The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019181	Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 chromosome, complete genome	4865682	460978	566528	4865682	tRNA,terminase,protease,tail,integrase,plate,holin,portal	Vibrio_phage(19.23%)	101	493575:493591	570449:570465
WP_001285165.1|460978_461926_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
WP_000114987.1|461941_462451_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	6.7e-19
WP_023228063.1|462582_463707_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000460663.1|463678_464152_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_001129708.1|464178_464721_+	DNA topoisomerase	NA	NA	NA	NA	NA
WP_001063613.1|464725_465298_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	A0A291ATS8	Pandoravirus	27.3	9.9e-11
WP_000451202.1|465302_466121_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001070571.1|466117_466375_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_001626875.1|466350_466905_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_000795911.1|467018_467171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000825645.1|473537_473759_-	membrane protein	NA	NA	NA	NA	NA
WP_001273283.1|473995_477109_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_000160383.1|477120_478278_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001085718.1|478691_479354_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_023228466.1|479356_481456_-	bifunctional diguanylate cyclase/phosphodiesterase	NA	G3MA91	Bacillus_virus	33.5	7.1e-22
WP_000620015.1|481606_481771_-	DUF2556 family protein	NA	NA	NA	NA	NA
WP_000642611.1|481853_482738_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.8	1.3e-25
WP_023228467.1|483201_484428_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	61.0	5.9e-154
WP_023228468.1|484427_485078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023228469.1|485688_485973_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_023228470.1|485993_486644_+	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	47.9	1.4e-21
WP_023228471.1|486708_486894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228472.1|487081_487354_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_023228473.1|487515_487914_+	DNA primase	NA	A0A286SGR4	Klebsiella_phage	54.2	1.1e-11
WP_023228475.1|488069_488297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023228476.1|488289_488643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023228477.1|488635_489388_+	hypothetical protein	NA	A0A0P0ZD96	Stx2-converting_phage	76.7	2.1e-29
WP_023228478.1|489384_489690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023228479.1|489779_490163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023228480.1|490155_490803_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	39.0	3.6e-33
WP_023228481.1|490813_492955_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.4	1.5e-192
WP_023228482.1|492951_493347_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_023228483.1|493390_494383_+	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	52.1	6.0e-72
493575:493591	attL	CGGAACTGGCGACGATT	NA	NA	NA	NA
WP_070793455.1|494467_495304_+	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	83.3	6.7e-125
WP_071604142.1|496265_496820_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	64.5	3.0e-49
WP_023228137.1|496746_497172_+	subtilase	NA	NA	NA	NA	NA
WP_001623349.1|497483_497873_+	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	71.8	1.1e-40
WP_023228136.1|497859_498141_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	79.6	1.3e-35
WP_023228135.1|498140_498767_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	78.3	1.3e-91
WP_023228134.1|498763_499306_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_023136440.1|499408_499912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024148291.1|500184_500901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001623372.1|501409_502000_+	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	56.5	1.5e-38
WP_024148290.1|501999_502551_+	hypothetical protein	NA	A0A067ZIZ9	Vibrio_phage	38.2	1.6e-18
WP_023228132.1|502556_504416_+|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	63.7	1.3e-232
WP_021000635.1|504427_504667_+	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	54.8	6.8e-14
WP_023228131.1|504663_506226_+|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	64.3	1.8e-187
WP_001623382.1|506218_507283_+|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	48.6	1.7e-80
WP_001623384.1|507293_507680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076018216.1|508734_509040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001623387.1|509200_509545_+	hypothetical protein	NA	A0A067ZJA6	Vibrio_phage	43.9	1.0e-18
WP_021000628.1|509541_510027_+	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	36.0	8.4e-19
WP_001623389.1|510026_510326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076018217.1|512877_513294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001623395.1|515235_515454_+	hypothetical protein	NA	A0A0C5AEF4	Bacteriophage	50.0	3.2e-10
WP_001623396.1|515443_516445_+	phage late control D	NA	A0A0C5AJ59	Bacteriophage	36.3	1.8e-55
WP_001623397.1|516445_517066_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	55.9	1.3e-32
WP_001623398.1|517062_517530_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_021000619.1|517526_517850_+	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	41.3	6.0e-13
WP_023228127.1|517846_518971_+|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	43.9	3.0e-88
WP_023228126.1|518963_519545_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	34.1	7.7e-19
WP_149866814.1|520475_521795_+|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	79.6	3.8e-183
WP_023228124.1|521807_522338_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	97.1	4.3e-93
WP_024148288.1|523284_523710_+	subtilase	NA	NA	NA	NA	NA
WP_001623421.1|523725_524457_+	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	51.2	1.9e-59
WP_023228121.1|524657_525200_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	65.4	4.0e-70
