The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022738	Pseudomonas sp. VLB120, complete sequence	5644569	1866512	1928795	5644569	protease,coat	Bacillus_virus(10.0%)	57	NA	NA
WP_023379635.1|1866512_1867796_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.3	3.7e-138
WP_023379636.1|1867948_1870345_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.3	3.0e-218
WP_011533117.1|1870496_1870769_+	DNA-binding protein HU-beta	NA	A3E2K9	Sodalis_phage	62.9	2.2e-21
WP_023379637.1|1870953_1872825_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023379638.1|1872934_1873975_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_023379639.1|1874141_1874420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027906795.1|1874446_1875205_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_023379642.1|1875291_1876089_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_023379643.1|1876126_1876495_-	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_023379644.1|1876570_1878049_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_023379645.1|1878137_1878935_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_023379646.1|1879094_1880501_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_023379647.1|1880613_1881051_+	DoxX family protein	NA	NA	NA	NA	NA
WP_023379649.1|1881254_1881563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379651.1|1881641_1882118_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_023379653.1|1882168_1884676_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_023379655.1|1884675_1885359_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.7e-07
WP_023379656.1|1885369_1885975_+	arylesterase	NA	NA	NA	NA	NA
WP_023379658.1|1886033_1886315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379660.1|1886421_1887399_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_003259780.1|1887536_1887788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379662.1|1888294_1888576_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_023379664.1|1888640_1889717_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A2I6UFP9	Klebsiella_phage	50.8	4.8e-83
WP_023379666.1|1889953_1890901_+	putative 2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_023379668.1|1891005_1891503_+	universal stress protein	NA	NA	NA	NA	NA
WP_023379669.1|1891632_1892607_+	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_177325263.1|1892661_1893441_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_023379673.1|1893527_1894871_-	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	34.1	2.2e-48
WP_023379675.1|1895055_1896036_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_023379676.1|1896035_1897571_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_027907724.1|1897576_1898113_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_023379680.1|1898406_1899123_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023379682.1|1899119_1900010_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_023379683.1|1900111_1901239_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_023379685.1|1901324_1903913_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_023379687.1|1903988_1905179_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_023379689.1|1905247_1906732_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_023379691.1|1906875_1909485_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_023379692.1|1909889_1910369_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_015269720.1|1910472_1910829_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_023379694.1|1910883_1911963_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_023379696.1|1912162_1912471_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_023379697.1|1912470_1912785_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_023379699.1|1912785_1913454_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023379700.1|1913450_1914782_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_023379701.1|1914994_1916140_+	HPP family protein	NA	NA	NA	NA	NA
WP_023379702.1|1916113_1916980_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023379703.1|1917160_1919050_+	propionyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	30.1	1.5e-55
WP_023379704.1|1919227_1920307_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_023379705.1|1920489_1920915_+	DUF1810 domain-containing protein	NA	A0A2H4UVK5	Bodo_saltans_virus	37.4	3.0e-12
WP_023379706.1|1921244_1923632_-	hybrid sensor histidine kinase/response regulator	NA	Q8QNA2	Ectocarpus_siliculosus_virus	25.5	2.1e-09
WP_023379707.1|1923645_1924107_-	response regulator	NA	NA	NA	NA	NA
WP_023379708.1|1924120_1926367_-	GAF domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	23.9	1.9e-28
WP_023379709.1|1926646_1927174_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023379710.1|1927202_1927739_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023379711.1|1927757_1928288_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_023379712.1|1928291_1928795_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 2
