The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP007534	Salmonella enterica subsp. enterica serovar Abony str. 0014 strain ATCC 6017 chromosome, complete genome	4737447	462316	478765	4737447	tRNA,tail,integrase	Erwinia_phage(30.77%)	17	459987:460010	484677:484700
459987:460010	attL	TTGCCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
WP_001264394.1|462316_463330_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	2.8e-109
WP_001144069.1|463557_463773_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|464008_465754_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|465903_467751_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|467873_468380_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000468307.1|468738_468957_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
WP_023244904.1|469023_470193_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.7	5.0e-211
WP_023135453.1|470189_470675_-|tail	phage tail protein	tail	A0A0M4RCP0	Salmonella_phage	99.4	2.3e-85
WP_023244906.1|471468_471669_-	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	87.9	2.9e-26
WP_023244907.1|471676_472186_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	1.5e-87
WP_023244908.1|472206_472482_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.4	7.8e-38
WP_023244909.1|472614_473190_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	65.4	2.6e-67
WP_023244910.1|473189_474191_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	96.4	2.7e-189
WP_023244911.1|474226_475246_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	23.7	2.6e-09
WP_000213758.1|475556_476324_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000983434.1|476555_477203_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478465.1|477199_478765_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	37.0	2.0e-13
484677:484700	attR	TTGCCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
>prophage 2
NZ_CP007534	Salmonella enterica subsp. enterica serovar Abony str. 0014 strain ATCC 6017 chromosome, complete genome	4737447	1044805	1053474	4737447		Enterobacteria_phage(85.71%)	10	NA	NA
WP_023245487.1|1044805_1045372_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	64.3	3.7e-58
WP_023245488.1|1045388_1045634_-	phage transcriptional activator, Ogr/delta	NA	Q7M294	Enterobacteria_phage	75.3	2.4e-30
WP_023245489.1|1045630_1046368_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.3	9.0e-81
WP_023245490.1|1046906_1047173_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	1.5e-30
WP_023245491.1|1047169_1047718_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	65.8	9.1e-30
WP_001216599.1|1047714_1047942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472077.1|1047938_1048259_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_023245492.1|1048273_1050607_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
WP_000120776.1|1051261_1051606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023245493.1|1052283_1053474_+	AAA family ATPase	NA	C7BGE8	Burkholderia_phage	33.3	3.5e-10
>prophage 3
NZ_CP007534	Salmonella enterica subsp. enterica serovar Abony str. 0014 strain ATCC 6017 chromosome, complete genome	4737447	2289953	2334174	4737447	coat,lysis,holin,terminase,integrase,protease,portal	Salmonella_phage(71.43%)	70	2293800:2293841	2334463:2334504
WP_001043667.1|2289953_2291006_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.8	2.6e-113
WP_001285275.1|2291288_2292392_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_023245184.1|2292403_2293654_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.0	1.8e-97
2293800:2293841	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGC	NA	NA	NA	NA
WP_006816417.1|2293859_2295023_-|integrase	site-specific integrase	integrase	A0A220NQU7	Salmonella_phage	100.0	1.4e-229
WP_024139959.1|2295252_2295882_-	DUF5420 family protein	NA	A0A220NQT7	Salmonella_phage	100.0	5.8e-121
WP_001277764.1|2295982_2296162_-	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	100.0	1.9e-29
WP_006816413.1|2296258_2296804_-	DUF551 domain-containing protein	NA	A0A220NQT9	Salmonella_phage	100.0	9.5e-104
WP_006816411.1|2296800_2297616_-	DUF550 domain-containing protein	NA	A0A220NQU1	Salmonella_phage	100.0	7.5e-137
WP_006816410.1|2297626_2297890_-	hypothetical protein	NA	A0A220NQU8	Salmonella_phage	100.0	3.7e-45
WP_016049830.1|2297877_2298153_-	hypothetical protein	NA	I6R982	Salmonella_phage	100.0	1.9e-52
WP_016049831.1|2298186_2298417_-	hypothetical protein	NA	A0A220NQV0	Salmonella_phage	100.0	6.9e-40
WP_006816408.1|2298419_2298941_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	100.0	2.1e-92
