The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012344	Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708, complete genome	4824322	87386	102716	4824322		Enterobacteria_phage(75.0%)	13	NA	NA
WP_023262402.1|87386_90254_-	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.3	1.5e-94
WP_000984806.1|90328_90946_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_052894590.1|92884_95218_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.8	0.0e+00
WP_000743150.1|95232_95553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001216598.1|95549_95777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023237521.1|95773_96325_-	ASH family protein	NA	Q7M2A7	Enterobacteria_phage	71.3	1.0e-33
WP_000149860.1|97127_97865_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_000984209.1|97861_98104_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_023237522.1|98120_98687_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	63.2	3.1e-57
WP_071737793.1|98650_98836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023262400.1|98901_99999_-	serine/threonine protein kinase	NA	A0A2I2L4W4	Orpheovirus	29.0	9.4e-10
WP_023237524.1|100053_101541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023237525.1|101537_102716_-	hypothetical protein	NA	Q7M297	Enterobacteria_phage	94.1	1.6e-212
>prophage 2
NZ_CP012344	Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708, complete genome	4824322	1146516	1211514	4824322	head,capsid,plate,tRNA,holin,terminase,tail,integrase,portal	Salmonella_phage(91.11%)	68	1146354:1146400	1182463:1182509
1146354:1146400	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023237380.1|1146516_1147707_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	48.6	6.7e-102
WP_023237379.1|1147730_1148744_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	94.4	4.4e-187
WP_023237378.1|1148746_1149379_-	phage regulatory protein cI	NA	A0A1S6KZZ7	Salmonella_phage	51.4	6.3e-59
WP_000102105.1|1149500_1149743_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_023237377.1|1149775_1150285_+	hypothetical protein	NA	E5G6L3	Salmonella_phage	95.9	7.8e-84
WP_023237376.1|1150292_1150493_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.2e-32
WP_000963473.1|1150456_1150798_+	hypothetical protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_023237375.1|1150865_1151099_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	96.1	5.4e-32
WP_023232905.1|1151098_1151326_+	hypothetical protein	NA	E5G6L7	Salmonella_phage	97.3	6.0e-36
WP_023237374.1|1151322_1152180_+	retron adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	8.6e-160
WP_023232907.1|1152176_1154576_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.2	0.0e+00
WP_023232908.1|1154744_1154933_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	9.4e-27
WP_023232911.1|1155290_1155710_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_023232912.1|1155979_1156363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023232913.1|1156564_1156900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338835.1|1157421_1157967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023237373.1|1158011_1159052_-|portal	portal vertex-like protein	portal	A0A1S6KZW5	Salmonella_phage	95.6	2.1e-192
WP_053253387.1|1159051_1160818_-	oxidoreductase	NA	A0A1S6KZW3	Salmonella_phage	96.8	0.0e+00
WP_000216276.1|1160960_1161794_+|capsid	phage capsid protein	capsid	E5G6M5	Salmonella_phage	100.0	3.1e-130
WP_023138927.1|1161810_1162875_+|capsid	phage capsid protein	capsid	A0A1S6KZZ3	Salmonella_phage	99.4	2.7e-195
WP_000059172.1|1162878_1163529_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	100.0	2.2e-115
WP_000673535.1|1163622_1164087_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	98.1	4.2e-84
WP_023138925.1|1164086_1164290_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	2.5e-33
WP_023138924.1|1164293_1164509_+|holin	holin family protein	holin	E5G6N0	Salmonella_phage	98.6	1.3e-32
WP_001069919.1|1164489_1164999_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_000731036.1|1165003_1165381_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_001201940.1|1165380_1165806_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	98.6	1.1e-67
WP_001039961.1|1165901_1166333_+|tail	tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_023138923.1|1166325_1166772_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	80.4	1.5e-59
WP_023138922.1|1166790_1167882_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	31.2	1.4e-18
WP_023138921.1|1167904_1168528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001672413.1|1168601_1169180_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	100.0	1.4e-108
WP_000177408.1|1169176_1169536_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	96.6	6.8e-58
WP_023138920.1|1169522_1170431_+|plate	phage baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	99.3	2.2e-158