NC_022738	Pseudomonas sp. VLB120, complete sequence	5644569	2018015	2123637	5644569	terminase,capsid,head,holin,tRNA,portal,protease,integrase,tail,transposase	Pseudomonas_phage(45.22%)	162	2025449:2025491	2127133:2127175
WP_023379797.1|2018015_2019938_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.9	2.0e-124
WP_013972005.1|2019937_2020489_+	translation initiation factor IF-3	NA	A0A2I7S9Q1	Vibrio_phage	38.6	3.2e-14
WP_003250667.1|2020549_2020744_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_003250671.1|2020772_2021129_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_023379798.1|2021240_2022257_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_023379799.1|2022288_2024670_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003250679.1|2024674_2024977_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.0e-11
WP_011533210.1|2024957_2025314_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
2025449:2025491	attL	GGGTGCAAGGGGGCGAGTGTTCGAATCACTCCGTCCCGACCAA	NA	NA	NA	NA
WP_023379800.1|2025573_2026755_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	70.6	1.5e-162
WP_023379802.1|2027058_2027235_-	hypothetical protein	NA	A0A2H4J7S3	uncultured_Caudovirales_phage	84.5	1.7e-22
WP_023379803.1|2027249_2027987_-	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	84.0	1.4e-121
WP_023379804.1|2028011_2028329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379805.1|2028385_2028793_-	hypothetical protein	NA	A0A218M341	Acidovorax_phage	55.8	1.2e-05
WP_023379806.1|2028839_2029193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379807.1|2029189_2029522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379808.1|2029509_2029920_-	DUF2591 domain-containing protein	NA	A0A1B0VMD7	Pseudomonas_phage	39.1	9.6e-16
WP_023379809.1|2029916_2030429_-	hypothetical protein	NA	A0A1B0VM38	Pseudomonas_phage	52.3	4.1e-08
WP_023379810.1|2030425_2030677_-	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	97.6	6.8e-41
WP_023379811.1|2030673_2031468_-	hypothetical protein	NA	Q5QF32	Pseudomonas_virus	54.2	1.4e-71
WP_023379812.1|2031517_2031670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379814.1|2032051_2032300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158491096.1|2032381_2032555_-	hypothetical protein	NA	Q9MC73	Pseudomonas_phage	59.2	2.2e-06
WP_023379815.1|2032551_2033025_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	57.8	2.4e-47
WP_023379816.1|2033021_2033360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379817.1|2033379_2033763_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JA92	uncultured_Caudovirales_phage	61.0	7.5e-23
WP_023379818.1|2033919_2034123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379819.1|2034119_2034557_-	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	63.6	1.2e-45
WP_041925618.1|2034909_2035653_-	helix-turn-helix transcriptional regulator	NA	A0A059VA53	Pseudomonas_phage	66.5	9.0e-81
WP_023379821.1|2035740_2035950_+	helix-turn-helix domain-containing protein	NA	H2BD64	Pseudomonas_phage	68.6	1.8e-15
WP_148299909.1|2036005_2036245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084212809.1|2036274_2037066_+	replication protein	NA	W6MYB0	Pseudomonas_phage	58.0	5.7e-41
WP_023379824.1|2037058_2038441_+	replicative DNA helicase	NA	H2BD70	Pseudomonas_phage	50.7	6.7e-122
WP_023379825.1|2038437_2038647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379826.1|2038628_2038925_+	DUF1364 domain-containing protein	NA	Q8HAF2	Salmonella_phage	67.0	1.8e-32
WP_158491097.1|2038921_2039092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379827.1|2039088_2039517_+	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	67.9	1.0e-44
WP_023379828.1|2039513_2040815_+|integrase	site-specific integrase	integrase	A0A2D1GND4	Pseudomonas_phage	73.0	4.1e-177
WP_023379829.1|2040811_2041147_+	hypothetical protein	NA	A0A2D1GNG3	Pseudomonas_phage	42.6	3.5e-16
WP_023379830.1|2041157_2041844_+	hypothetical protein	NA	A0A1B0VMF2	Pseudomonas_phage	66.7	1.5e-85
WP_023379831.1|2042004_2042514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379832.1|2042544_2042868_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	52.5	5.2e-25
WP_023379833.1|2042871_2043090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379834.1|2043150_2043330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041925459.1|2043320_2043692_+	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	63.4	3.7e-19
WP_023379836.1|2043776_2044262_+|terminase	phage terminase small subunit P27 family	terminase	A0A2D1GNP3	Pseudomonas_phage	79.9	5.2e-69
WP_023379837.1|2044261_2045986_+|terminase	terminase large subunit	terminase	A0A2D1GNU5	Pseudomonas_phage	84.4	5.6e-291
WP_023379838.1|2045985_2047386_+|portal	phage portal protein	portal	A0A0U4IJ43	Pseudomonas_phage	84.3	4.6e-227
WP_023379839.1|2047399_2048275_+|protease	Clp protease ClpP	protease	A0A0U4B0J0	Pseudomonas_phage	73.5	1.5e-114
WP_023379840.1|2048289_2049504_+|capsid	phage major capsid protein	capsid	A0A0U4JIW8	Pseudomonas_phage	83.8	7.6e-186
WP_023379841.1|2049548_2049926_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	63.8	2.1e-09
WP_023379842.1|2049929_2050406_+|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	39.0	7.7e-17