WP_015968590.1|2298937_2299315_-	hypothetical protein	NA	A0A220NQV7	Salmonella_phage	100.0	2.5e-63
WP_001214771.1|2299311_2299482_-	DUF2737 family protein	NA	A0A220NQV6	Salmonella_phage	100.0	6.1e-25
WP_001111310.1|2299492_2299786_-	DUF2856 family protein	NA	E7C9P8	Salmonella_phage	100.0	3.2e-50
WP_001253475.1|2299832_2300117_-	sigma-70 family RNA polymerase sigma factor	NA	E7C9P9	Salmonella_phage	100.0	2.3e-45
WP_000365269.1|2300116_2300824_-	recombinase	NA	E7C9Q0	Salmonella_phage	100.0	3.7e-140
WP_000361564.1|2301017_2301131_-	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_001541875.1|2301123_2301270_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	E7C9Q3	Salmonella_phage	100.0	1.3e-20
WP_000776962.1|2301354_2301669_-	superinfection exclusion protein	NA	E7C9Q4	Salmonella_phage	100.0	1.9e-56
WP_071824239.1|2301840_2302380_-	pentapeptide repeat-containing protein	NA	E7C9Q5	Salmonella_phage	99.4	1.2e-53
WP_000213981.1|2302463_2302658_-	Restriction inhibitor protein ral	NA	E7C9Q6	Salmonella_phage	100.0	2.5e-30
WP_000216177.1|2302736_2303075_-	hypothetical protein	NA	E7C9Q7	Salmonella_phage	100.0	1.1e-57
WP_138922303.1|2303095_2303278_-	hypothetical protein	NA	A0A220NQW5	Salmonella_phage	100.0	3.3e-29
WP_071533030.1|2303297_2303495_+	hypothetical protein	NA	A0A075B8J1	Enterobacteria_phage	97.1	1.5e-11
WP_023177700.1|2303632_2304295_-	LexA family transcriptional regulator	NA	Q37946	Enterobacteria_phage	100.0	6.3e-126
WP_000067726.1|2304413_2304629_+	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_001103492.1|2304739_2305021_+	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_001125981.1|2305055_2305202_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_006819445.1|2305194_2306094_+	hypothetical protein	NA	A0A220NQX5	Salmonella_phage	100.0	2.1e-156
WP_006819447.1|2306083_2307520_+	AAA family ATPase	NA	A0A220NQX0	Salmonella_phage	100.0	7.2e-276
WP_006819448.1|2307594_2307867_+	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	100.0	4.2e-44
WP_023245189.1|2308097_2308346_+	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	100.0	5.2e-41
WP_015968595.1|2308348_2308645_+	hypothetical protein	NA	A0A220NQY0	Salmonella_phage	100.0	2.8e-49
WP_023245190.1|2308601_2309048_+	recombination protein NinB	NA	A0A220NQX4	Salmonella_phage	100.0	8.3e-82
WP_024139963.1|2309044_2309218_+	hypothetical protein	NA	Q8HAF7	Salmonella_phage	100.0	8.9e-32
WP_000113765.1|2309184_2309361_+	NinE family protein	NA	C6ZR57	Salmonella_phage	100.0	4.6e-28
WP_001532927.1|2309363_2309705_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	100.0	2.1e-64
WP_000950971.1|2309697_2309871_+	protein ninF	NA	A0A220NQX7	Salmonella_phage	100.0	5.6e-26
WP_000986768.1|2309860_2310166_+	hypothetical protein	NA	Q8HAF3	Salmonella_phage	100.0	1.3e-54
WP_000002241.1|2310158_2310449_+	DUF1364 domain-containing protein	NA	A0A220NQY2	Salmonella_phage	100.0	1.7e-51
WP_015968599.1|2310445_2310841_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A220NQY4	Salmonella_phage	100.0	9.1e-72
WP_000149925.1|2310837_2311041_+	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000219143.1|2311021_2311201_+	hypothetical protein	NA	E7C9S6	Salmonella_phage	100.0	9.2e-24
WP_000027541.1|2311197_2311716_+	DUF1133 family protein	NA	A0A192Y911	Salmonella_phage	100.0	9.0e-96
WP_001129219.1|2312115_2312433_+|holin	holin	holin	E7C9S8	Salmonella_phage	100.0	1.1e-54
WP_001194317.1|2312419_2312818_+	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	100.0	1.1e-69
WP_001541885.1|2312814_2313267_+|lysis	lysis protein	lysis	E7C9T0	Salmonella_phage	100.0	5.0e-74
WP_000808099.1|2313562_2313805_+	DUF2560 family protein	NA	Q76H60	Enterobacteria_phage	100.0	1.7e-33
WP_001140562.1|2313808_2314198_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	100.0	3.9e-75
WP_001687044.1|2314197_2314602_+	hypothetical protein	NA	Q76H26	Enterobacteria_phage	100.0	1.1e-67
WP_000729923.1|2314605_2315094_+	hypothetical protein	NA	Q76H25	Enterobacteria_phage	100.0	1.0e-88
WP_006819463.1|2315071_2316571_+|terminase	terminase large subunit	terminase	Q5C836	Enterobacteria_phage	100.0	1.7e-307
WP_006819465.1|2316570_2318748_+|portal	portal protein	portal	Q5C835	Enterobacteria_phage	100.0	0.0e+00
WP_006819467.1|2318761_2319673_+	scaffolding protein	NA	A0A220NQZ9	Salmonella_phage	100.0	7.5e-162
WP_001196937.1|2319672_2320965_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_000538674.1|2321005_2321566_+	hypothetical protein	NA	E7C9T9	Salmonella_phage	100.0	1.3e-103
WP_001166093.1|2321549_2322050_+	packaged DNA stabilization protein p27	NA	E7C9U0	Salmonella_phage	100.0	2.5e-90