WP_023237372.1|1170423_1171029_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	7.5e-118
WP_023262363.1|1171025_1172681_+|tail	phage tail fiber protein	tail	A0A1S6KZZ8	Salmonella_phage	98.9	0.0e+00
WP_023138916.1|1172683_1173223_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	97.2	6.1e-95
WP_077908642.1|1173226_1173844_-|tail	phage tail protein	tail	A0A1S6KZY8	Salmonella_phage	98.5	1.4e-111
WP_023262362.1|1173813_1174803_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	95.7	4.3e-187
WP_001165558.1|1174832_1175390_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	98.4	5.5e-99
WP_000046109.1|1175492_1176665_+|tail	tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.7	5.7e-223
WP_001207653.1|1176674_1177190_+|tail	major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_001280967.1|1177244_1177547_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_000763316.1|1177561_1177681_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_023237099.1|1177673_1180481_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.3	0.0e+00
WP_023237098.1|1180477_1180963_+	phage P2 GpU family protein	NA	E5G6Q2	Salmonella_phage	94.4	1.9e-71
WP_023225979.1|1180959_1182060_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.9	1.1e-194
WP_000980499.1|1182128_1182347_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	98.6	1.0e-37
WP_072095627.1|1182898_1184062_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1182463:1182509	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023237097.1|1184069_1186250_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	1.3e-18
WP_000533846.1|1186246_1187656_-	TolC family type I secretion outer membrane protein	NA	NA	NA	NA	NA
WP_023237096.1|1187720_1199195_-	large repetitive protein	NA	NA	NA	NA	NA
WP_001518569.1|1199808_1200291_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242603.1|1200440_1200917_+	ubiquinone-binding protein	NA	NA	NA	NA	NA
WP_001112990.1|1200906_1201197_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1201362_1201701_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1201849_1203511_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1203596_1204475_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001607188.1|1204406_1204601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001518875.1|1204597_1205188_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287923.1|1205222_1205828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519447.1|1205948_1207190_-	membrane protein	NA	NA	NA	NA	NA
WP_001537507.1|1207254_1208046_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_072073170.1|1207991_1208288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000460052.1|1208211_1209573_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1209886_1210135_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1210153_1210702_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1210746_1211514_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP012344	Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708, complete genome	4824322	1474013	1516549	4824322	lysis,protease,terminase,coat,integrase,portal	Salmonella_phage(49.18%)	65	1496579:1496595	1515576:1515592
WP_000716009.1|1474013_1474952_+|protease	outer membrane protease PgtE	protease	NA	NA	NA	NA
WP_024149194.1|1474973_1475204_-	hypothetical protein	NA	C6ZR23	Salmonella_phage	70.0	7.5e-10
WP_053253392.1|1475213_1475417_-	histidine kinase	NA	I6RSG8	Salmonella_phage	98.5	1.0e-31
WP_023241397.1|1475513_1476149_-	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	88.6	9.7e-108
WP_000002107.1|1476219_1476504_-	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	100.0	1.8e-50
WP_077944248.1|1476496_1476949_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	54.4	2.8e-40
WP_053253394.1|1477485_1478226_-	hypothetical protein	NA	H6WRY2	Salmonella_phage	83.6	1.5e-96
WP_000267991.1|1478222_1478516_-	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	100.0	1.5e-50
WP_053253395.1|1478746_1479325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053253396.1|1479321_1479543_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	50.8	4.1e-13
WP_053253397.1|1479539_1480376_-	DNA methyltransferase	NA	Q5QF26	Pseudomonas_virus	50.7	2.0e-68
WP_053253398.1|1480372_1480603_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	98.7	4.3e-34
WP_053253399.1|1480599_1481247_-	hypothetical protein	NA	R9VWB9	Serratia_phage	54.1	5.1e-64
WP_077944241.1|1481243_1481786_-	Eae-like protein	NA	Q5G8U6	Enterobacteria_phage	77.2	7.6e-53
WP_071827193.1|1481782_1481953_-	DUF2737 domain-containing protein	NA	I6S642	Salmonella_phage	98.2	3.0e-24
WP_001111312.1|1481963_1482257_-	hypothetical protein	NA	A0A1R3Y5T7	Salmonella_virus	100.0	3.2e-50
WP_001253476.1|1482303_1482588_-	sigma-70 family RNA polymerase sigma factor	NA	Q76H41	Enterobacteria_phage	100.0	1.4e-45
WP_053253400.1|1482587_1483295_-	recombinase	NA	B8K1D9	Salmonella_phage	89.8	4.5e-122
