8	8.1e-09
>prophage 4
NZ_CP009974	Pseudomonas putida S12, complete genome	5798534	1742843	1782453	5798534	integrase,transposase,holin	Bacillus_virus(50.0%)	35	1772972:1772995	1788283:1788306
WP_014589378.1|1742843_1743788_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003255710.1|1743911_1744796_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_014589377.1|1744962_1745928_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_014589376.1|1745938_1746409_+	4-hydroxybenzoyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_019436920.1|1746453_1748100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014589374.1|1748488_1748746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011953240.1|1748867_1749974_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_019439081.1|1750467_1751844_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_014589371.1|1752296_1753244_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_003255725.1|1753328_1754174_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_010951660.1|1754170_1755349_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.7	5.0e-25
WP_014589370.1|1755523_1756294_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_003255731.1|1756304_1757042_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_003255734.1|1757069_1757330_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_014589369.1|1757330_1757969_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_003255736.1|1757969_1758563_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_019439080.1|1758752_1760414_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_019439079.1|1760682_1762935_+	AsmA family protein	NA	NA	NA	NA	NA
WP_010951654.1|1762931_1763999_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_019439078.1|1763995_1764268_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_019439077.1|1764622_1764850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014589364.1|1765089_1765533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003255745.1|1765771_1767157_-	GABA permease	NA	NA	NA	NA	NA
WP_019439075.1|1767788_1768562_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.0	8.4e-21
WP_019439074.1|1768573_1769326_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003255749.1|1769380_1770073_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_019439073.1|1770072_1770762_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_019439072.1|1770873_1772079_+	methyltransferase	NA	NA	NA	NA	NA
WP_019439071.1|1772359_1772635_-	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
1772972:1772995	attL	TGTAGGAGCGGGTTCACCCGCGAA	NA	NA	NA	NA
WP_014589359.1|1773154_1773403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019439070.1|1773739_1775059_+	DUF4102 domain-containing protein	NA	A0A0R6PGM3	Moraxella_phage	33.0	5.4e-44
WP_019437433.1|1775986_1776967_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_019437435.1|1777383_1778562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019437436.1|1778551_1780318_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_019437364.1|1780896_1782453_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	35.7	1.4e-83
1788283:1788306	attR	TTCGCGGGTGAACCCGCTCCTACA	NA	NA	NA	NA
>prophage 5
NZ_CP009974	Pseudomonas putida S12, complete genome	5798534	2707914	2789528	5798534	integrase,transposase,protease,tRNA	Acidithiobacillus_phage(30.0%)	60	2725216:2725236	2792725:2792745
WP_019437573.1|2707914_2708886_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003249532.1|2708980_2709241_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012274456.1|2709253_2710555_+	GTPase HflX	NA	NA	NA	NA	NA
WP_014592593.1|2710651_2711833_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_014592592.1|2711832_2712702_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_010955481.1|2713003_2714191_+	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_003249542.1|2714247_2715540_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	37.1	9.2e-73
WP_019437574.1|2715878_2717813_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	27.0	2.3e-19
WP_019437575.1|2717987_2718455_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_003249548.1|2718537_2720103_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_019437576.1|2720102_2721116_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_003249552.1|2721890_2724464_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.2	7.2e-69
WP_019437577.1|2724460_2725207_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
2725216:2725236	attL	CTGTTCCGGCCTCTTCGCGGG	NA	NA	NA	NA
WP_003249557.1|2725496_2725922_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_003249563.1|2725950_2726181_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_003249565.1|2726214_2727078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003249568.1|2727098_2727545_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_010955472.1|2727658_2729056_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	59.3	7.2e-148
