The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019177	Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 chromosome, complete genome	4805448	1443653	1520621	4805448	coat,lysis,integrase,portal	Salmonella_phage(45.63%)	105	1481430:1481489	1519367:1519545
WP_001749406.1|1443653_1443857_-	hypothetical protein	NA	I6RSG8	Salmonella_phage	100.0	5.5e-33
WP_016049827.1|1443953_1444304_-	hypothetical protein	NA	I6R980	Salmonella_phage	100.0	3.2e-60
WP_016049828.1|1444375_1444660_-	ASCH domain-containing protein	NA	I6S5Y4	Salmonella_phage	100.0	5.4e-50
WP_023241538.1|1444652_1445288_-	DUF551 domain-containing protein	NA	I6R0M4	Salmonella_phage	56.3	2.1e-54
WP_023241536.1|1445694_1446087_-	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	76.0	7.2e-45
WP_001214452.1|1446083_1446248_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_000753555.1|1446264_1446579_-	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_023241535.1|1446590_1447073_-	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	7.2e-79
WP_023241534.1|1447056_1447959_-	phage-related DNA recombination protein	NA	K7PKG9	Enterobacteria_phage	87.8	3.7e-145
WP_000604106.1|1447955_1448264_-	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	98.0	2.1e-52
WP_001243355.1|1448348_1448501_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|1448485_1448620_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_023241533.1|1448703_1449120_-	hypothetical protein	NA	A0A0U2DAF7	Escherichia_phage	65.0	7.6e-53
WP_023241532.1|1449162_1449411_-	hypothetical protein	NA	K7P6N6	Enterobacteria_phage	97.6	2.2e-36
WP_021520338.1|1449578_1449821_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	59.7	5.4e-19
WP_000394305.1|1449848_1450100_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	98.8	1.4e-41
WP_023241531.1|1450108_1450414_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	89.7	6.4e-25
WP_000233129.1|1450782_1451151_-	hypothetical protein	NA	K7P6G1	Enterobacteria_phage	98.4	8.5e-56
WP_023241530.1|1451169_1451886_-	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	99.2	2.0e-122
WP_000620665.1|1451992_1452187_+	hypothetical protein	NA	K7PLQ6	Enterobacteria_phage	100.0	1.8e-28
WP_021544312.1|1452295_1452574_+	transcriptional activator protein C1	NA	K7P7A2	Enterobacteria_phage	97.8	9.0e-42
WP_023241529.1|1452756_1453578_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.3	7.5e-153
WP_001560907.1|1453574_1454951_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	2.8e-253
WP_023241528.1|1455023_1455230_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	94.1	7.4e-25
WP_000796282.1|1455242_1455569_+	hypothetical protein	NA	Q716D0	Shigella_phage	100.0	3.3e-59
WP_000049638.1|1455565_1455766_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_000814600.1|1456089_1456500_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	9.4e-72
WP_001254255.1|1456496_1456673_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_001363895.1|1456675_1457035_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	74.2	2.6e-41
WP_023241526.1|1457027_1457204_+	hypothetical protein	NA	I6S668	Salmonella_phage	98.2	2.8e-25
WP_001283993.1|1457196_1457415_+	hypothetical protein	NA	S4TUE0	Salmonella_phage	68.1	5.6e-23
WP_023241525.1|1457415_1457706_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	99.0	3.8e-51
WP_023241524.1|1457702_1458065_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	98.3	7.8e-62
WP_000994516.1|1458061_1458250_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001235461.1|1458246_1458870_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000286100.1|1459306_1459510_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_023241523.1|1459487_1459985_+	lysozyme	NA	A0A192Y6U3	Salmonella_phage	98.8	3.2e-90
WP_023241522.1|1459981_1460449_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	98.7	1.4e-76
WP_023241521.1|1460665_1461196_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	99.4	5.6e-93
WP_000807788.1|1461452_1461695_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_023241520.1|1461698_1462088_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	98.4	4.3e-74
WP_024149211.1|1462087_1462492_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	97.0	3.8e-65
WP_001629224.1|1462504_1462963_+	hypothetical protein	NA	A0A2P1MXF5	Escherichia_phage	66.2	3.3e-49
WP_023217188.1|1462962_1464423_+	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.5	3.3e-220
WP_023241519.1|1464422_1466600_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.9	0.0e+00
WP_000433856.1|1466613_1467525_+	scaffold protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
WP_023241518.1|1467524_1468817_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.1	6.1e-242
WP_023241517.1|1468857_1469418_+	hypothetical protein	NA	E7C9T9	Salmonella_phage	97.8	1.0e-100
WP_023241516.1|1469401_1469902_+	DNA stabilization, phage-associated protein	NA	I6RSF6	Salmonella_phage	99.4	9.3e-90
WP_023241515.1|1469861_1471280_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	97.9	9.0e-271
WP_023241514.1|1471283_1471985_+	hypothetical protein	NA	A0A0M4QWW6	Salmonella_phage	91.0	3.5e-66
WP_023241513.1|1471984_1472440_+	DUF2824 family protein	NA	I6R0L6	Salmonella_phage	100.0	3.0e-87
WP_023241512.1|1472442_1473132_+	hypothetical protein	NA	A0A0M4RTU3	Salmonella_phage	97.8	4.3e-109
WP_023241511.1|1473142_1474615_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	57.7	2.2e-115
WP_023241510.1|1474614_1476618_+	hypothetical protein	NA	A0A2I7QW93	Vibrio_phage	36.4	6.4e-97
WP_000275950.1|1476629_1476950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077464452.1|1477409_1477745_+	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	100.0	1.7e-58
WP_001674386.1|1477748_1477946_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	100.0	2.9e-31