WP_000156731.1|1483424_1483613_-	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_010835571.1|1483593_1483752_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	98.1	1.8e-23
WP_023217201.1|1483836_1484151_-	Superinfection exclusion protein (protein gp17)	NA	E7C9Q4	Salmonella_phage	100.0	4.2e-56
WP_001083253.1|1484322_1484823_-	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.5	5.2e-32
WP_053253401.1|1484907_1485168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053253402.1|1485437_1485773_-	hypothetical protein	NA	Q5G8T5	Enterobacteria_phage	87.9	1.1e-46
WP_023135942.1|1486123_1486786_-	hypothetical protein	NA	A0A0M4QWY1	Salmonella_phage	100.0	1.7e-126
WP_000067726.1|1486904_1487120_+	XRE family transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_017441422.1|1487227_1487506_+	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	91.3	6.4e-40
WP_042827542.1|1487679_1488513_+	DNA replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.9	1.2e-150
WP_053253403.1|1488509_1489886_+	DNA helicase	NA	A0A192Y673	Salmonella_phage	99.3	4.8e-253
WP_023241107.1|1489959_1490400_+	phage protein NinB	NA	K7PKW7	Enterobacterial_phage	98.6	1.0e-79
WP_001629218.1|1490396_1491269_+	phage NinC	NA	I6R0S6	Salmonella_phage	93.1	6.7e-168
WP_000679699.1|1491265_1491439_+	hypothetical protein	NA	C6ZR56	Salmonella_phage	93.0	7.0e-29
WP_042837728.1|1491405_1491582_+	NinE family protein	NA	I6RSI9	Salmonella_phage	96.6	1.7e-25
WP_042837729.1|1491578_1491755_+	NinF family protein	NA	A0A0M4S6T3	Salmonella_phage	94.8	3.0e-27
WP_001750247.1|1491717_1492014_+	hypothetical protein	NA	A0A0M3ULJ7	Salmonella_phage	100.0	2.0e-47
WP_001539188.1|1492010_1492406_+	hypothetical protein	NA	A0A0M4REJ2	Salmonella_phage	98.5	3.4e-71
WP_000149926.1|1492402_1492606_+	protein ninH	NA	Q5G8R8	Enterobacteria_phage	100.0	7.2e-33
WP_000219135.1|1492586_1492766_+	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	98.3	7.1e-24
WP_042837730.1|1492762_1493386_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	6.8e-114
WP_071883505.1|1493526_1493709_-	hypothetical protein	NA	A0A088CPS7	Enterobacteria_phage	94.9	3.8e-25
WP_000286100.1|1493822_1494026_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_053253515.1|1494003_1494501_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.6	9.3e-90
WP_053253516.1|1494589_1495027_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.9	1.4e-70
WP_000877024.1|1495230_1495761_+	hypothetical protein	NA	B8K1H1	Salmonella_phage	95.5	3.4e-90
WP_017441429.1|1495948_1496329_+	hypothetical protein	NA	Q716B1	Shigella_phage	97.6	1.0e-64
WP_000807788.1|1496432_1496675_+	hypothetical protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
1496579:1496595	attL	CCAGTCAGGCGGCGCTA	NA	NA	NA	NA
WP_053253404.1|1496676_1496856_+	hypothetical protein	NA	A0A2H4A350	Salmonella_phage	98.3	1.1e-24
WP_023235274.1|1496879_1497368_+	DNA packaging protein gp3 (Terminase small subunit)	NA	A0A0M3ULC0	Salmonella_phage	99.4	5.0e-88
WP_053253405.1|1497345_1498845_+|terminase	terminase	terminase	G5DA96	Enterobacteria_phage	99.4	1.5e-305
WP_053253406.1|1498845_1501011_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.3	0.0e+00
WP_053253407.1|1501024_1501936_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	98.7	7.8e-159
WP_001196946.1|1501935_1503231_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	99.3	9.4e-243
WP_023235276.1|1503275_1503512_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	78.4	1.1e-24
WP_053253408.1|1503489_1503990_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.2	5.5e-90
WP_053253409.1|1503990_1505409_+	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	98.1	5.6e-273
WP_053253410.1|1505412_1506051_+	hypothetical protein	NA	A8CGD2	Salmonella_phage	99.5	3.1e-90
WP_053253411.1|1506050_1506506_+	hypothetical protein	NA	Q76H16	Enterobacteria_phage	98.0	3.3e-86
WP_053253412.1|1506508_1507198_+	hypothetical protein	NA	A0A1R3Y5P8	Salmonella_virus	98.7	2.9e-89
WP_053253517.1|1507240_1508542_+	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	98.2	5.6e-235
WP_053253413.1|1508541_1510434_+	hypothetical protein	NA	E7C9U6	Salmonella_phage	79.0	7.8e-246
WP_023198770.1|1510451_1510781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023241086.1|1511020_1512772_+	hypothetical protein	NA	I6S5Y0	Salmonella_phage	87.5	3.0e-58
WP_053253414.1|1512835_1514089_-	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	25.8	5.2e-20
WP_053253415.1|1514124_1515294_-|integrase	integrase	integrase	I6R0M2	Salmonella_phage	99.2	1.0e-227
WP_001590337.1|1515607_1516549_-	transporter protein	NA	E7DYY8	Enterobacteria_phage	87.8	4.1e-147
1515576:1515592	attR	TAGCGCCGCCTGACTGG	NA	NA	NA	NA
>prophage 4
NZ_CP012344	Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708, complete genome	4824322	1917924	1928527	4824322		Morganella_phage(25.0%)	13	NA	NA
WP_001219015.1|1917924_1918398_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_001669246.1|1919045_1919336_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	5.2e-08