WP_014592586.1|2729728_2732029_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	95.4	1.8e-135
WP_019438728.1|2732165_2732753_-	TIGR00730 family Rossman fold protein	NA	A0A2I2L3F0	Orpheovirus	26.6	3.1e-07
WP_003249580.1|2733101_2733551_+	azurin	NA	NA	NA	NA	NA
WP_019438730.1|2734271_2735927_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.1	8.4e-95
WP_019438731.1|2735983_2737120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039612251.1|2737787_2739146_+	benzoate 1,2-dioxygenase large subunit	NA	NA	NA	NA	NA
WP_019438733.1|2739142_2739628_+	benzoate 1,2-dioxygenase small subunit	NA	NA	NA	NA	NA
WP_019438734.1|2739683_2740694_+	ring-hydroxylating dioxygenase ferredoxin reductase family protein	NA	A0A0E3F6W9	Synechococcus_phage	40.7	2.3e-10
WP_026031956.1|2740809_2741571_+	1,6-dihydroxycyclohexa-2,4-diene-1-carboxylate dehydrogenase	NA	NA	NA	NA	NA
WP_019438736.1|2741714_2742641_+	catechol 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_019438737.1|2742725_2743634_-	transporter	NA	NA	NA	NA	NA
WP_019438738.1|2743916_2744894_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019438739.1|2745133_2746261_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_039612252.1|2746325_2747192_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019437638.1|2747319_2748834_+|transposase	IS21-like element ISPpu7 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.9	1.5e-146
WP_019437637.1|2748851_2749607_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	54.8	1.9e-73
WP_019438741.1|2749961_2751302_+	aromatic acid/H+ symport family MFS transporter	NA	NA	NA	NA	NA
WP_019438742.1|2751469_2752717_+	OprD family porin	NA	NA	NA	NA	NA
WP_050548036.1|2752785_2753745_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019438744.1|2753779_2754859_-	mandelate racemase	NA	Q6A202	Oenococcus_phage	24.0	1.3e-14
WP_019438745.1|2754855_2756037_-	mandelate dehydrogenase	NA	NA	NA	NA	NA
WP_019437637.1|2756456_2757212_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	54.8	1.9e-73
WP_019437638.1|2757229_2758744_-|transposase	IS21-like element ISPpu7 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.9	1.5e-146
WP_023389519.1|2760386_2761088_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019438750.1|2762780_2764091_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_100219690.1|2764681_2765380_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	4.4e-13
WP_019436633.1|2765575_2766013_-	transcriptional regulator	NA	A0A2H4J450	uncultured_Caudovirales_phage	27.9	6.2e-05
WP_019436634.1|2766199_2766925_+	hypothetical protein	NA	K4K650	Caulobacter_phage	40.3	1.3e-36
WP_019437637.1|2767476_2768232_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	54.8	1.9e-73
WP_019437638.1|2768249_2769764_-|transposase	IS21-like element ISPpu7 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.9	1.5e-146
WP_019436635.1|2770199_2771474_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	41.2	1.6e-64
WP_019436636.1|2771603_2774999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019436637.1|2775423_2775615_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_100219689.1|2775845_2776922_-	taurine catabolism dioxygenase TauD	NA	NA	NA	NA	NA
WP_023389525.1|2777040_2778042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026031804.1|2778044_2781350_+	AAA family ATPase	NA	A0A1V0SET7	Hokovirus	38.4	8.6e-06
WP_019436641.1|2781399_2781981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019436644.1|2782715_2783552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019436645.1|2783992_2784319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019436646.1|2784433_2784955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019436647.1|2784951_2787084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019436648.1|2787083_2789528_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
2792725:2792745	attR	CTGTTCCGGCCTCTTCGCGGG	NA	NA	NA	NA
>prophage 6
NZ_CP009974	Pseudomonas putida S12, complete genome	5798534	3482779	3492590	5798534	transposase	uncultured_Mediterranean_phage(28.57%)	8	NA	NA
WP_010952690.1|3482779_3483529_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.6	7.5e-67
WP_026031805.1|3483525_3484203_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.0	6.8e-43
WP_019436655.1|3484440_3485298_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I3PV79	Clostridium_phage	36.2	1.9e-13
WP_019436654.1|3485406_3486414_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	35.8	5.0e-34
WP_019437638.1|3486975_3488490_+|transposase	IS21-like element ISPpu7 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.9	1.5e-146
WP_019437637.1|3488507_3489263_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	54.8	1.9e-73
WP_003252355.1|3489552_3489876_-	Ferredoxin 1	NA	NA	NA	NA	NA
WP_010952693.1|3490016_3492590_-	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	23.3	9.9e-26
>prophage 7