WP_023228120.1|525376_525742_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.2	9.4e-15
WP_001623424.1|525902_526712_-	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	47.0	1.6e-59
WP_001623427.1|527409_527634_-	DinI family protein	NA	K7PKR6	Enterobacteria_phage	88.6	3.8e-27
WP_001160725.1|527962_528286_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000645852.1|528282_529113_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.7	1.3e-08
WP_000866905.1|529109_530123_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023228157.1|530218_531652_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566347.1|531662_532664_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001623438.1|532702_534421_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.4	1.3e-29
WP_023210713.1|534578_535547_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458785.1|535558_537211_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_001623439.1|537354_538254_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_000599763.1|538455_540114_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001617140.1|540110_541061_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_001201751.1|541206_542325_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_000125877.1|542321_544268_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_000447499.1|544397_544619_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|544942_545263_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_001623444.1|545293_547570_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001623499.1|547782_547980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228156.1|548141_548519_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	41.0	1.2e-20
WP_000097893.1|549186_549864_-	hydrolase	NA	NA	NA	NA	NA
WP_000809969.1|549883_550744_-	pirin family protein	NA	NA	NA	NA	NA
WP_000597928.1|550852_551764_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001040187.1|551854_552073_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001611348.1|552000_552384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001241640.1|552384_553089_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202249.1|553133_554855_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	23.3	1.9e-12
WP_001044531.1|554855_556622_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.1	6.0e-22
WP_023228155.1|556736_557705_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	6.5e-63
WP_000228469.1|558251_558746_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_024148295.1|558880_562870_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.8e-88
WP_001519746.1|563012_563624_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067785.1|563633_564977_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.9	1.6e-80
WP_000886697.1|565235_566528_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.5	8.6e-95
570449:570465	attR	CGGAACTGGCGACGATT	NA	NA	NA	NA
>prophage 2
NZ_CP019181	Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 chromosome, complete genome	4865682	598849	663316	4865682	head,tRNA,protease,lysis,terminase,tail,integrase,capsid,holin,portal,transposase	Salmonella_phage(48.0%)	64	600984:600999	635245:635260
WP_001154028.1|598849_599653_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288828.1|599645_600968_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_000060025.1|600948_601653_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
600984:600999	attL	TAAGCTGGCGCAGGCG	NA	NA	NA	NA
WP_023228147.1|601652_606119_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_023228146.1|606463_608305_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000357052.1|608564_609113_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	1.2e-05
WP_001109471.1|609140_609788_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462653.1|609849_611040_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977709.1|611224_612316_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.7	1.7e-99
WP_023201779.1|612921_614322_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	5.9e-81
WP_000762343.1|614522_614984_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000544849.1|615300_616515_+	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_023228145.1|616760_618197_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000191404.1|618274_619477_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001262307.1|619671_620964_-|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000065276.1|621008_621257_-	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001237031.1|621297_621537_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_001539618.1|621579_622737_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_023228144.1|622699_625900_-	gifsy-1 prophage RecE	NA	S4TNL0	Salmonella_phage	79.4	0.0e+00
WP_014344515.1|626026_626377_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	94.0	2.7e-59
WP_000917561.1|626398_626557_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	96.2	2.6e-22
WP_001009038.1|626955_627360_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	100.0	4.2e-72
WP_000869364.1|627489_627726_+	Cro/Cl family transcriptional regulator	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|627691_628066_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_001191964.1|628339_629401_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	83.0	3.3e-36
WP_000800012.1|629403_630153_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_000113621.1|630163_630511_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	98.3	1.5e-57
WP_000065341.1|630507_630909_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	100.0	2.9e-73
WP_000151011.1|630905_631358_+	ead/Ea22-like family protein	NA	S4TNP2	Salmonella_phage	100.0	3.8e-74
WP_000208070.1|631354_632164_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	100.0	4.5e-158
WP_001217670.1|632683_632923_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	3.9e-38
WP_023228142.1|633256_633859_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	1.7e-109
WP_001096553.1|634067_634679_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	2.7e-91