WP_000598920.1|1919707_1920505_-	protein MtfA	NA	NA	NA	NA	NA
WP_071786941.1|1920765_1921008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000500831.1|1920985_1921147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1921273_1921693_+	DNA polymerase V subunit UmuD	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457665.1|1921695_1922964_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1923418_1923631_+	cold-shock protein CspJ	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1923641_1923830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023237033.1|1924090_1925287_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.3	6.1e-111
WP_000107435.1|1925936_1926248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377053.1|1926327_1927023_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.7	9.5e-08
WP_001157317.1|1927096_1928527_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 5
NZ_CP012344	Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708, complete genome	4824322	2837426	2896541	4824322	lysis,holin,terminase,tail,integrase,protease	Salmonella_phage(72.22%)	74	2853648:2853662	2896576:2896590
WP_023262235.1|2837426_2839187_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2839255_2839774_+	beta-hydroxydecanoyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_001537784.1|2839873_2840041_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2840296_2840860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433416.1|2840856_2842497_-	paraquat-inducible protein B	NA	NA	NA	NA	NA
WP_000333152.1|2842501_2843755_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_000053044.1|2843769_2845677_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2845689_2847798_-	ribosomal RNA large subunit methyltransferase K/L	NA	NA	NA	NA	NA
WP_000224073.1|2847896_2849006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001220671.1|2849002_2849545_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2849710_2850721_-	dihydroorotate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_023237069.1|2850928_2853541_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.8e-20
2853648:2853662	attL	GCTACATTTTTATAA	NA	NA	NA	NA
WP_000497440.1|2853967_2854174_+	DNA-damage-inducible protein I	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_001842495.1|2854649_2855450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077944242.1|2855478_2855667_-	hypothetical protein	NA	S4TTF2	Salmonella_phage	90.9	1.1e-08
WP_058107135.1|2855840_2856041_+	PagK	NA	NA	NA	NA	NA
WP_052944290.1|2856137_2856716_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	9.8e-91
WP_071883498.1|2856715_2858245_-	hypothetical protein	NA	A0A1B0VFW4	Salmonella_phage	86.6	4.0e-83
WP_023209956.1|2858244_2858925_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	1.1e-128
WP_023209957.1|2858921_2860121_-	bacteriophage protein	NA	A0A0M4RD32	Salmonella_phage	97.5	6.5e-214
WP_053253430.1|2860121_2860475_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	96.6	7.9e-59
WP_023209958.1|2860474_2861230_-	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	92.4	1.0e-127
WP_023209960.1|2861465_2861996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023209961.1|2862002_2862350_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.2	6.8e-23
WP_023209962.1|2862346_2863420_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	93.2	1.6e-187
WP_023209963.1|2863422_2863725_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	99.0	1.6e-52
WP_000353826.1|2863724_2864300_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_053253431.1|2864299_2866309_-	lytic transglycosylase	NA	A0A0M4REK7	Salmonella_phage	99.1	0.0e+00
WP_024131618.1|2866298_2866475_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	72.9	4.7e-12
WP_001669124.1|2866486_2866939_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	81.3	3.2e-65
WP_023209965.1|2866942_2867383_-	DUF3277 domain-containing protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.0	4.6e-56
WP_053253432.1|2867394_2868540_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.1	1.0e-163
WP_053253433.1|2868543_2869089_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	53.0	1.8e-49
WP_053253434.1|2869081_2869486_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	69.2	1.2e-42
WP_053253435.1|2869485_2869995_-	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	40.7	3.8e-22
WP_053253436.1|2869991_2870402_-	DUF4054 domain-containing protein	NA	A0A2H4J1A6	uncultured_Caudovirales_phage	51.9	2.0e-29
WP_053253437.1|2870370_2870739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047602436.1|2870788_2871736_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	54.2	6.1e-98
WP_053253438.1|2871747_2872251_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	46.1	1.2e-31
WP_047602440.1|2872262_2873540_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	42.8	7.2e-78