WP_023379843.1|2050405_2050747_+|head	phage head closure protein	head	B5WZS5	Pseudomonas_phage	51.3	2.0e-22
WP_023379844.1|2050739_2051234_+	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	77.2	6.7e-64
WP_041925460.1|2051230_2051599_+	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	59.8	3.0e-37
WP_023379846.1|2051732_2051978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379847.1|2052168_2052894_+	hypothetical protein	NA	H2BDC0	Pseudomonas_virus	46.4	7.0e-46
WP_023379848.1|2052902_2053370_+|tail	phage tail assembly chaperone family protein, TAC	tail	Q9MCA4	Pseudomonas_phage	65.6	1.9e-36
WP_084212810.1|2053345_2053591_+	hypothetical protein	NA	A0A0U4J8S9	Pseudomonas_phage	49.4	2.0e-13
WP_041925619.1|2053681_2054011_+	superinfection immunity protein	NA	A0A0A7HBY6	Escherichia_phage	48.3	2.0e-08
WP_023379851.1|2054064_2056620_+|tail	phage tail tape measure protein	tail	A0A2H4PI09	Pseudomonas_phage	58.3	2.4e-221
WP_023379852.1|2056619_2056967_+|tail	phage tail protein	tail	A0A2D1GNJ1	Pseudomonas_phage	56.1	3.4e-30
WP_023379853.1|2057004_2057706_+|tail	phage minor tail protein L	tail	A0A2D1GNF3	Pseudomonas_phage	77.4	1.1e-104
WP_023379854.1|2057708_2058491_+	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	75.0	1.2e-123
WP_023379855.1|2058487_2059072_+|tail	tail assembly protein	tail	A0A2D1GNM2	Pseudomonas_phage	67.9	4.0e-68
WP_023379856.1|2059127_2062655_+|tail	phage tail protein	tail	A0A2D1GNE3	Pseudomonas_phage	61.3	0.0e+00
WP_148299910.1|2062651_2063695_+	hypothetical protein	NA	A0A2H4JA10	uncultured_Caudovirales_phage	60.4	2.9e-117
WP_023379858.1|2063715_2064498_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	49.2	1.1e-55
WP_084212896.1|2064695_2065091_+|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	66.7	2.8e-36
WP_023379860.1|2065147_2065594_+	hypothetical protein	NA	A0A2R3UAM8	Myoviridae_environmental_samples	56.6	3.8e-34
WP_023379861.1|2065590_2066106_+	DUF2514 domain-containing protein	NA	A0A2H4J3Q6	uncultured_Caudovirales_phage	78.7	5.7e-42
WP_023379862.1|2066102_2066309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379863.1|2066422_2066731_+	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	72.2	2.4e-35
WP_023379864.1|2066720_2066927_+	hypothetical protein	NA	A0A2H4J7A7	uncultured_Caudovirales_phage	43.8	1.7e-05
WP_023379865.1|2067224_2068403_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	69.8	9.1e-160
WP_023379866.1|2068697_2068874_-	hypothetical protein	NA	A0A2H4J7S3	uncultured_Caudovirales_phage	82.8	5.0e-22
WP_023379867.1|2068888_2069626_-	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	82.4	2.3e-121
WP_023379804.1|2069650_2069968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379805.1|2070024_2070432_-	hypothetical protein	NA	A0A218M341	Acidovorax_phage	55.8	1.2e-05
WP_023379806.1|2070478_2070832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379868.1|2070828_2071260_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_023379869.1|2071304_2071577_-	hypothetical protein	NA	A0A2H4J399	uncultured_Caudovirales_phage	68.1	9.7e-25
WP_023379870.1|2071579_2072017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379812.1|2072046_2072199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041925462.1|2072741_2072975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041925463.1|2072955_2073666_-	HNH endonuclease	NA	A0A1S5SDS7	Streptococcus_phage	28.6	5.2e-17
WP_023379872.1|2073734_2074160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379873.1|2074326_2074569_-	hypothetical protein	NA	A0A2H4J0R5	uncultured_Caudovirales_phage	90.0	9.5e-32
WP_023379874.1|2074543_2074891_-	hypothetical protein	NA	A0A2H4J0L9	uncultured_Caudovirales_phage	83.5	1.7e-45
WP_158491098.1|2074932_2075496_-	HNH endonuclease	NA	A0A0G2Y7F9	Acanthamoeba_polyphaga_mimivirus	38.9	1.1e-22
WP_023379876.1|2075659_2076172_-	hypothetical protein	NA	A0A2H4J7C8	uncultured_Caudovirales_phage	33.7	4.0e-11
WP_023379877.1|2076179_2076743_-	siphovirus Gp157 family protein	NA	A0A2H4IZG3	uncultured_Caudovirales_phage	94.7	7.8e-93
WP_023379878.1|2076739_2077471_-	hypothetical protein	NA	A0A2H4J2D5	uncultured_Caudovirales_phage	86.0	9.4e-115
WP_023379880.1|2077768_2077990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379882.1|2077986_2078202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379883.1|2078198_2078732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379884.1|2078728_2078923_-	hypothetical protein	NA	A0A1B0VMB8	Pseudomonas_phage	58.1	1.4e-12
WP_023379885.1|2078919_2079342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379886.1|2079620_2079875_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_023379887.1|2079871_2080084_-	hypothetical protein	NA	A0A1B0VMC0	Pseudomonas_phage	44.9	3.8e-08
WP_023379888.1|2080521_2081064_-	hypothetical protein	NA	J7HXB1	Pseudomonas_phage	59.4	2.6e-53
WP_023379889.1|2081779_2082097_+	DUF1654 domain-containing protein	NA	A0A2D1GND3	Pseudomonas_phage	55.2	4.3e-24
WP_148299912.1|2082145_2082652_-	hypothetical protein	NA	A0A1B0VMC8	Pseudomonas_phage	65.4	7.6e-47