NZ_CP009974	Pseudomonas putida S12, complete genome	5798534	4205822	4268468	5798534	coat,protease	Bacillus_virus(10.0%)	57	NA	NA
WP_003250242.1|4205822_4207106_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.3	3.7e-138
WP_014591679.1|4207269_4209666_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	6.7e-218
WP_003250246.1|4209818_4210091_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	62.9	1.7e-21
WP_019438678.1|4210272_4212144_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_026031953.1|4212260_4213301_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003250254.1|4213478_4213757_+	lipoprotein	NA	NA	NA	NA	NA
WP_019438676.1|4213771_4214551_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_014591675.1|4214627_4215425_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_014591674.1|4215466_4215835_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_019438675.1|4215910_4217389_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	5.0e-30
WP_019438674.1|4217487_4218312_-	preprotein translocase subunit TatD	NA	NA	NA	NA	NA
WP_019438673.1|4218469_4219876_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_010953281.1|4219988_4220426_+	DoxX family protein	NA	NA	NA	NA	NA
WP_014591670.1|4220674_4220983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010953283.1|4220994_4221483_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_019438672.1|4221546_4224054_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_010953285.1|4224050_4224737_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.4	3.1e-35
WP_014591667.1|4224747_4225353_+	arylesterase	NA	NA	NA	NA	NA
WP_014591666.1|4225411_4225702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019438671.1|4225815_4226793_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_003250288.1|4226926_4227178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014591664.1|4227686_4227968_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_014591663.1|4228037_4229114_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	50.8	2.2e-83
WP_019438670.1|4229346_4230294_+	putative 2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_003250295.1|4230418_4230916_+	universal stress protein	NA	NA	NA	NA	NA
WP_010953293.1|4231044_4232019_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_003250299.1|4232135_4232870_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_014591661.1|4232949_4234290_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	33.0	9.6e-49
WP_010953295.1|4234498_4235479_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_014591660.1|4235478_4237014_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_010953297.1|4237019_4237556_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_014591659.1|4237862_4238579_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014591658.1|4238575_4239466_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_003250313.1|4239526_4240654_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_019437326.1|4240816_4243405_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_014591656.1|4243556_4244747_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_019437437.1|4244918_4246403_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_019437438.1|4246578_4249188_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_019437439.1|4249557_4250076_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_003250327.1|4250086_4250443_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_019437440.1|4250496_4251576_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_010953306.1|4251795_4252104_+	peptidase	NA	NA	NA	NA	NA
WP_003250344.1|4252103_4252418_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_014591651.1|4252418_4253087_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_019437441.1|4253083_4254403_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_014591649.1|4254722_4255877_+	HPP family protein	NA	NA	NA	NA	NA
WP_010953310.1|4255850_4256717_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019437442.1|4256897_4258787_+	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	29.7	9.7e-55
WP_014591647.1|4259017_4260088_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_012271609.1|4260220_4260463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014591646.1|4260922_4263310_-	response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	28.8	6.4e-11
WP_003250360.1|4263323_4263785_-	response regulator	NA	NA	NA	NA	NA
WP_014591645.1|4263800_4266047_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	23.8	3.8e-21
WP_019437443.1|4266314_4266842_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_019437444.1|4266872_4267409_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_014591643.1|4267427_4267961_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_014591642.1|4267964_4268468_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 8
NZ_CP009974	Pseudomonas putida S12, complete genome	5798534	5445843	5455855	5798534		uncultured_Caudovirales_phage(44.44%)	13	NA	NA