WP_000801757.1|634675_634816_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097240.1|634812_635502_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	52.4	1.1e-59
635245:635260	attR	CGCCTGCGCCAGCTTA	NA	NA	NA	NA
WP_000657897.1|635991_636180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110787.1|636394_637081_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	99.6	3.6e-132
WP_001574216.1|637356_637686_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984583.1|637669_638122_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
WP_031606933.1|638139_638586_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	88.4	1.1e-62
WP_000669689.1|638812_639214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102152.1|639499_640045_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	79.9	1.9e-56
WP_076018218.1|640016_641948_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	4.8e-259
WP_000201415.1|641931_642135_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_001623362.1|642131_643712_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.6	2.8e-188
WP_023226259.1|643701_645198_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.7	4.3e-98
WP_000011260.1|645210_645558_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001623560.1|645612_646641_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
WP_000201485.1|646698_647064_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083292.1|647074_647458_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.2e-28
WP_000817265.1|647490_648621_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	98.1	4.0e-213
WP_000677089.1|648729_649308_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000033885.1|649304_649706_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|649713_650460_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|650510_650906_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|650902_651241_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_001623563.1|651212_654308_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.4e-276
WP_000447370.1|654310_654640_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_001156291.1|654649_655348_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	4.6e-103
WP_000662736.1|655354_656092_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	4.0e-129
WP_000246124.1|655989_656637_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
WP_076018219.1|656698_660103_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	75.3	0.0e+00
WP_023228166.1|660146_662777_+|tail	side tail fiber protein	tail	A0A1B0VFW4	Salmonella_phage	64.2	1.8e-152
WP_108426318.1|662854_663316_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	84.7	4.2e-68
>prophage 3
NZ_CP019181	Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 chromosome, complete genome	4865682	737443	746614	4865682	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|737443_738391_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_000824854.1|738374_739106_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|739086_739194_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|739253_739985_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|740207_741893_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|741889_742609_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001624991.1|742655_743123_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	89.7	8.8e-74
WP_001197951.1|743179_743710_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_001624990.1|743881_744340_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	1.6e-51
WP_023228437.1|744580_746614_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
>prophage 4
NZ_CP019181	Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 chromosome, complete genome	4865682	924765	975919	4865682	head,terminase,protease,tail,integrase,plate,capsid,holin,portal	Salmonella_phage(70.0%)	69	917729:917744	954982:954997
917729:917744	attL	GCGGCAGCAACCGTCG	NA	NA	NA	NA
WP_023228394.1|924765_926034_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.4	1.8e-76
WP_001736108.1|926697_926988_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
WP_000598920.1|927359_928157_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|928448_929438_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_000414876.1|929439_929682_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	9.5e-40
WP_023228393.1|929706_930276_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	99.5	1.2e-109
WP_024148319.1|930279_930981_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	59.9	3.6e-79
WP_020898896.1|930985_931345_-	hypothetical protein	NA	A0A1L7N114	Ralstonia_phage	49.1	2.1e-22
WP_023228391.1|931344_931884_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	71.3	1.5e-64
WP_000008351.1|931954_932494_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_053299710.1|932630_933458_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	7.1e-151
WP_000997190.1|933515_933887_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_000141749.1|934183_934414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023228487.1|934872_935079_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	71.6	7.1e-20
WP_023228488.1|935098_935311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024148333.1|935378_935726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031622327.1|935742_936447_-	hypothetical protein	NA	G8C7U1	Escherichia_phage	59.0	1.2e-66
WP_024148334.1|936553_936817_+	hypothetical protein	NA	H6WRX5	Salmonella_phage	48.4	3.2e-09
WP_000509733.1|936845_937400_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	99.5	2.0e-101
WP_076018222.1|937396_938554_+	peptidase	NA	Q8HA97	Salmonella_phage	97.9	4.8e-214
WP_000620702.1|938550_938775_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_070810380.1|938771_939731_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	80.9	1.6e-117
WP_023171062.1|939732_940215_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.8	1.6e-86
WP_001624543.1|940214_940868_+	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	88.0	7.1e-114
WP_023228498.1|940864_941254_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	86.0	2.1e-60