WP_006819470.1|2322009_2323428_+	Tail accessory protein	NA	A0A220NQZ5	Salmonella_phage	100.0	4.9e-277
WP_000774919.1|2323431_2324070_+	hypothetical protein	NA	A8CGD2	Salmonella_phage	100.0	6.3e-91
WP_000627703.1|2324069_2324525_+	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_006819472.1|2324527_2325217_+	hypothetical protein	NA	I1TEJ4	Salmonella_phage	100.0	3.9e-94
WP_006819474.1|2325226_2326561_+	phage DNA ejection protein	NA	A0A220NR03	Salmonella_phage	100.0	2.7e-245
WP_001029860.1|2326560_2328537_+	hypothetical protein	NA	Q76H13	Enterobacteria_phage	100.0	0.0e+00
WP_071533035.1|2328675_2328969_+	hypothetical protein	NA	Q76H12	Enterobacteria_phage	100.0	3.2e-50
WP_000532177.1|2328989_2329238_-	Arc family DNA-binding protein	NA	Q76H48	Enterobacteria_phage	100.0	1.8e-38
WP_006819477.1|2329373_2331377_+	protein 9	NA	A0A220NR02	Salmonella_phage	100.0	0.0e+00
WP_000671496.1|2331435_2332893_-	hypothetical protein	NA	A8CG94	Salmonella_phage	100.0	1.3e-240
WP_000703639.1|2332882_2333815_-	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	100.0	5.5e-176
WP_000915528.1|2333811_2334174_-	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
2334463:2334504	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGC	NA	NA	NA	NA
>prophage 4
NZ_CP007534	Salmonella enterica subsp. enterica serovar Abony str. 0014 strain ATCC 6017 chromosome, complete genome	4737447	2927005	2934317	4737447	protease,integrase	Dickeya_phage(16.67%)	7	2928256:2928270	2940068:2940082
WP_001201751.1|2927005_2928124_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125873.1|2928120_2930067_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
2928256:2928270	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|2930196_2930418_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_023245268.1|2930741_2931062_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_023245267.1|2931092_2933369_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	4.8e-165
WP_001117984.1|2933580_2933778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228156.1|2933939_2934317_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
2940068:2940082	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 5
NZ_CP007534	Salmonella enterica subsp. enterica serovar Abony str. 0014 strain ATCC 6017 chromosome, complete genome	4737447	3159285	3205562	4737447	tRNA,tail,transposase,integrase	Salmonella_phage(25.93%)	49	3159826:3159853	3194272:3194299
WP_000502119.1|3159285_3159744_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
3159826:3159853	attL	CCTCCGGCTATGCCGGAGGATATTTATT	NA	NA	NA	NA
WP_000482970.1|3159872_3160838_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_001114323.1|3160985_3164432_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001272105.1|3164658_3165969_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_001033714.1|3165961_3166663_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	2.4e-35
WP_000168091.1|3166662_3167907_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291332.1|3167935_3168847_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_001191856.1|3168865_3169687_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	33.5	1.0e-21
WP_000759329.1|3169768_3170815_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580299.1|3170839_3171619_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_001533329.1|3171934_3172945_-	SPI-2 type III secretion system effector SifA	NA	NA	NA	NA	NA
WP_000799391.1|3173273_3174137_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	2.0e-10
WP_000531607.1|3174120_3175257_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	34.0	2.1e-28
WP_000359412.1|3175507_3176737_+	peptidase T	NA	NA	NA	NA	NA
WP_023209851.1|3176740_3178075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000456514.1|3178114_3179236_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_001031687.1|3179316_3180780_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001537766.1|3180779_3181451_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423763.1|3181577_3182948_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.3	8.5e-109
WP_001519653.1|3182951_3183593_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004541.1|3183679_3184786_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_023209849.1|3184839_3185301_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000825956.1|3185312_3185642_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001249411.1|3185638_3186304_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_023244952.1|3186475_3187726_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	7.4e-19
WP_000741321.1|3187839_3188982_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	80.0	1.4e-173