WP_019436670.1|5445843_5446335_+	DUF1543 domain-containing protein	NA	A0A2I2L4Z6	Orpheovirus	34.3	1.3e-22
WP_014591338.1|5446412_5447183_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q56AQ6	Bacillus_thuringiensis_phage	40.7	2.8e-40
WP_003254014.1|5447279_5447972_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_026031806.1|5448064_5448604_+	type 1 glutamine amidotransferase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	36.6	1.1e-19
WP_010953640.1|5448660_5449185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019436672.1|5449379_5450237_+	glucose 1-dehydrogenase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	50.9	5.7e-71
WP_019436674.1|5450467_5450767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010953634.1|5450952_5451300_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	61.1	8.6e-34
WP_014591345.1|5451321_5452605_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	75.4	1.3e-175
WP_014591346.1|5452633_5453104_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	68.6	1.3e-56
WP_010953631.1|5453117_5453819_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	79.4	1.1e-104
WP_019436675.1|5453831_5455196_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014591349.1|5455192_5455855_-	response regulator	NA	W8CYM9	Bacillus_phage	36.7	2.1e-28
>prophage 9
NZ_CP009974	Pseudomonas putida S12, complete genome	5798534	5513858	5587855	5798534	plate,transposase,protease	Bacillus_phage(37.5%)	55	NA	NA
WP_110159681.1|5513858_5515213_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	5.0e-77
WP_019439089.1|5515354_5515954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019439088.1|5515953_5516652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014591396.1|5516746_5517565_-	phosphate ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_014591397.1|5517582_5518476_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_004574212.1|5518472_5519441_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_003254123.1|5519511_5520543_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.1	5.0e-53
WP_014591399.1|5520760_5520994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019439087.1|5521065_5521491_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_014591401.1|5521487_5521802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019439086.1|5521908_5522727_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_014591402.1|5522716_5523502_-	hydratase	NA	NA	NA	NA	NA
WP_014591403.1|5523640_5524984_-	MFS transporter	NA	NA	NA	NA	NA
WP_014591404.1|5525028_5526171_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_019439085.1|5526313_5527255_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019439084.1|5527545_5528421_+	universal stress protein	NA	NA	NA	NA	NA
WP_019439083.1|5528480_5529335_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019439082.1|5529486_5530041_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_014591408.1|5530334_5531561_+	MFS transporter	NA	NA	NA	NA	NA
WP_110159681.1|5531691_5533045_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	54.4	5.0e-77
WP_014591409.1|5533100_5533478_-	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_014591410.1|5533499_5536214_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	23.3	1.1e-35
WP_004574224.1|5536955_5538581_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.1	8.1e-50
WP_019436845.1|5538721_5539612_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_019436846.1|5539934_5541431_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_019436847.1|5541431_5543198_+	NAD(P)H dependent flavin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_019436848.1|5543311_5543770_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023389546.1|5543816_5544989_-	PAS domain-containing sensor histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	36.9	5.9e-26
WP_019436850.1|5545273_5553934_+	cyclic beta 1-2 glucan synthetase	NA	NA	NA	NA	NA
WP_014591418.1|5554005_5554722_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_012052056.1|5554803_5555316_-	transporter	NA	NA	NA	NA	NA
WP_012052055.1|5555328_5555913_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_033724638.1|5555909_5557067_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_014591421.1|5557088_5558210_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7SAX5	Vibrio_phage	29.9	4.6e-28
WP_019436852.1|5558265_5559309_-	aliphatic amidase	NA	NA	NA	NA	NA
WP_014591422.1|5559494_5560361_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_019436854.1|5560698_5564217_-	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_019436855.1|5564204_5565320_-	cellulase	NA	NA	NA	NA	NA
WP_080590197.1|5565319_5567608_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_019436857.1|5567604_5570214_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_019436858.1|5570210_5570918_-	cellulose synthase operon protein YhjQ	NA	NA	NA	NA	NA