WP_053253439.1|2873550_2874084_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	54.0	8.8e-46
WP_053253440.1|2874160_2875624_-	hypothetical protein	NA	A0A0M4S6U1	Salmonella_phage	55.9	6.4e-155
WP_053253441.1|2875664_2877083_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.2	2.0e-185
WP_053253442.1|2877048_2877801_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	73.3	5.3e-12
WP_053253443.1|2877902_2878163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053253518.1|2878410_2878860_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	91.8	1.9e-65
WP_000984583.1|2878877_2879330_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
WP_001574216.1|2879313_2879643_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|2879918_2880605_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|2880965_2881415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2881550_2881676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053253444.1|2881849_2882167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047630.1|2882233_2883031_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001617856.1|2883020_2883167_-	hypothetical protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_046593564.1|2883163_2883775_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	97.5	3.0e-90
WP_001241022.1|2883777_2883984_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	98.5	4.6e-35
WP_000929790.1|2883983_2884586_-	hypothetical protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2884620_2884869_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2884985_2885219_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000788825.1|2885693_2886395_-	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.6	8.4e-129
WP_000024046.1|2886391_2887297_-	hypothetical protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_077944243.1|2887388_2887763_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.3e-63
WP_000145711.1|2887728_2887956_-	Rha family transcriptional regulator	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_053253445.1|2887969_2888437_+	transcriptional regulator	NA	K7PHG0	Enterobacteria_phage	86.5	4.2e-68
WP_000439725.1|2888479_2888905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091280.1|2888906_2889341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000438989.1|2889367_2889574_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	9.6e-17
WP_053253446.1|2889970_2890129_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	96.2	4.5e-22
WP_022742800.1|2890150_2890501_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	98.3	6.4e-61
WP_053253447.1|2890627_2893513_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	97.4	0.0e+00
WP_077944244.1|2893475_2894633_+	enterohemolysin	NA	S4TTE8	Salmonella_phage	99.2	8.8e-216
WP_001237031.1|2894675_2894915_+	DUF4060 domain-containing protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2894955_2895204_+	excisionase	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001528853.1|2895200_2896541_+|integrase	integrase	integrase	S4TSP2	Salmonella_phage	100.0	7.2e-262
2896576:2896590	attR	GCTACATTTTTATAA	NA	NA	NA	NA
>prophage 6
NZ_CP012344	Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708, complete genome	4824322	3187396	3207707	4824322	head,capsid,lysis,holin,terminase,tail	Cronobacter_phage(70.59%)	20	NA	NA
WP_053253519.1|3187396_3189037_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	37.9	6.2e-98
WP_053253454.1|3189068_3189632_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	40.9	5.7e-27
WP_053253520.1|3189594_3190275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077944246.1|3191401_3193474_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	42.4	4.3e-56
WP_053253456.1|3193442_3194015_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	54.2	1.3e-55
WP_053253457.1|3194007_3195186_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	61.3	1.3e-137
WP_053253458.1|3195175_3195514_-	DUF2590 domain-containing protein	NA	F1BUK8	Cronobacter_phage	59.0	2.4e-28
WP_053253459.1|3195517_3197599_-|tail	phage tail protein	tail	Q94MY4	Haemophilus_virus	47.8	7.6e-101
WP_053253460.1|3197786_3198059_-	hypothetical protein	NA	A5X9I7	Aeromonas_virus	58.5	2.3e-18
WP_053253461.1|3198112_3198577_-|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	42.5	3.2e-20
WP_053253462.1|3198573_3199020_-	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	65.3	5.7e-46
WP_053253463.1|3199016_3199355_-|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_053253464.1|3199363_3199825_-	DUF2597 domain-containing protein	NA	A0A0U3TH58	Pseudomonas_phage	56.2	8.7e-42
WP_053253465.1|3199828_3201016_-	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	50.5	1.5e-98
WP_053253466.1|3201019_3201751_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	42.0	3.3e-43