WP_023244951.1|3188971_3189208_-	excisionase	NA	NA	NA	NA	NA
WP_000069466.1|3189257_3189761_-	hypothetical protein	NA	A0A075B8H2	Enterobacteria_phage	92.3	6.0e-36
WP_000066252.1|3189757_3190090_-	hypothetical protein	NA	S4TNP2	Salmonella_phage	80.3	3.0e-20
WP_001033921.1|3190082_3190403_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	60.2	3.6e-34
WP_001126032.1|3190438_3191269_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_000784710.1|3191638_3191866_+	DNA breaking-rejoining protein	NA	A0A0M4RU10	Salmonella_phage	66.7	2.2e-14
WP_001097218.1|3191995_3192685_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.9	2.1e-60
WP_001574213.1|3192781_3193306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798706.1|3193679_3194129_-	lipoprotein	NA	NA	NA	NA	NA
WP_001574215.1|3194489_3195176_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	99.6	1.8e-131
3194272:3194299	attR	CCTCCGGCTATGCCGGAGGATATTTATT	NA	NA	NA	NA
WP_071824250.1|3195451_3195883_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	59.2	1.0e-28
WP_000725267.1|3195972_3196470_+	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000877926.1|3196586_3197120_-	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_023205989.1|3197209_3197905_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.7e-89
WP_023205988.1|3197914_3198652_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.2e-114
WP_001576012.1|3198549_3199254_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_038390029.1|3201353_3201932_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	85.2	3.1e-89
WP_058107135.1|3202028_3202229_-	PagK	NA	NA	NA	NA	NA
WP_077914361.1|3202402_3202570_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	93.9	4.6e-09
WP_023245329.1|3202741_3203161_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	59.1	1.9e-35
WP_023245330.1|3203163_3204432_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	98.8	7.5e-245
WP_000334550.1|3204424_3205096_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.8e-80
WP_012218897.1|3205349_3205562_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.5e-20
>prophage 6
NZ_CP007534	Salmonella enterica subsp. enterica serovar Abony str. 0014 strain ATCC 6017 chromosome, complete genome	4737447	3832379	3874067	4737447	tail,protease,integrase	Salmonella_phage(25.0%)	39	3861915:3861944	3874203:3874232
WP_000984498.1|3832379_3833261_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|3833454_3835503_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|3835522_3836209_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000145727.1|3836306_3836891_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|3836932_3838216_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001521100.1|3838184_3840818_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001670762.1|3840895_3842335_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131167.1|3842452_3842689_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457836.1|3842799_3842991_+	YebW family protein	NA	NA	NA	NA	NA
WP_023244784.1|3843009_3843660_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	6.5e-59
WP_001134857.1|3843882_3844047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000182072.1|3844331_3845054_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422890.1|3845737_3846133_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	33.6	8.3e-17
WP_000030949.1|3846462_3846939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354402.1|3847311_3847731_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077914367.1|3848101_3848371_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	44.4	4.5e-06
WP_038390064.1|3848536_3848677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|3851592_3852507_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|3852639_3852798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|3852807_3853422_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000951652.1|3853909_3854056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|3854569_3854695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001751604.1|3855264_3855465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071785322.1|3855561_3856062_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	78.0	6.7e-64
WP_000340812.1|3858151_3858643_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.9	4.2e-42
WP_001034748.1|3858697_3858886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|3858950_3859118_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001013467.1|3859960_3860191_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_077914368.1|3860380_3860875_+	RecE	NA	A0A0U2I1R6	Escherichia_phage	70.3	2.8e-22