WP_023379891.1|2082883_2083462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379892.1|2083451_2083700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379893.1|2083732_2083966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379894.1|2083968_2084850_-	helix-turn-helix domain-containing protein	NA	H2BD63	Pseudomonas_phage	41.3	5.9e-47
WP_041925625.1|2084955_2085150_+	Cro/Cl family transcriptional regulator	NA	A0A2H4J1L8	uncultured_Caudovirales_phage	50.0	1.3e-07
WP_023379896.1|2085180_2085393_+	hypothetical protein	NA	A0A2H4J3U0	uncultured_Caudovirales_phage	100.0	6.4e-32
WP_023379897.1|2085411_2085624_+	hypothetical protein	NA	A0A2H4IZI7	uncultured_Caudovirales_phage	97.0	1.9e-28
WP_041925465.1|2085722_2086466_+	phage antirepressor KilAC domain-containing protein	NA	A0A059VF66	Pseudomonas_phage	80.4	1.8e-100
WP_023379899.1|2086465_2087272_+	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	91.0	2.7e-147
WP_023379900.1|2087261_2088068_+	ATP-binding protein	NA	A0A2H4J3E5	uncultured_Caudovirales_phage	97.4	2.4e-143
WP_012273057.1|2088067_2088439_+	DUF2493 domain-containing protein	NA	A0A2H4J0K9	uncultured_Caudovirales_phage	99.2	1.1e-63
WP_023379901.1|2088435_2088627_+	hypothetical protein	NA	A0A2H4IZH6	uncultured_Caudovirales_phage	98.4	5.6e-27
WP_023379902.1|2088856_2089129_+	hypothetical protein	NA	A0A2H4JG78	uncultured_Caudovirales_phage	58.5	6.8e-18
WP_023379903.1|2089125_2089425_+	hypothetical protein	NA	A0A2H4J8S0	uncultured_Caudovirales_phage	100.0	7.4e-50
WP_023379904.1|2089417_2089816_+	recombination protein NinB	NA	A0A059VG13	Pseudomonas_phage	84.1	3.8e-62
WP_023379905.1|2089815_2090418_+	recombination protein NinG	NA	L7TH85	Pseudomonas_virus	56.9	3.1e-55
WP_023379906.1|2090533_2091223_+	hypothetical protein	NA	Q9MC44	Pseudomonas_phage	45.8	3.6e-47
WP_023379907.1|2091212_2091647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379909.1|2091707_2091971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046854952.1|2091981_2092371_+	hypothetical protein	NA	A0A2H4J7X6	uncultured_Caudovirales_phage	43.8	3.2e-21
WP_023379912.1|2092367_2092670_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_023379913.1|2092713_2093100_-	hypothetical protein	NA	A0A0S2SYH9	Pseudomonas_phage	86.7	5.4e-53
WP_023379914.1|2093152_2093350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041925467.1|2093423_2094032_+	hypothetical protein	NA	A0A0S2SYA5	Pseudomonas_phage	82.7	2.8e-96
WP_023379917.1|2094062_2094539_+	DUF2280 domain-containing protein	NA	A0A1B0VMH2	Pseudomonas_phage	82.9	3.5e-70
WP_023379919.1|2094513_2095833_+|terminase	phage terminase	terminase	A0A0S2SYF1	Pseudomonas_phage	93.8	1.4e-249
WP_023379921.1|2097240_2098317_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	52.6	5.7e-100
WP_013972415.1|2098470_2099217_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	77.2	3.5e-93
WP_013972416.1|2099226_2100195_+	hypothetical protein	NA	A0A0H5ARK0	Pseudomonas_phage	79.8	1.4e-142
WP_023379923.1|2100236_2100533_+	hypothetical protein	NA	A0A0H5BBX8	Pseudomonas_phage	53.3	1.0e-06
WP_023379924.1|2100532_2100901_+	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	53.5	5.4e-26
WP_023379926.1|2100902_2101289_+	hypothetical protein	NA	A0A2H4IZB5	uncultured_Caudovirales_phage	63.8	6.8e-40
WP_023379928.1|2101291_2101963_+	hypothetical protein	NA	A0A2H4J0Q3	uncultured_Caudovirales_phage	53.6	2.3e-59
WP_023379929.1|2101959_2102388_+	hypothetical protein	NA	A0A2H4J5P1	uncultured_Caudovirales_phage	93.5	6.6e-68
WP_023379931.1|2102427_2103087_+|tail	phage tail protein	tail	A0A0S2SYG8	Pseudomonas_phage	72.4	4.1e-85
WP_023379933.1|2103096_2103480_+|tail	phage tail assembly chaperone	tail	A0A2H4IYQ5	uncultured_Caudovirales_phage	57.5	6.3e-38
WP_049818804.1|2103542_2103794_+	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	77.8	5.1e-28
WP_023379936.1|2103797_2107199_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	53.2	2.7e-204
WP_023379938.1|2107198_2107537_+|tail	phage tail protein	tail	A0A2H4JI07	uncultured_Caudovirales_phage	72.3	4.0e-44
WP_023379939.1|2107546_2108296_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	77.1	1.1e-121
WP_023379940.1|2108298_2109054_+	C40 family peptidase	NA	A0A2H4J1J7	uncultured_Caudovirales_phage	78.5	6.7e-124
WP_023379941.1|2109078_2109282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379942.1|2109278_2109491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148299913.1|2109767_2110157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379944.1|2110271_2110862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379945.1|2111162_2111591_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_023379946.1|2111719_2112139_+	hypothetical protein	NA	J9Q806	Salmonella_phage	42.5	2.3e-25
WP_023379947.1|2112181_2112766_+|tail	tail assembly protein	tail	A0A2H4J1H0	uncultured_Caudovirales_phage	76.8	8.1e-77
WP_023379948.1|2112821_2116289_+	DUF1983 domain-containing protein	NA	A0A2H4J8Z6	uncultured_Caudovirales_phage	55.0	0.0e+00
WP_023379949.1|2116285_2116600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379950.1|2116600_2117476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023379951.1|2117491_2118274_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	47.7	9.9e-54
