The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019178	Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 chromosome, complete genome	4660922	1095298	1158393	4660922	capsid,plate,tRNA,tail,integrase,terminase,portal,head	Salmonella_phage(88.1%)	62	1095132:1095181	1129403:1129452
1095132:1095181	attL	TTATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023232902.1|1095298_1096324_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	99.7	1.3e-202
WP_000616878.1|1096327_1096960_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	100.0	1.1e-116
WP_000102102.1|1097079_1097322_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.1e-38
WP_023232903.1|1097354_1097864_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	98.8	3.1e-88
WP_000956168.1|1097871_1098072_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	100.0	3.2e-33
WP_000963480.1|1098035_1098377_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_023232904.1|1098444_1098678_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	93.5	1.0e-30
WP_023232905.1|1098677_1098905_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	6.0e-36
WP_023232906.1|1098901_1099759_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	3.0e-160
WP_023232907.1|1099755_1102155_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	95.2	0.0e+00
WP_023232908.1|1102323_1102512_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	9.4e-27
WP_023232911.1|1102869_1103289_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023232912.1|1103558_1103942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023232913.1|1104143_1104479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818975.1|1105045_1106827_+	DUF262 domain-containing protein	NA	K4F7C3	Cronobacter_phage	27.3	8.7e-05
WP_000517631.1|1106868_1107882_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	94.1	5.2e-180
WP_023232914.1|1107881_1109648_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	95.7	0.0e+00
WP_023184686.1|1109790_1110624_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	99.6	1.2e-129
WP_000730755.1|1110640_1111723_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.7	1.6e-190
WP_023184685.1|1111726_1112380_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.2	1.3e-112
WP_023184684.1|1112473_1112938_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	91.6	9.9e-78
WP_023232915.1|1112937_1113141_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	4.2e-33
WP_000171565.1|1113144_1113360_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069919.1|1113340_1113850_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_000731036.1|1113854_1114232_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_024148543.1|1114228_1114663_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	97.2	8.2e-66
WP_023232917.1|1114758_1115190_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	1.9e-75
WP_023232918.1|1115182_1115629_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	91.1	7.6e-67
WP_023232919.1|1115697_1116276_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.0	1.1e-107
WP_023232920.1|1116272_1116632_+|plate,tail	base plate tail-like protein	plate,tail	E5G6N7	Salmonella_phage	95.8	2.3e-58
WP_001655641.1|1116618_1117527_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.3	3.5e-159
WP_023232921.1|1117519_1118125_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.5	4.9e-117
WP_023232922.1|1118121_1119741_+|tail	phage tail fiber protein	tail	E5G6P0	Salmonella_phage	91.5	3.2e-155
WP_000006337.1|1119747_1120155_+|tail	tail assembly protein	tail	A0A1B0V844	Salmonella_phage	84.2	4.1e-59
WP_000161708.1|1120352_1121075_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000388790.1|1121288_1121507_+	Hin recombinase	NA	A0A1S6L009	Salmonella_phage	90.3	1.4e-29
WP_023232923.1|1121609_1122782_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	1.3e-222
WP_001207653.1|1122791_1123307_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	99.4	2.7e-92
WP_023232924.1|1123361_1123664_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	7.2e-45
WP_000763317.1|1123678_1123798_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_000980409.1|1126594_1127080_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_023232927.1|1127076_1128177_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	97.3	1.3e-189
WP_000972388.1|1128243_1128462_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	76.4	8.3e-27
WP_023232928.1|1128746_1129337_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	76.7	2.3e-47
WP_072101562.1|1129841_1131005_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1129403:1129452	attR	TTATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_023232929.1|1131012_1133193_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_000533867.1|1133189_1134599_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_023232930.1|1134663_1146138_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1146752_1147235_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242604.1|1147384_1147861_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1147850_1148141_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1148302_1148641_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1148789_1150451_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059160.1|1150536_1151415_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1151537_1152128_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023232931.1|1152162_1152768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1152888_1154175_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1154194_1154986_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1155151_1156513_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1156765_1157014_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1157032_1157581_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1157625_1158393_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP019178	Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 chromosome, complete genome	4660922	1555802	1611400	4660922	capsid,lysis,plate,protease,tail,integrase,holin,terminase,head	Salmonella_phage(62.22%)	69	1552331:1552346	1615531:1615546
1552331:1552346	attL	CGCGCAGCAGGCGCTG	NA	NA	NA	NA
WP_001550295.1|1555802_1556297_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228072.1|1556710_1557202_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260056.1|1557191_1557455_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778099.1|1557451_1559938_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091679.1|1559944_1560640_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013481.1|1560626_1561496_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1561611_1562061_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1562070_1562673_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888532.1|1562693_1563311_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	6.9e-10