WP_023244716.1|3861518_3861788_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	54.0	4.3e-17
3861915:3861944	attL	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_000161704.1|3864011_3864734_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143174.1|3864929_3865505_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	91.0	1.5e-96
WP_038390069.1|3865504_3866956_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	70.2	7.3e-42
WP_022742713.1|3866945_3867548_-	DUF2612 domain-containing protein	NA	H9C0Y0	Aeromonas_phage	43.2	5.9e-30
WP_023245088.1|3867549_3870141_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.2	2.9e-102
WP_001126032.1|3870866_3871697_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_001518052.1|3872437_3872662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038390080.1|3872734_3873007_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	4.0e-10
WP_038390082.1|3872987_3874067_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	1.5e-100
3874203:3874232	attR	AAATAAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
>prophage 7
NZ_CP007534	Salmonella enterica subsp. enterica serovar Abony str. 0014 strain ATCC 6017 chromosome, complete genome	4737447	3980286	3987555	4737447		Morganella_phage(33.33%)	8	NA	NA
WP_001157315.1|3980286_3981717_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_038390093.1|3981790_3982486_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_000107430.1|3982577_3982877_-	membrane protein	NA	NA	NA	NA	NA
WP_001080675.1|3983526_3984738_+	porin	NA	Q1MVN1	Enterobacteria_phage	56.0	1.3e-108
WP_024131163.1|3984998_3985187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|3985197_3985410_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457663.1|3985864_3987133_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	9.3e-227
WP_000394197.1|3987135_3987555_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 8
NZ_CP007534	Salmonella enterica subsp. enterica serovar Abony str. 0014 strain ATCC 6017 chromosome, complete genome	4737447	4103113	4113619	4737447		Enterobacteria_phage(37.5%)	10	NA	NA
WP_000126349.1|4103113_4104427_-	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
WP_000565903.1|4104453_4105533_-	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.7e-16
WP_000648784.1|4105537_4106311_-	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000018227.1|4106307_4107300_-	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000973709.1|4107305_4107857_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_023194347.1|4107857_4108736_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.1e-108
WP_001023658.1|4108783_4109683_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000697846.1|4109682_4110768_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_000981469.1|4111144_4112038_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_023209799.1|4112215_4113619_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.2	5.2e-21
>prophage 9
NZ_CP007534	Salmonella enterica subsp. enterica serovar Abony str. 0014 strain ATCC 6017 chromosome, complete genome	4737447	4181897	4191068	4737447	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195332.1|4181897_4183931_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|4184171_4184630_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023244721.1|4184801_4185332_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|4185388_4185856_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|4185902_4186622_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272845.1|4186618_4188304_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_001240418.1|4188526_4189258_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|4189317_4189425_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|4189405_4190137_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023204661.1|4190120_4191068_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.4	6.2e-10
>prophage 10
NZ_CP007534	Salmonella enterica subsp. enterica serovar Abony str. 0014 strain ATCC 6017 chromosome, complete genome	4737447	4210475	4276871	4737447	holin,tail,lysis	Salmonella_phage(28.57%)	60	NA	NA
WP_000989296.1|4210475_4211171_+|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_000553526.1|4211324_4212209_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_000920081.1|4212385_4213105_+	outer membrane permeability protein SanA	NA	NA	NA	NA	NA
WP_000605187.1|4213101_4213347_+	DUF2542 family protein	NA	NA	NA	NA	NA