WP_084212899.1|2118471_2118867_+|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	67.4	3.6e-36
WP_023379953.1|2118924_2119371_+	hypothetical protein	NA	A0A2R3UAM8	Myoviridae_environmental_samples	57.9	1.2e-35
WP_023379954.1|2119367_2119865_+	DUF2514 domain-containing protein	NA	A0A2H4J3Q6	uncultured_Caudovirales_phage	78.8	1.0e-43
WP_041925629.1|2119878_2120103_+	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	79.7	6.5e-27
WP_023379863.1|2120182_2120491_+	hypothetical protein	NA	A0A2H4JER5	uncultured_Caudovirales_phage	72.2	2.4e-35
WP_023379956.1|2120480_2120687_+	hypothetical protein	NA	A0A2H4J7A7	uncultured_Caudovirales_phage	43.8	1.7e-05
WP_023379379.1|2121344_2122145_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.5	2.9e-32
WP_167332798.1|2122137_2123637_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
2127133:2127175	attR	GGGTGCAAGGGGGCGAGTGTTCGAATCACTCCGTCCCGACCAA	NA	NA	NA	NA
>prophage 3
NC_022738	Pseudomonas sp. VLB120, complete sequence	5644569	3265495	3274982	5644569	tRNA	uncultured_Caudovirales_phage(71.43%)	12	NA	NA
WP_023381076.1|3265495_3266782_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	22.8	2.5e-09
WP_023381077.1|3266847_3267555_-	response regulator	NA	NA	NA	NA	NA
WP_023381078.1|3267721_3268504_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_023381079.1|3268496_3268745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023381080.1|3268828_3269221_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	78.3	3.5e-52
WP_023381081.1|3269222_3269582_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	65.0	2.5e-36
WP_023381082.1|3269581_3269878_+	sulfurtransferase complex subunit TusB	NA	A0A2H4JG28	uncultured_Caudovirales_phage	64.6	3.0e-27
WP_023381083.1|3269874_3270210_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	75.7	4.4e-43
WP_023381084.1|3270206_3271223_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	78.9	1.1e-153
WP_023381085.1|3271317_3272277_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_023381086.1|3272309_3273701_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_023381087.1|3273701_3274982_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.3	4.2e-94
>prophage 4
NC_022738	Pseudomonas sp. VLB120, complete sequence	5644569	4109877	4161752	5644569	head,capsid,terminase,protease,portal,integrase,tail	Pseudomonas_phage(53.66%)	65	4121315:4121374	4161858:4161924
WP_023381809.1|4109877_4111440_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_023381810.1|4111886_4113725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041925533.1|4113969_4114884_+	replication initiation protein	NA	NA	NA	NA	NA
WP_041925534.1|4116056_4116437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084212857.1|4116669_4118376_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	A0A1D8KUN9	Synechococcus_phage	36.3	9.8e-14
WP_148299925.1|4118440_4119112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148299926.1|4119505_4119859_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_148299927.1|4120540_4120897_-	hypothetical protein	NA	NA	NA	NA	NA
4121315:4121374	attL	AATATGGCGGAGAGATAGGGATTTGAACCCTAGGTACTGTTGCCAGTACAACGGATTTCG	NA	NA	NA	NA
WP_158239721.1|4121724_4121877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023381813.1|4122010_4122364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023381814.1|4122515_4122740_-	hypothetical protein	NA	A0A2H4JG60	uncultured_Caudovirales_phage	86.5	2.7e-28
WP_023381815.1|4122782_4123316_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_023381816.1|4123312_4123759_-	hypothetical protein	NA	A0A2R3UAM8	Myoviridae_environmental_samples	57.8	3.0e-39
WP_084212918.1|4123822_4124218_-|tail	tail fiber assembly protein	tail	A0A2H4J9Z7	uncultured_Caudovirales_phage	61.8	6.1e-36
WP_023381818.1|4124415_4125204_-	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	48.9	1.8e-50
WP_023381819.1|4125219_4126095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023381820.1|4126095_4126410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023381821.1|4126406_4129862_-	DUF1983 domain-containing protein	NA	A0A2D1GNE3	Pseudomonas_phage	43.8	8.9e-256
WP_023381822.1|4129870_4130494_-|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	48.5	1.8e-42
WP_041925724.1|4130939_4131698_-	C40 family peptidase	NA	A0A2I6PI52	Pseudomonas_phage	46.7	6.4e-58
WP_023381825.1|4131713_4132412_-|tail	phage minor tail protein L	tail	A0A2I6PIA7	Pseudomonas_phage	45.4	1.5e-53
WP_023381826.1|4132411_4132750_-|tail	phage tail protein	tail	K7P7R1	Enterobacteria_phage	48.6	3.0e-23
WP_023381827.1|4132770_4135272_-|tail	phage tail tape measure protein	tail	D4FUM0	Pseudomonas_phage	49.1	1.6e-129
WP_023381829.1|4135541_4136009_-|tail	phage tail assembly chaperone family protein, TAC	tail	K7PJU9	Enterobacteria_phage	59.7	2.3e-34
WP_023381830.1|4136017_4136509_-|tail	phage major tail protein	tail	H2BDC0	Pseudomonas_virus	64.7	5.3e-53
WP_023381831.1|4136698_4136944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023381832.1|4137077_4137446_-	DUF3168 domain-containing protein	NA	Q9MCA6	Pseudomonas_phage	61.5	1.2e-38