WP_000532174.1|1477953_1478205_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	98.8	4.1e-38
WP_023241509.1|1478340_1480197_+	hypothetical protein	NA	I6S5Y0	Salmonella_phage	99.8	0.0e+00
WP_001749026.1|1480259_1481429_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	100.0	3.7e-230
1481430:1481489	attL	GTGGGCATAAATCCGTGGTCATTTTAACATGTGCCCACAATATGCCCGCATTAATGTGCG	NA	NA	NA	NA
WP_001749406.1|1481697_1481901_-	hypothetical protein	NA	I6RSG8	Salmonella_phage	100.0	5.5e-33
WP_016049827.1|1481997_1482348_-	hypothetical protein	NA	I6R980	Salmonella_phage	100.0	3.2e-60
WP_016049828.1|1482419_1482704_-	ASCH domain-containing protein	NA	I6S5Y4	Salmonella_phage	100.0	5.4e-50
WP_023241538.1|1482696_1483332_-	DUF551 domain-containing protein	NA	I6R0M4	Salmonella_phage	56.3	2.1e-54
WP_075995151.1|1483738_1484107_-	hypothetical protein	NA	K7PGR4	Enterobacteria_phage	74.4	7.7e-41
WP_001214452.1|1484127_1484292_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_023241534.1|1485099_1486002_-	phage-related DNA recombination protein	NA	K7PKG9	Enterobacteria_phage	87.8	3.7e-145
WP_000972063.1|1486520_1486655_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_023241528.1|1492963_1493170_+	hypothetical protein	NA	G8C7M4	Escherichia_phage	94.1	7.4e-25
WP_000049638.1|1493504_1493705_+	hypothetical protein	NA	Q716C9	Shigella_phage	100.0	4.6e-32
WP_000814600.1|1494028_1494439_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	99.3	9.4e-72
WP_001254255.1|1494435_1494612_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_001363895.1|1494614_1494974_+	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	74.2	2.6e-41
WP_023241526.1|1494966_1495143_+	hypothetical protein	NA	I6S668	Salmonella_phage	98.2	2.8e-25
WP_001283993.1|1495135_1495354_+	hypothetical protein	NA	S4TUE0	Salmonella_phage	68.1	5.6e-23
WP_023241525.1|1495354_1495645_+	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	99.0	3.8e-51
WP_023241524.1|1495641_1496004_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	98.3	7.8e-62
WP_000994516.1|1496000_1496189_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_000286100.1|1497244_1497448_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_023241523.1|1497425_1497923_+	lysozyme	NA	A0A192Y6U3	Salmonella_phage	98.8	3.2e-90
WP_023241522.1|1497919_1498387_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	98.7	1.4e-76
WP_023241521.1|1498603_1499134_+	KilA-N domain-containing protein	NA	A0A2H4FQV0	Salmonella_phage	99.4	5.6e-93
WP_000807788.1|1499390_1499633_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_023241520.1|1499636_1500026_+	hypothetical protein	NA	Q76H27	Enterobacteria_phage	98.4	4.3e-74
WP_024149211.1|1500025_1500430_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	97.0	3.8e-65
WP_001629224.1|1500442_1500901_+	hypothetical protein	NA	A0A2P1MXF5	Escherichia_phage	66.2	3.3e-49
WP_023217188.1|1500900_1502361_+	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.5	3.3e-220
WP_023241519.1|1502360_1504538_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.9	0.0e+00
WP_000433856.1|1504551_1505463_+	scaffold protein	NA	A0A1R3Y5R6	Salmonella_virus	100.0	4.9e-161
WP_023241518.1|1505462_1506755_+|coat	coat protein	coat	Q76H21	Enterobacteria_phage	99.1	6.1e-242
WP_023241517.1|1506795_1507356_+	hypothetical protein	NA	E7C9T9	Salmonella_phage	97.8	1.0e-100
WP_023241516.1|1507339_1507840_+	DNA stabilization, phage-associated protein	NA	I6RSF6	Salmonella_phage	99.4	9.3e-90
WP_023241515.1|1507799_1509218_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	97.9	9.0e-271
WP_023241514.1|1509221_1509923_+	hypothetical protein	NA	A0A0M4QWW6	Salmonella_phage	91.0	3.5e-66
WP_023241513.1|1509922_1510378_+	DUF2824 family protein	NA	I6R0L6	Salmonella_phage	100.0	3.0e-87
WP_023241512.1|1510380_1511070_+	hypothetical protein	NA	A0A0M4RTU3	Salmonella_phage	97.8	4.3e-109
WP_023241511.1|1511080_1512553_+	phage DNA ejection protein	NA	B6SCW4	Bacteriophage	57.7	2.2e-115
WP_000275950.1|1514566_1514887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077464452.1|1515346_1515682_+	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	100.0	1.7e-58
WP_001674386.1|1515685_1515883_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	100.0	2.9e-31
WP_000532174.1|1515890_1516142_-	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	98.8	4.1e-38
WP_023241509.1|1516277_1518134_+	hypothetical protein	NA	I6S5Y0	Salmonella_phage	99.8	0.0e+00
WP_001749026.1|1518196_1519366_-|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	100.0	3.7e-230
WP_000377772.1|1519679_1520621_-	membrane protein	NA	E7DYY8	Enterobacteria_phage	88.2	1.4e-147
1519367:1519545	attR	GTGGGCATAAATCCGTGGTCATTTTAACATGTGCCCACAATATGCCCGCATTAATGTGCGGCAGTCAACGATCCGCTACGAACGTCTAAGAACTTATTTTTGGTATAAGTAGTGATTATAAAGGGGATTCTAGAACTGTAACGAACGAGGAAGAACTGAAAAGTGGTGTCCCCTGCAGG	NA	NA	NA	NA
>prophage 2
NZ_CP019177	Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 chromosome, complete genome	4805448	1761754	1770925	4805448	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1761754_1762702_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|1762685_1763417_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1763397_1763505_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1763564_1764296_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1764518_1766204_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1766200_1766920_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1766966_1767434_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_023242134.1|1767490_1768021_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1768192_1768651_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023242133.1|1768891_1770925_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 3