WP_001136420.1|4213551_4214793_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000956095.1|4214786_4216022_+	NAD-dependent dihydropyrimidine dehydrogenase subunit PreA	NA	NA	NA	NA	NA
WP_001275101.1|4216096_4217107_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000535913.1|4217122_4218643_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	1.0e-09
WP_020437444.1|4218776_4219775_-	galactose/glucose ABC transporter substrate-binding protein MglB	NA	NA	NA	NA	NA
WP_000628634.1|4220273_4221296_-	HTH-type transcriptional regulator GalS	NA	NA	NA	NA	NA
WP_001526153.1|4221445_4222588_-	DUF418 family protein	NA	NA	NA	NA	NA
WP_001139611.1|4222602_4223271_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	4.1e-56
WP_000425488.1|4223600_4224458_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000876817.1|4224446_4224836_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023245065.1|4224840_4226208_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000022911.1|4226424_4227312_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000023807.1|4227344_4228667_+	MFS transporter	NA	NA	NA	NA	NA
WP_000488254.1|4228710_4230702_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
WP_000535000.1|4231047_4232517_-	lysine-specific permease	NA	NA	NA	NA	NA
WP_000548316.1|4232706_4233570_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000137966.1|4233690_4234740_+	YeiH family protein	NA	NA	NA	NA	NA
WP_000873915.1|4234818_4235676_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.5	9.9e-23
WP_023245066.1|4235740_4237429_-	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000091249.1|4237445_4238384_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_000487287.1|4238383_4239514_-	fused PTS fructose transporter subunit IIA/HPr protein	NA	NA	NA	NA	NA
WP_000551937.1|4239882_4241064_+	sugar efflux transporter SetB	NA	NA	NA	NA	NA
WP_023245232.1|4241128_4241794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519564.1|4241795_4241918_-	membrane protein	NA	NA	NA	NA	NA
WP_001523448.1|4242305_4242560_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001136822.1|4242883_4243456_+	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_000169346.1|4243668_4244655_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_000178095.1|4244684_4245404_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000241015.1|4245817_4246390_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
WP_000957751.1|4246715_4248272_+	cyclic di-GMP phosphodiesterase	NA	NA	NA	NA	NA
WP_023245230.1|4248378_4250184_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000501623.1|4250193_4251288_+	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_001137761.1|4251287_4252313_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000203619.1|4252314_4253904_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.1	3.2e-19
WP_001094639.1|4253907_4254252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213349.1|4254642_4255833_-	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.2	5.4e-19
WP_001234836.1|4255860_4256556_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578121.1|4256707_4258468_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	1.9e-100
WP_000494192.1|4258592_4258877_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000033443.1|4258985_4259606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000050806.1|4259633_4260641_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	4.5e-83
WP_001135904.1|4260820_4261048_+	YejL family protein	NA	NA	NA	NA	NA
WP_000256153.1|4261079_4262840_+	cardiolipin transport protein PbgA	NA	NA	NA	NA	NA
WP_000806401.1|4263120_4263624_-	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
WP_000884778.1|4263651_4263942_+	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000639473.1|4264289_4266119_+	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000022213.1|4266172_4266616_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_001215679.1|4266993_4267521_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000554739.1|4267523_4268765_-	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001120499.1|4269357_4269687_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000894640.1|4269983_4271315_+	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_010989045.1|4271343_4271712_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_024149446.1|4271726_4272716_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	1.7e-188
WP_001115840.1|4273044_4275411_-	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001113462.1|4275579_4275783_-|tail	tail protein	tail	NA	NA	NA	NA
WP_000624225.1|4276079_4276871_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