WP_023381833.1|4137442_4137937_-	HK97 gp10 family phage protein	NA	A0A0U3TGT7	Pseudomonas_phage	77.0	5.1e-64
WP_023381834.1|4137929_4138271_-|head	phage head closure protein	head	B5WZS5	Pseudomonas_phage	48.7	3.3e-22
WP_023381835.1|4138270_4138747_-|head,tail	phage gp6-like head-tail connector protein	head,tail	G3ENA1	Psychrobacter_phage	37.4	1.5e-17
WP_023381836.1|4138750_4138972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023381837.1|4139013_4140270_-|capsid	phage major capsid protein	capsid	Q6JIM7	Burkholderia_virus	49.0	2.5e-91
WP_023381838.1|4140279_4140981_-|head,protease	HK97 family phage prohead protease	head,protease	Q6JIM8	Burkholderia_virus	61.5	2.5e-72
WP_023381839.1|4140977_4142312_-|portal	phage portal protein	portal	Q6JIM9	Burkholderia_virus	56.1	2.6e-131
WP_010952648.1|4142304_4142469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023381840.1|4142480_4144190_-|terminase	terminase large subunit	terminase	A0A0R6PIM0	Moraxella_phage	68.4	5.2e-233
WP_010952646.1|4144189_4144573_-|terminase	phage terminase small subunit	terminase	Q9XJT7	Pseudomonas_phage	44.2	3.9e-19
WP_023381841.1|4144700_4145069_-	HNH endonuclease	NA	H2BDK0	Pseudomonas_virus	59.8	4.9e-19
WP_023381842.1|4145059_4145239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023381843.1|4145299_4145617_-	hypothetical protein	NA	A0A059VJW1	Pseudomonas_phage	54.7	5.3e-14
WP_023381844.1|4145616_4145988_-	hypothetical protein	NA	A0A059VK40	Pseudomonas_phage	84.6	2.8e-38
WP_023381845.1|4146015_4146669_-	hypothetical protein	NA	A0A2H4J0P2	uncultured_Caudovirales_phage	37.2	1.3e-14
WP_158491102.1|4147113_4147536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023381848.1|4147833_4148445_-	hypothetical protein	NA	A0A2H4J2J2	uncultured_Caudovirales_phage	49.8	7.5e-57
WP_023381849.1|4148441_4148948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023381850.1|4148934_4150317_-	AAA family ATPase	NA	A0A2H4J8N1	uncultured_Caudovirales_phage	57.8	1.4e-140
WP_023381851.1|4150313_4151096_-	ATP-binding protein	NA	A0A0A0YRV1	Pseudomonas_phage	61.4	5.6e-89
WP_023381852.1|4151092_4151887_-	hypothetical protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	51.9	5.0e-29
WP_023381853.1|4151883_4152114_-	hypothetical protein	NA	A0A1W6JTF8	Pseudomonas_phage	53.9	1.6e-15
WP_023381854.1|4152110_4152725_-	hypothetical protein	NA	A0A1B0VMK2	Pseudomonas_phage	40.3	5.8e-33
WP_023381855.1|4152721_4153492_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	53.1	1.4e-23
WP_023381856.1|4153488_4153785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023381857.1|4154089_4154425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023381858.1|4154831_4155365_-	KilA-N domain-containing protein	NA	A0A0H5ARR4	Pseudomonas_phage	46.9	8.8e-38
WP_023381859.1|4155361_4155658_-	regulatory protein cro	NA	A0A0U1UNM4	Pseudomonas_phage	59.1	2.4e-13
WP_041925731.1|4155763_4156510_+	LexA family transcriptional regulator	NA	A0A0U1SXS9	Pseudomonas_phage	40.6	1.2e-40
WP_023381861.1|4156649_4157045_+	DUF134 domain-containing protein	NA	A0A0A0YWH0	Pseudomonas_phage	69.2	1.2e-34
WP_023381862.1|4157141_4157333_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	64.7	1.8e-09
WP_023381863.1|4157322_4157550_+	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	57.6	1.3e-09
WP_023381864.1|4157536_4158097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023381865.1|4158093_4158237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023381867.1|4158604_4158853_+	hypothetical protein	NA	B5WZU8	Pseudomonas_phage	53.9	1.6e-13
WP_023381868.1|4158868_4159588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084212860.1|4159588_4160734_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_041925735.1|4160774_4161752_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	70.5	5.4e-126
4161858:4161924	attR	AATATGGCGGAGAGATAGGGATTTGAACCCTAGGTACTGTTGCCAGTACAACGGATTTCGAATCCGT	NA	NA	NA	NA
>prophage 5
NC_022738	Pseudomonas sp. VLB120, complete sequence	5644569	4547944	4579871	5644569	head,capsid,terminase,tRNA,protease,portal,integrase,tail	uncultured_Mediterranean_phage(15.79%)	39	4544467:4544486	4588282:4588301
4544467:4544486	attL	ATCGCCGGCAAGCCGGCTCC	NA	NA	NA	NA
WP_023382203.1|4547944_4549234_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.3	2.5e-25
WP_023382204.1|4549258_4550368_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_023382205.1|4550371_4551421_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023382206.1|4551417_4552179_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_027906606.1|4552193_4553339_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_023382208.1|4553363_4553795_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	40.9	9.7e-19
WP_023382209.1|4553884_4554085_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_023382210.1|4554095_4554437_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_023382212.1|4554440_4556303_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.8	5.9e-105