WP_000990033.1|1563307_1563967_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_023233396.1|1564018_1564756_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1564752_1564965_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1564961_1565441_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_023215043.1|1565437_1567369_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828299.1|1567365_1567923_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_076031635.1|1567919_1568963_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115500.1|1569006_1569654_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281871.1|1570472_1571036_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001110923.1|1571228_1571432_-	DinI-like family protein	NA	NA	NA	NA	NA
WP_023233249.1|1572017_1572827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023233250.1|1573035_1574214_-|integrase	site-specific integrase	integrase	A0A2D1GN00	Marinobacter_phage	29.8	2.6e-29
WP_001096408.1|1574216_1574426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023233251.1|1575200_1575434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001020640.1|1575651_1576347_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_001191666.1|1576444_1576669_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509727.1|1576697_1577252_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	5.9e-101
WP_031607341.1|1577248_1578391_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	99.2	6.4e-211
WP_024148566.1|1578608_1579583_+	GntR family transcriptional regulator	NA	U5P0A0	Shigella_phage	79.6	1.2e-117
WP_001669427.1|1579584_1580067_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
WP_023233161.1|1580066_1580720_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	88.4	1.4e-114
WP_000779150.1|1580716_1581106_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	86.0	2.4e-61
WP_023233162.1|1581122_1581983_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	99.3	9.2e-162
WP_024148567.1|1581990_1582980_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.2	1.3e-191
WP_000595052.1|1582994_1583267_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	77.6	9.4e-28
WP_023233164.1|1583263_1584100_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	77.0	7.7e-121
WP_000057291.1|1584403_1585099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000658036.1|1585402_1585591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294873.1|1585680_1586070_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_000226307.1|1586056_1586338_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_023233165.1|1586337_1586952_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	82.8	1.1e-95
WP_050955063.1|1586984_1587431_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	83.9	9.3e-57
WP_023233167.1|1587759_1588263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023137451.1|1588330_1588675_+	HNH endonuclease	NA	K7P7P6	Enterobacteria_phage	73.9	3.9e-47
WP_000919034.1|1588807_1589272_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	62.1	1.3e-48
WP_078052818.1|1589225_1590968_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	44.5	9.1e-140
WP_023233170.1|1592284_1593133_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	88.6	2.6e-132
WP_023233171.1|1593142_1594360_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	88.6	1.3e-198
WP_023233172.1|1594403_1594592_+	hypothetical protein	NA	K7PHI6	Enterobacteria_phage	57.6	1.7e-12
WP_000886224.1|1594591_1594915_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	57.4	2.2e-31
WP_023171044.1|1594926_1595340_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	74.8	6.0e-50
WP_023233173.1|1595311_1595824_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	87.1	6.2e-81
WP_023233174.1|1595820_1596381_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	89.8	8.8e-97
WP_023233175.1|1596384_1596549_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	98.1	3.8e-24
WP_023233176.1|1596538_1598035_+|tail	bacteriophage Mu tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	99.8	1.0e-277
WP_000515952.1|1598034_1598391_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1598387_1598714_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_023233177.1|1598798_1600727_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.7	0.0e+00
WP_023233178.1|1600760_1602101_+	hypothetical protein	NA	A0A192Y5U9	Salmonella_phage	98.9	1.1e-249
WP_023233179.1|1602097_1603156_+|tail	phage tail protein	tail	A0A192Y7L7	Salmonella_phage	99.1	3.6e-200
WP_001273652.1|1603155_1603689_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	98.3	5.5e-96
WP_000605051.1|1603693_1604107_+	hypothetical protein	NA	A0A192Y6D0	Salmonella_phage	100.0	3.1e-75
WP_023233180.1|1604099_1605179_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	98.1	5.1e-202
WP_023233181.1|1605181_1605769_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	98.5	4.1e-113
WP_050938715.1|1605755_1606997_+	hypothetical protein	NA	A0A1C9II52	Salmonella_phage	96.3	2.7e-53
WP_001215679.1|1606999_1607527_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1607904_1608348_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1608401_1610231_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1610578_1610869_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_078052820.1|1610896_1611400_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	70.5	3.6e-49
1615531:1615546	attR	CAGCGCCTGCTGCGCG	NA	NA	NA	NA
>prophage 3
NZ_CP019178	Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 chromosome, complete genome	4660922	1682816	1691987	4660922	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1682816_1683764_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1683747_1684479_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1684459_1684567_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1684626_1685358_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023233189.1|1685580_1687266_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.9e-278
WP_000598637.1|1687262_1687982_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1688028_1688496_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_023137005.1|1688552_1689083_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703136.1|1689254_1689713_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_000195336.1|1689953_1691987_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP019178	Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 chromosome, complete genome	4660922	1759209	1769716	4660922		Enterobacteria_phage(37.5%)	10	NA	NA