NZ_CP019177	Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 chromosome, complete genome	4805448	1850514	1861020	4805448		Enterobacteria_phage(37.5%)	9	NA	NA
WP_023242358.1|1850514_1851918_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.3	4.0e-21
WP_000981469.1|1852095_1852989_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_023242359.1|1853365_1854448_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_023242360.1|1854450_1855350_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_023224546.1|1855397_1856276_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	3.0e-107
WP_072103223.1|1856276_1856828_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000648783.1|1857822_1858596_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|1858600_1859680_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126351.1|1859706_1861020_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 4
NZ_CP019177	Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 chromosome, complete genome	4805448	1960583	1967817	4805448		Morganella_phage(33.33%)	8	NA	NA
WP_000394196.1|1960583_1961003_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001728934.1|1961005_1962274_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	3.2e-227
WP_000208509.1|1962728_1962941_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1962951_1963140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242492.1|1963398_1964577_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	1.1e-109
WP_023242493.1|1965226_1965538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023242494.1|1965617_1966313_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	4.7e-07
WP_052894936.1|1966386_1967817_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP019177	Salmonella enterica subsp. enterica serovar Albany str. ATCC 51960 chromosome, complete genome	4805448	4390650	4437694	4805448	plate,tRNA,tail	Burkholderia_phage(36.36%)	49	NA	NA
WP_001182233.1|4390650_4391649_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_023242461.1|4391736_4393047_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4393293_4393809_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4393907_4394117_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4394138_4394252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128113.1|4394248_4395574_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4395752_4396361_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4396469_4396838_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4397008_4399429_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4399527_4400400_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4400413_4400911_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4401091_4402009_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973644.1|4402172_4403531_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4403619_4404729_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4405090_4406281_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382565.1|4406412_4407957_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4407971_4408862_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982752.1|4409027_4409438_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_023242462.1|4409580_4411677_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_023242463.1|4411676_4412414_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_023888164.1|4412410_4413079_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4413112_4413355_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790027.1|4413799_4415449_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4415793_4417143_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4417273_4417621_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4418197_4418485_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_023242464.1|4418487_4419093_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_000777266.1|4419105_4419420_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449438.1|4419578_4420034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875313.1|4420030_4420228_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
WP_023242465.1|4420217_4421645_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	8.9e-194
WP_017441260.1|4421644_4422169_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	1.8e-67
WP_001003641.1|4422220_4422538_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4422497_4422626_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_017441261.1|4422722_4425077_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.5	3.4e-65
WP_017441262.1|4425076_4426030_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269716.1|4426029_4426239_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_017441263.1|4426226_4427270_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.5e-76
WP_000679395.1|4427279_4428002_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4428328_4428691_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|4428687_4429617_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_017441264.1|4429616_4431164_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	5.0e-49
WP_001093501.1|4431326_4431686_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_017441265.1|4431676_4432792_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.7	3.1e-101
WP_000359503.1|4432784_4433417_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_023242466.1|4433419_4435165_+|tail	tail fiber domain-containing protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	8.4e-53
WP_031608406.1|4435169_4435775_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_023242468.1|4435771_4436227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587743.1|4436965_4437694_+	hypothetical protein	NA	A0A292GAQ8	Xanthomonas_phage	28.2	3.5e-13