WP_053253467.1|3201747_3202227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053253468.1|3202223_3202694_-|head	phage head completion protein	head	F1BUL8	Cronobacter_phage	50.7	1.6e-27
WP_053253469.1|3202799_3203501_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	42.5	1.3e-44
WP_053253470.1|3203512_3204577_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	48.0	1.1e-76
WP_053253471.1|3205883_3207707_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	52.6	8.5e-173
>prophage 7
NZ_CP012344	Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708, complete genome	4824322	4379002	4423935	4824322	tail,plate,tRNA	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182233.1|4379002_4380001_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039335.1|4380088_4381399_-	conjugative transfer protein	NA	NA	NA	NA	NA
WP_000416271.1|4381645_4382161_+	transcriptional regulator Zur	NA	NA	NA	NA	NA
WP_000981150.1|4382260_4382473_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4382491_4382605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4382601_4383927_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_000646079.1|4384105_4384714_-	LexA repressor	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4384822_4385191_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4385361_4387782_+	glycerol-3-phosphate 1-O-acyltransferase	NA	NA	NA	NA	NA
WP_000455249.1|4387880_4388753_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4388766_4389264_-	chorismate--pyruvate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4389444_4390362_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973644.1|4390525_4391884_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4391972_4393082_-	maltose/maltodextrin import ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4393443_4394634_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382570.1|4394765_4396310_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4396324_4397215_+	maltose ABC transporter permease	NA	NA	NA	NA	NA
WP_000982752.1|4397380_4397791_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_023236909.1|4397933_4400030_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_023236910.1|4400029_4400767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824803.1|4400763_4401402_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000976742.1|4401465_4401711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023236911.1|4402151_4403801_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_023236912.1|4404145_4405495_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4405625_4405973_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4406547_4406835_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_020437576.1|4406837_4407443_+	phage lysin	NA	Q5ZQZ1	Pseudomonas_phage	59.9	1.4e-60
WP_000777268.1|4407455_4407770_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	4.9e-20
WP_000875313.1|4408380_4408578_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
WP_023236915.1|4408567_4409995_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.5	3.4e-193
WP_023138088.1|4409994_4410519_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	6.2e-68
WP_053253499.1|4410570_4410888_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4410847_4410976_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_053253500.1|4411072_4413427_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.3	2.9e-64
WP_023236917.1|4413426_4414380_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	51.5	7.9e-37
WP_001269717.1|4414379_4414589_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_023236918.1|4414576_4415620_+	hypothetical protein	NA	Q6QIA2	Burkholderia_phage	45.3	1.5e-76
WP_023236919.1|4415629_4416352_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	5.1e-12
WP_071786937.1|4416360_4416603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000593184.1|4416678_4417041_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703628.1|4417037_4417967_+	glycosyltransferase	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_023236920.1|4417966_4419514_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	8.5e-49
WP_001093501.1|4419677_4420037_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951725.1|4420027_4421143_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	6.9e-101
WP_000359503.1|4421135_4421768_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_023236921.1|4421770_4423231_+|tail	tail fiber domain-containing protein	tail	A0A0M3ULH6	Salmonella_phage	38.8	2.0e-76
WP_000493812.1|4423233_4423935_+	DUF4376 domain-containing protein	NA	X2KPE1	Enterobacteria_phage	38.6	2.1e-23
>prophage 8
NZ_CP012344	Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708, complete genome	4824322	4571695	4608198	4824322	head,plate,capsid,holin,terminase,tail,integrase,portal	Escherichia_phage(40.0%)	46	4571538:4571584	4603573:4603619
4571538:4571584	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001218608.1|4571695_4571950_-	transcriptional regulator	NA	M1SNR2	Escherichia_phage	100.0	1.3e-44