WP_023228497.1|941270_942131_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	97.9	4.3e-159
WP_070804833.1|942138_943128_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	2.6e-192
WP_023227964.1|943141_943894_+	antitermination protein	NA	Q8SBE4	Shigella_phage	97.2	3.5e-133
WP_001306866.1|944183_944426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162493699.1|944563_944899_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	92.8	2.1e-53
WP_023227966.1|944902_945373_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.4	7.7e-86
WP_024148265.1|945362_945755_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	84.6	1.3e-51
WP_023227967.1|946285_946480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023227968.1|946532_946883_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	8.9e-63
WP_000929191.1|947006_947501_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_000088185.1|947497_949231_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	99.8	0.0e+00
WP_000605609.1|949242_949425_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_023227969.1|949424_950666_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.3	8.5e-241
WP_001193639.1|950643_951294_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000257528.1|951308_952514_+|capsid	phage major capsid protein	capsid	Q8HAD2	Salmonella_phage	100.0	1.6e-223
WP_000601353.1|952564_952765_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|952767_953091_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702409.1|953087_953492_+|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	99.3	5.4e-72
WP_001135697.1|953463_953976_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779215.1|953972_954533_+	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_000497739.1|954536_954701_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_023227970.1|954690_956187_+|tail	bacteriophage Mu tail sheath protein	tail	A0A192Y7L1	Salmonella_phage	99.8	8.0e-278
954982:954997	attR	GCGGCAGCAACCGTCG	NA	NA	NA	NA
WP_000515952.1|956186_956543_+|tail	tail protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|956539_956866_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_023227971.1|956950_958879_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.2	0.0e+00
WP_023227972.1|958912_960253_+|tail	tail/DNA circulation protein	tail	A0A192Y5U9	Salmonella_phage	98.7	2.0e-248
WP_001624460.1|960249_961308_+|tail	phage tail protein	tail	A0A192Y7L7	Salmonella_phage	99.4	6.6e-202
WP_001273647.1|961307_961841_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	99.4	1.9e-96
WP_023227973.1|961845_962259_+	phage protein	NA	Q8HAB8	Salmonella_phage	94.2	1.2e-71
WP_000785580.1|962251_963331_+|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	99.7	2.5e-204
WP_001207832.1|963333_963921_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554737.1|963907_965470_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	100.0	2.6e-287
WP_015701331.1|965439_966039_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_000492926.1|966323_967331_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	100.0	7.9e-197
WP_023227974.1|967543_967765_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	98.6	9.9e-36
WP_001529333.1|968395_968557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|968683_969103_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023227975.1|969105_970374_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.6e-226
WP_000208509.1|970828_971041_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|971051_971240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080668.1|971500_972679_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	57.2	6.6e-110
WP_000107437.1|973328_973640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377042.1|973719_974415_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001623639.1|974488_975919_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP019181	Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 chromosome, complete genome	4865682	1079124	1088354	4865682	integrase,tail	Salmonella_phage(28.57%)	12	1073568:1073582	1084466:1084480
1073568:1073582	attL	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000856224.1|1079124_1079355_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168393.1|1079492_1079867_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_001623761.1|1079867_1080743_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_023227990.1|1080759_1081113_+	YebY family protein	NA	NA	NA	NA	NA
WP_001623770.1|1081495_1082575_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	8.7e-101
WP_023227991.1|1082571_1083678_-	hypothetical protein	NA	Q9QF34	Lambdoid_phage	66.1	1.5e-55
WP_001013467.1|1083708_1083939_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_001050883.1|1083992_1084526_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
1084466:1084480	attR	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000789530.1|1084782_1084950_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001532317.1|1085014_1085203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001623776.1|1085257_1085749_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	55.0	1.1e-39
WP_015675561.1|1087853_1088354_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	78.0	8.8e-64
>prophage 6
NZ_CP019181	Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 chromosome, complete genome	4865682	1874664	1921184	4865682	integrase,protease,terminase,tail	Escherichia_phage(32.5%)	59	1894974:1894987	1921849:1921862
WP_077905582.1|1874664_1874988_-	hypothetical protein	NA	E5G6P3	Salmonella_phage	68.1	3.2e-06
WP_001623600.1|1875202_1876078_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
WP_024148298.1|1876299_1876953_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	68.7	3.8e-75
WP_023228192.1|1877342_1877609_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	86.4	3.7e-37
WP_023228193.1|1877624_1877816_-	DUF2767 family protein	NA	A0A0M4R5C3	Salmonella_phage	97.7	5.8e-16
WP_024148299.1|1877925_1878360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228195.1|1878715_1879315_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	82.9	6.8e-87