WP_023233203.1|1759209_1760613_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	1.5e-20
WP_000981469.1|1760790_1761684_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697846.1|1762060_1763146_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_015405858.1|1763145_1764045_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	6.7e-30
WP_015405859.1|1764092_1764971_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.7e-108
WP_000973709.1|1764971_1765523_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_001528498.1|1765528_1766503_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648785.1|1766518_1767292_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_023233204.1|1767296_1768376_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	2.3e-16
WP_023233205.1|1768402_1769716_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP019178	Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 chromosome, complete genome	4660922	1852262	1859515	4660922		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1852262_1852682_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457657.1|1852684_1853953_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.9	2.4e-227
WP_000208509.1|1854407_1854620_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1854630_1854819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023233037.1|1855078_1856275_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.9	1.3e-110
WP_000107430.1|1856924_1857224_+	membrane protein	NA	NA	NA	NA	NA
WP_000377042.1|1857315_1858011_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001655552.1|1858084_1859515_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP019178	Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 chromosome, complete genome	4660922	1962192	1970794	4660922	tail,integrase	Salmonella_phage(28.57%)	11	1956636:1956650	1966910:1966924
1956636:1956650	attL	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000856225.1|1962192_1962423_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1962560_1962935_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_023233025.1|1962935_1963811_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1963827_1964181_+	YebY family protein	NA	NA	NA	NA	NA
WP_072208045.1|1964554_1965409_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.3	3.8e-75
WP_077910066.1|1965468_1965963_-	RecE	NA	A0A0U2I1R6	Escherichia_phage	68.9	1.1e-21
WP_001014089.1|1966152_1966440_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.1	1.9e-39
WP_001529209.1|1966436_1966970_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	42.4	1.6e-10
1966910:1966924	attR	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000789530.1|1967226_1967394_-	lytic enzyme	NA	NA	NA	NA	NA
WP_023233022.1|1967696_1968188_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	3.8e-43
WP_071785322.1|1970293_1970794_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	78.0	6.7e-64
>prophage 7
NZ_CP019178	Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 chromosome, complete genome	4660922	2142025	2148687	4660922		Salmonella_phage(33.33%)	9	NA	NA
WP_000230462.1|2142025_2142832_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2142833_2143826_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2143825_2144716_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001605114.1|2145538_2146261_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
WP_001096568.1|2146731_2146914_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	77.6	1.0e-22
WP_001605117.1|2147163_2147304_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
WP_001605118.1|2147342_2147642_+	putative pertussis-like toxin subunit	NA	A0A0U2KD26	Escherichia_phage	54.3	3.2e-13
WP_000727928.1|2147568_2147994_+	peptidase	NA	NA	NA	NA	NA
WP_077905325.1|2148372_2148687_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 8
NZ_CP019178	Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 chromosome, complete genome	4660922	2622421	2629626	4660922		Escherichia_phage(42.86%)	8	NA	NA
WP_000497451.1|2622421_2622661_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_015405983.1|2622878_2623043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2623540_2624350_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2624422_2624800_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2624947_2625490_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_000733298.1|2625682_2626411_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.2e-61
WP_023232966.1|2626427_2626841_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	5.5e-19
WP_072102280.1|2629461_2629626_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	9.6e-20
>prophage 9
NZ_CP019178	Salmonella enterica subsp. enterica serovar Chester str. ATCC 11997 chromosome, complete genome	4660922	2789695	2888709	4660922	capsid,lysis,protease,tRNA,tail,integrase,holin,terminase,portal,head	Enterobacteria_phage(31.48%)	94	2813857:2813873	2893250:2893266
WP_000374046.1|2789695_2790355_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2790441_2790771_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2790767_2791049_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2791097_2791877_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859418.1|2791902_2792451_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2792665_2793877_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2793934_2794252_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2794296_2794710_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|2794883_2795546_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2795640_2796099_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_023233084.1|2796134_2798189_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.3	2.5e-19
WP_001261222.1|2798312_2798759_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_023215050.1|2798777_2800931_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2800917_2801523_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2801739_2802249_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001562588.1|2802605_2803658_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2803729_2804182_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156458.1|2804367_2806128_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2806196_2806715_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2806815_2806983_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2807238_2807802_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_023233085.1|2807798_2809439_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333143.1|2809443_2810697_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053043.1|2810711_2812619_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086481.1|2812631_2814740_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