WP_023382213.1|4556345_4556867_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_003257854.1|4556875_4557199_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	1.5e-24
WP_007929523.1|4557231_4557618_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	77.4	2.7e-52
WP_023382214.1|4557664_4558879_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.3	5.1e-33
WP_023382215.1|4558932_4559424_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_023382216.1|4559603_4560389_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_023382217.1|4560392_4561163_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_023382218.1|4561314_4562133_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_023382219.1|4562231_4562774_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_023382220.1|4562893_4563802_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.0	2.9e-49
WP_023382221.1|4563812_4565675_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_023382222.1|4565738_4566074_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	42.4	2.9e-10
WP_023382223.1|4566116_4567232_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.3	3.3e-95
WP_023382224.1|4567246_4568296_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_023382225.1|4568695_4569904_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	69.2	2.0e-154
WP_023382226.1|4569903_4570698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382227.1|4570807_4571032_+	AlpA family phage regulatory protein	NA	A0A1B0VNF0	Pseudomonas_phage	73.8	6.6e-19
WP_023382228.1|4571424_4571583_+	hypothetical protein	NA	A0A1B0VP73	Pseudomonas_phage	67.3	3.0e-10
WP_023382229.1|4571579_4571906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382230.1|4571908_4572316_+	virulence-associated protein E	NA	NA	NA	NA	NA
WP_023382231.1|4572312_4573566_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_023382232.1|4573562_4573856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382233.1|4573974_4575177_+|capsid	phage major capsid protein	capsid	F4YCR7	Synechococcus_phage	36.7	8.4e-44
WP_023382234.1|4575176_4575698_+|head,protease	HK97 family phage prohead protease	head,protease	B4UTP2	Rhizobium_phage	45.9	2.3e-30
WP_023382235.1|4575694_4576927_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	35.7	1.0e-60
WP_023382236.1|4576923_4577262_+	HNH endonuclease	NA	H9YSB8	environmental_Halophage	41.2	1.5e-06
WP_023382237.1|4577321_4577783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382238.1|4577779_4579276_+|terminase	phage terminase large subunit	terminase	F1C585	Cronobacter_phage	62.9	3.4e-180
WP_023382239.1|4579272_4579554_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	36.3	1.4e-05
WP_023382240.1|4579553_4579871_+|head	phage head closure protein	head	Q3HQT3	Burkholderia_phage	38.7	3.9e-09
4588282:4588301	attR	ATCGCCGGCAAGCCGGCTCC	NA	NA	NA	NA
>prophage 6
NC_022738	Pseudomonas sp. VLB120, complete sequence	5644569	5238076	5309994	5644569	head,terminase,capsid,plate,lysis,holin,portal,integrase,tail,transposase	Pseudomonas_phage(67.74%)	78	5293260:5293275	5308634:5308649
WP_023382784.1|5238076_5239021_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_023382785.1|5239144_5240029_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_023382786.1|5240050_5241016_+	L-carnitine dehydrogenase	NA	NA	NA	NA	NA
WP_023382787.1|5241026_5241497_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_023382788.1|5241855_5242113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382789.1|5242196_5243303_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_023382790.1|5243696_5245073_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_023382791.1|5245515_5246463_+|holin	choline ABC transporter substrate-binding protein	holin	NA	NA	NA	NA
WP_177325271.1|5246545_5247394_+|holin	choline ABC transporter permease subunit	holin	NA	NA	NA	NA
WP_023382793.1|5247390_5248569_+|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	36.2	3.2e-24
WP_011536177.1|5248665_5249436_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_023382794.1|5249446_5250184_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_023382795.1|5250211_5250472_-	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_023382796.1|5250472_5251111_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_023382797.1|5251111_5251705_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_023382798.1|5251919_5253578_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_023382799.1|5253899_5256137_+	AsmA family protein	NA	NA	NA	NA	NA
WP_023382800.1|5256133_5257201_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_023382801.1|5257197_5257470_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_162144451.1|5257974_5258856_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_023382803.1|5258909_5259353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382804.1|5259495_5260884_-	GABA permease	NA	NA	NA	NA	NA
WP_023382806.1|5261490_5262264_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.4	2.9e-21
WP_023382807.1|5262275_5263028_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023382808.1|5263083_5263776_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023382809.1|5263775_5264465_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023382810.1|5264537_5265743_+	methyltransferase	NA	NA	NA	NA	NA