WP_014591429.1|5570914_5571133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019436859.1|5571129_5572743_-	cellulose biosynthesis protein BcsG	NA	NA	NA	NA	NA
WP_010953551.1|5572735_5572921_-	cellulose biosynthesis protein BcsF	NA	NA	NA	NA	NA
WP_019436860.1|5572917_5574408_-	peptidase	NA	NA	NA	NA	NA
WP_019436861.1|5574556_5574712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019436862.1|5574710_5576564_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.0	7.6e-36
WP_019436863.1|5576641_5580262_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_014591434.1|5580258_5581722_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_080557843.1|5581709_5582270_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_014591436.1|5582686_5583190_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_019436866.1|5583207_5584698_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_010953542.1|5584694_5585105_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_019436868.1|5585108_5586875_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_019436869.1|5586838_5587855_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 1
NZ_CP009975	Pseudomonas putida S12 plasmid pTTS12, complete sequence	583900	13258	67747	583900	transposase,integrase	uncultured_Caudovirales_phage(17.65%)	46	15033:15047	55352:55366
WP_019436561.1|13258_14416_+|integrase	site-specific integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	24.4	4.3e-05
WP_023389346.1|14426_16034_+	hypothetical protein	NA	NA	NA	NA	NA
15033:15047	attL	GCGATGGCTGTATTG	NA	NA	NA	NA
WP_033724593.1|16789_17872_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_033724594.1|17897_18281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019436566.1|18371_19334_-	SdiA-regulated domain-containing protein	NA	NA	NA	NA	NA
WP_019436567.1|19380_19734_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_019436568.1|19739_20591_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	64.0	2.3e-96
WP_019436569.1|20605_22093_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	87.9	4.3e-239
WP_100219738.1|22695_23700_+	DUF4113 domain-containing protein	NA	A0A1W6JNT0	Morganella_phage	45.5	7.2e-73
WP_019438696.1|24028_24406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019438697.1|24430_27367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019438698.1|27907_30496_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_019438699.1|30574_31420_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_019438700.1|31446_31743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019438701.1|31774_32302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100219739.1|32545_33559_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_019438704.1|33699_34083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019438705.1|34280_34706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019438706.1|34707_35004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019438707.1|35010_36591_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_019438708.1|36731_38000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_100219737.1|38848_39580_-	TonB C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_019438711.1|39698_40481_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	32.8	1.5e-22
WP_019438712.1|40563_41166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019438714.1|41465_42413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019438715.1|42568_43849_-	site-specific DNA-methyltransferase	NA	NA	NA	NA	NA
WP_010794461.1|43974_44331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085983697.1|44564_44834_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019438716.1|44802_45927_+|integrase	site-specific integrase	integrase	A0A1S6L1B6	Ralstonia_phage	41.3	1.3e-46
WP_080771117.1|47730_48681_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_019437953.1|48838_49273_-	GTP diphosphokinase	NA	A0A141E1X8	Streptococcus_phage	46.7	2.2e-26
WP_019437954.1|49347_49692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019437955.1|49862_50285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019437956.1|50339_50975_-	SOS response-associated peptidase	NA	A0A218MNF5	uncultured_virus	39.5	3.4e-28
WP_019437958.1|51301_52615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019437959.1|52774_53656_-	prohibitin family protein	NA	A0A1S6UA41	Serratia_phage	53.7	2.1e-52
WP_019437298.1|53899_54655_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	54.4	3.5e-72
WP_019437297.1|54675_56190_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.7	4.0e-144
55352:55366	attR	GCGATGGCTGTATTG	NA	NA	NA	NA
WP_011078030.1|56622_57873_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	46.5	2.2e-47
WP_011078029.1|58040_59699_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	36.4	5.6e-22
WP_011600734.1|60040_60601_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	98.4	1.6e-58