2813857:2813873	attL	CTCAGTTGCGCCACATC	NA	NA	NA	NA
WP_023212160.1|2814838_2815948_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2815944_2816487_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2816652_2817663_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193768.1|2817870_2820483_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.5	1.8e-19
WP_000497441.1|2820909_2821101_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_023233086.1|2821371_2822058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023233087.1|2822417_2823044_+	hypothetical protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	64.8	2.4e-66
WP_023233089.1|2823515_2824484_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	98.4	1.3e-191
WP_023204074.1|2824629_2824962_+|tail	phage tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	63.4	4.4e-19
WP_000421115.1|2825604_2826123_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	51.4	2.5e-45
WP_023233090.1|2826137_2828816_-|tail	side tail fiber protein	tail	A0A1B0VFW4	Salmonella_phage	62.8	1.0e-145
WP_000178849.1|2828869_2829112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077906598.1|2829150_2830026_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.8	2.6e-50
WP_001576012.1|2832572_2833277_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	63.1	2.4e-67
WP_000606353.1|2833174_2833912_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	1.8e-113
WP_001152416.1|2833921_2834617_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2834706_2835240_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2835356_2835854_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_020899435.1|2835952_2836285_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	4.4e-35
WP_023233091.1|2836281_2839374_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	57.7	2.6e-270
WP_001175132.1|2839357_2839660_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	58.6	2.8e-25
WP_000478854.1|2839680_2840070_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	58.9	1.5e-31
WP_000126419.1|2840118_2840871_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	70.0	1.9e-94
WP_001032919.1|2840883_2841285_-	hypothetical protein	NA	A0A291AWY2	Escherichia_phage	59.8	8.1e-44
WP_000053601.1|2841284_2841884_-|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	68.7	8.3e-69
WP_000083787.1|2841893_2842250_-|tail	tail attachment protein	tail	K7P6U9	Enterobacteria_phage	58.5	1.8e-31
WP_000448213.1|2842260_2842635_-	DNA breaking-rejoining protein	NA	A0A2R9YJP4	Escherichia_phage	34.9	4.8e-06
WP_001048356.1|2842698_2843727_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	58.4	2.4e-108
WP_000143301.1|2843781_2844129_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	4.6e-19
WP_023233092.1|2844128_2845643_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	51.8	2.1e-100
WP_000820305.1|2845632_2847219_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	6.4e-185
WP_000224407.1|2847215_2847419_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	80.0	1.0e-18
WP_021000150.1|2847402_2849337_-|terminase	phage terminase large subunit family protein	terminase	E4WL19	Enterobacteria_phage	66.1	7.0e-258
WP_000867564.1|2849308_2849854_-|terminase	terminase small subunit	terminase	K7P7G0	Enterobacteria_phage	61.3	4.5e-53
WP_024135843.1|2850322_2850769_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	89.7	7.1e-65
WP_000984585.1|2850786_2851239_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.4e-79
WP_001574216.1|2851222_2851552_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_023233093.1|2851820_2852507_+	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM2	Phage_Gifsy-1	98.2	1.5e-130
WP_000657897.1|2852721_2852910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097243.1|2853399_2854089_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	50.2	5.3e-59
WP_000801757.1|2854085_2854226_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_023233094.1|2854222_2854834_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.0	9.3e-92
WP_000929790.1|2855042_2855645_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_000972673.1|2855707_2856013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001237395.1|2856644_2858624_-	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	46.3	1.9e-162
WP_023139984.1|2859020_2860151_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000089415.1|2860437_2860833_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
WP_157872077.1|2860845_2861388_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	74.8	7.1e-67
WP_023233096.1|2862352_2862847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033911.1|2862833_2863088_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574209.1|2863186_2863585_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001525799.1|2864015_2864195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023233097.1|2864625_2864910_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_023233098.1|2865456_2868636_+	gifsy-1 prophage RecE	NA	S4TNL0	Salmonella_phage	69.2	0.0e+00
WP_001539618.1|2868598_2869756_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2869798_2870038_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2870078_2870327_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2870371_2871664_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000191405.1|2871858_2873061_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117867.1|2873229_2874630_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
WP_000977709.1|2875236_2876328_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_000462653.1|2876512_2877703_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109471.1|2877764_2878412_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000357052.1|2878439_2878988_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_000925894.1|2879247_2881095_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_023233099.1|2881439_2885906_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000060025.1|2885905_2886610_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288828.1|2886590_2887913_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001154025.1|2887905_2888709_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
2893250:2893266	attR	CTCAGTTGCGCCACATC	NA	NA	NA	NA