WP_000882949.1|4571995_4573159_-	late control protein D	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000978885.1|4573158_4573638_-|tail	tail assembly protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_000785970.1|4576091_4576211_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4576243_4576519_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|4576575_4577094_-|tail	major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286720.1|4577106_4578297_-|tail	tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
WP_077944247.1|4579787_4580405_+|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	94.4	7.2e-108
WP_053253502.1|4580408_4580948_-|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	88.8	8.8e-86
WP_053253503.1|4580950_4582495_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	50.1	4.4e-154
WP_053253504.1|4582491_4583103_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.0	5.4e-116
WP_001121478.1|4583095_4584004_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_000127163.1|4584008_4584356_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093737.1|4584352_4584988_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
WP_001001780.1|4585054_4585507_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_053253505.1|4585499_4585967_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	1.5e-81
WP_001440152.1|4585929_4586103_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_053253506.1|4586074_4586500_-	protein lysB	NA	U5N3W5	Enterobacteria_phage	95.7	1.4e-65
WP_000736607.1|4586487_4586913_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
WP_053253507.1|4586927_4587425_-	lysozyme	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.5e-92
WP_000123124.1|4587424_4587706_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|4587709_4587913_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|4587912_4588422_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_053253508.1|4588521_4589265_-|terminase	terminase	terminase	U5N091	Enterobacteria_phage	96.8	9.5e-123
WP_001248559.1|4589268_4590342_-|capsid	phage capsid protein	capsid	Q94MD1	Enterobacteria_phage	100.0	5.1e-202
WP_001085976.1|4590400_4591255_-|capsid	capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	96.5	9.0e-133
WP_052908765.1|4591428_4593201_+	oxidoreductase	NA	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_000038161.1|4593200_4594235_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_024160514.1|4594661_4595726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001398851.1|4595722_4596835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053253509.1|4596846_4597518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053253510.1|4597678_4599958_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_000027664.1|4599947_4600223_-	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113264.1|4600219_4600444_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277958.1|4600443_4600746_-	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_053253511.1|4600745_4600970_-	DUF2732 domain-containing protein	NA	S4TP68	Salmonella_phage	95.9	4.4e-31
WP_053253512.1|4601033_4601534_-	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	5.9e-92
WP_001308179.1|4601703_4601976_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4602112_4602406_+	transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4602475_4603456_+|integrase	integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|4603641_4604142_-	repressor CpxP	NA	NA	NA	NA	NA
4603573:4603619	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4604292_4604991_+	DNA-binding response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4604987_4606361_+	two-component system sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133441.1|4606411_4606807_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_077910795.1|4606818_4607571_-	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_023237330.1|4607577_4608198_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	3.2e-63
>prophage 1
NZ_CP012345	Salmonella enterica subsp. enterica serovar Choleraesuis str. ATCC 10708 plasmid pCFSAN000679_01, complete sequence	119113	84617	92323	119113	transposase	Sodalis_phage(16.67%)	7	NA	NA
WP_000728920.1|84617_85559_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	55.0	1.4e-73
WP_000427676.1|85973_87179_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.3	1.5e-162
WP_001541561.1|87175_88153_+	chromosome partitioning protein ParB	NA	A0A1B0V750	Salmonella_phage	53.2	5.2e-84
WP_053253578.1|88234_89509_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	64.2	6.6e-156
WP_053253579.1|89508_89931_-	peptidase	NA	A0A1W6JNS2	Morganella_phage	51.6	1.7e-28
WP_077944255.1|90441_90912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000088645.1|91642_92323_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.6e-28