WP_040117735.1|60604_63571_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	97.3	0.0e+00
WP_019437774.1|63673_64036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019437775.1|64032_64953_-	hypothetical protein	NA	A0A2I7R6K1	Vibrio_phage	44.3	4.6e-34
WP_019437777.1|65373_66408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019437778.1|66541_67747_+	hypothetical protein	NA	J9Q6K3	Salmonella_phage	38.7	2.6e-08
>prophage 2
NZ_CP009975	Pseudomonas putida S12 plasmid pTTS12, complete sequence	583900	101197	108642	583900	protease	Acinetobacter_phage(33.33%)	9	NA	NA
WP_010792502.1|101197_101776_-	TerD family protein	NA	A0A2L1IWC0	Streptomyces_phage	31.0	5.7e-06
WP_010792503.1|101804_102839_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.2	3.1e-71
WP_010792504.1|102850_103300_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	30.2	1.3e-10
WP_019437801.1|103347_104529_-	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_019437802.1|104525_105119_-	TerD family protein	NA	A0A2I7QY07	Vibrio_phage	36.8	3.1e-23
WP_019437803.1|105121_105850_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_019437804.1|105849_106797_-	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_019437805.1|106796_107891_-|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.0	5.7e-39
WP_019437806.1|107883_108642_-	Trehalose-6-phosphatase	NA	A0A172Q0Q4	Acinetobacter_phage	26.8	1.9e-09
>prophage 3
NZ_CP009975	Pseudomonas putida S12 plasmid pTTS12, complete sequence	583900	287540	325509	583900	transposase,integrase	Enterobacteria_phage(16.67%)	37	289518:289550	305771:305803
WP_019437638.1|287540_289055_-|transposase	IS21-like element ISPpu7 family transposase	transposase	K4I413	Acidithiobacillus_phage	52.9	1.5e-146
WP_155295801.1|289182_289542_+	hypothetical protein	NA	NA	NA	NA	NA
289518:289550	attL	GCAATGGAACCAAAAACCAACGTAAGCCCTACC	NA	NA	NA	NA
WP_003150544.1|289545_290475_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.9	1.9e-40
WP_003089107.1|290676_290916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003150546.1|290915_291326_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_003299771.1|291329_294323_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
WP_003089113.1|294335_294548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003150552.1|294555_294831_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_023383589.1|295358_297017_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.9	6.4e-26
WP_003465068.1|297365_299045_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	M4T586	Rhodobacter_phage	25.4	2.6e-06
WP_003465065.1|299047_299956_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_003465063.1|299952_301170_+	TniQ family protein	NA	NA	NA	NA	NA
WP_000904941.1|301230_301845_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.3	6.6e-37
WP_001087809.1|301897_302134_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003465059.1|302130_302496_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000136268.1|302512_304159_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_000654684.1|304155_304401_-	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000735441.1|304403_304679_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294667.1|304694_305045_-	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000429838.1|305116_305551_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_023383590.1|305827_306388_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	96.0	8.9e-57
305771:305803	attR	GCAATGGAACCAAAAACCAACGTAAGCCCTACC	NA	NA	NA	NA
WP_019437225.1|306391_309358_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	97.3	0.0e+00
WP_080590209.1|309334_310195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080590210.1|310364_312143_+	carboxylesterase family protein	NA	A0A0G2Y6W1	Acanthamoeba_polyphaga_mimivirus	35.9	6.8e-26
WP_019437692.1|312465_313446_-|transposase	IS5-like element ISPpu21 family transposase	transposase	A0A077K814	Ralstonia_phage	59.2	7.7e-96
WP_155295802.1|313461_314403_+	EDD domain protein	NA	NA	NA	NA	NA
WP_019436593.1|314566_314953_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_019436594.1|315077_315917_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019436595.1|316105_318160_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_019436596.1|318218_319865_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_019436597.1|319861_320170_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_019436598.1|320321_321395_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	V5UTY8	Synechococcus_phage	43.6	9.9e-12
WP_019436599.1|321419_321953_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_019436600.1|321939_322701_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_019436601.1|322711_322993_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_019436602.1|323016_324009_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_019436603.1|324492_325509_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