WP_023382811.1|5266070_5266343_-	DUF3077 domain-containing protein	NA	NA	NA	NA	NA
WP_023382812.1|5266348_5266615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023382813.1|5267136_5267385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041925764.1|5268182_5268533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382815.1|5268606_5268852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382817.1|5269667_5269898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382818.1|5269909_5270206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382819.1|5271136_5272108_-	hypothetical protein	NA	A0A0U4IBV2	Pseudomonas_phage	67.5	1.6e-122
WP_023382820.1|5272080_5272785_-	hypothetical protein	NA	A0A2I7RNK1	Vibrio_phage	39.0	2.4e-38
WP_023382821.1|5272781_5273327_-	hypothetical protein	NA	A0A0U4J942	Pseudomonas_phage	57.4	1.3e-47
WP_041925765.1|5273323_5274247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023382823.1|5274243_5274951_-	hypothetical protein	NA	A0A0U4JEJ6	Pseudomonas_phage	46.8	5.1e-57
WP_023382824.1|5274958_5276923_-|tail	phage tail protein	tail	A0A0U4K5K2	Pseudomonas_phage	49.0	4.0e-136
WP_023382825.1|5276933_5277458_-	hypothetical protein	NA	A0A0U4JVX3	Pseudomonas_phage	75.9	6.8e-75
WP_023382826.1|5277454_5278621_-|plate	baseplate J/gp47 family protein	plate	A0A0U4JJ14	Pseudomonas_phage	72.4	3.2e-157
WP_023382827.1|5278617_5278941_-	DUF2590 family protein	NA	A0A0U4B0N5	Pseudomonas_phage	76.4	7.2e-35
WP_023382828.1|5278940_5281010_-|tail	phage tail tape measure protein	tail	A0A0U4IJ81	Pseudomonas_phage	41.8	8.8e-134
WP_023382829.1|5281184_5281472_-	hypothetical protein	NA	A0A0U4B0P2	Pseudomonas_phage	53.8	1.9e-18
WP_023382830.1|5281468_5281960_-|lysis	lysis protein	lysis	A0A0U4JXC2	Pseudomonas_phage	44.3	2.2e-19
WP_023382831.1|5281956_5282487_-	lysozyme	NA	NA	NA	NA	NA
WP_041925563.1|5282483_5282765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023382833.1|5282761_5282977_-	TraR/DksA C4-type zinc finger protein	NA	A0A0U4IIN4	Pseudomonas_phage	58.2	1.0e-13
WP_023382834.1|5282976_5283426_-	DUF2597 family protein	NA	A0A0U3TH58	Pseudomonas_phage	75.8	1.8e-60
WP_023382835.1|5283432_5284542_-	DUF2586 family protein	NA	A0A0U4KLE6	Pseudomonas_phage	65.3	2.1e-134
WP_023382836.1|5284553_5285234_-	phage virion morphogenesis protein	NA	A0A0U4ISN1	Pseudomonas_phage	59.6	4.3e-61
WP_023382837.1|5285223_5285679_-|tail	phage tail protein	tail	A0A0U4IBS7	Pseudomonas_phage	62.0	4.9e-45
WP_023382838.1|5285675_5286137_-|head	head completion/stabilization protein	head	A0A0U4J933	Pseudomonas_phage	57.5	6.7e-42
WP_023382839.1|5286233_5286968_-|terminase	terminase endonuclease subunit	terminase	A0A0U4JEJ1	Pseudomonas_phage	64.1	3.9e-76
WP_023382840.1|5286964_5287987_-|capsid	phage major capsid protein, P2 family	capsid	A0A0U4K5I9	Pseudomonas_phage	64.2	3.0e-119
WP_023382841.1|5287988_5288930_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0U4JVV6	Pseudomonas_phage	58.9	4.4e-64
WP_084212880.1|5290986_5291928_+|portal	phage portal protein	portal	A0A0U4B0L9	Pseudomonas_phage	75.8	2.2e-100
WP_023382844.1|5291999_5292260_+	ogr/Delta-like zinc finger family protein	NA	A5X9H0	Aeromonas_virus	43.4	3.3e-14
WP_023382846.1|5292577_5292916_-	helix-turn-helix domain-containing protein	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	44.0	1.9e-17
WP_041925564.1|5293000_5293201_+	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	47.7	2.1e-08
WP_023382848.1|5293231_5293711_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	51.3	1.1e-34
5293260:5293275	attL	AGGATGTGGTCAGCGC	NA	NA	NA	NA
WP_023382849.1|5293707_5293947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382850.1|5294014_5294248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382851.1|5294256_5296944_+	toprim domain-containing protein	NA	A0A2H4J936	uncultured_Caudovirales_phage	52.1	2.9e-270
WP_023382852.1|5296949_5297252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051376146.1|5297382_5297610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041925769.1|5297639_5298020_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_023382855.1|5298016_5298250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382856.1|5298391_5298604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382857.1|5298600_5299773_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	38.9	2.7e-71
WP_023382858.1|5300079_5301399_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	40.0	3.7e-69
WP_023382859.1|5302200_5303184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382860.1|5303180_5303864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023382862.1|5305167_5306148_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_023382863.1|5306503_5307466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023379379.1|5307701_5308502_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.5	2.9e-32
WP_167332798.1|5308494_5309994_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
5308634:5308649	attR	AGGATGTGGTCAGCGC	NA	NA	NA	NA