WP_024148300.1|1879304_1879541_-	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	50.0	2.8e-20
WP_065304957.1|1879668_1879860_-	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	92.1	7.5e-24
WP_023228196.1|1879856_1881566_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	65.6	7.6e-91
WP_023136425.1|1881562_1882189_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.2	1.3e-91
WP_023228197.1|1882172_1883399_-	hypothetical protein	NA	A0A0U2RJZ0	Escherichia_phage	65.4	2.1e-151
WP_023228198.1|1883395_1883728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228199.1|1883724_1884441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001213276.1|1884437_1885481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000116517.1|1885480_1885756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000011139.1|1885752_1886469_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	36.5	1.0e-28
WP_023228200.1|1886468_1888523_-	hypothetical protein	NA	A0A2R3UAN6	Myoviridae_environmental_samples	35.8	1.7e-20
WP_000268744.1|1888646_1889234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001133547.1|1889233_1889671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001018951.1|1889674_1891069_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	36.8	6.0e-70
WP_001139605.1|1891074_1892013_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	39.5	2.5e-51
WP_031604700.1|1891996_1892407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114360.1|1892424_1892850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001643824.1|1892862_1893348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110972.1|1893412_1894444_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.5	1.5e-73
WP_001262267.1|1894461_1895334_-	hypothetical protein	NA	NA	NA	NA	NA
1894974:1894987	attL	AACCCAGGCGATAA	NA	NA	NA	NA
WP_000860554.1|1895354_1896929_-	NUDIX domain-containing protein	NA	Q6UJ14	Burkholderia_virus	48.6	1.7e-20
WP_023228201.1|1896929_1897805_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.8	1.1e-56
WP_023228202.1|1897776_1899207_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	37.7	9.8e-92
WP_000179871.1|1899206_1900478_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.8	6.1e-85
WP_023228203.1|1900467_1901439_-|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	32.8	5.0e-23
WP_001288297.1|1901503_1901917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108426293.1|1901977_1902514_-	DUF2514 family protein	NA	A0A193GYI0	Enterobacter_phage	32.0	1.4e-11
WP_023228205.1|1902495_1903035_-	lysozyme	NA	H6WRZ4	Salmonella_phage	98.9	4.4e-101
WP_023228207.1|1903851_1904430_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	50.3	1.7e-42
WP_023228208.1|1904426_1904720_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	64.2	1.4e-32
WP_023228209.1|1904716_1905313_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	72.7	3.2e-81
WP_000474096.1|1905381_1905573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129735.1|1905756_1906095_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_023228210.1|1906094_1908068_-	hypothetical protein	NA	H9C171	Pectobacterium_phage	54.2	3.1e-205
WP_023228211.1|1908064_1908820_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.1	9.9e-67
WP_023228212.1|1908816_1909419_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	2.3e-98
WP_000918618.1|1909411_1909660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228213.1|1909663_1910344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031609362.1|1910382_1911777_-	replicative DNA helicase	NA	Q76H51	Enterobacteria_phage	47.4	5.2e-106
WP_023228215.1|1911785_1912766_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	79.6	5.2e-44
WP_023228216.1|1912768_1912993_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	8.0e-09
WP_024138915.1|1913015_1913462_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	9.4e-25
WP_023228218.1|1913526_1913730_-	transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	46.6	4.0e-07
WP_024142132.1|1913808_1914210_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	55.6	2.5e-37
WP_010835722.1|1914864_1915188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023228220.1|1915195_1915441_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_023228221.1|1915470_1917744_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.3	1.1e-108
WP_023228222.1|1917740_1918295_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.7e-47
WP_000916251.1|1918297_1918480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196402.1|1918692_1918917_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_023228223.1|1918917_1919937_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.2	1.6e-91
WP_000374046.1|1920524_1921184_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
1921849:1921862	attR	AACCCAGGCGATAA	NA	NA	NA	NA
>prophage 7
NZ_CP019181	Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 chromosome, complete genome	4865682	1935195	2024849	4865682	head,protease,tail,terminase,capsid,holin,portal,transposase	Salmonella_phage(33.33%)	100	NA	NA
WP_001623584.1|1935195_1936956_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|1937024_1937543_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|1937642_1937810_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|1938065_1938629_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|1938625_1940266_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|1940270_1941524_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|1941538_1943446_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|1943458_1945567_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_001623556.1|1945665_1946775_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|1946771_1947314_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|1947479_1948490_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_001623553.1|1948697_1951310_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|1951736_1951928_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|1952198_1952885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077911262.1|1952963_1953083_-|tail	phage tail protein	tail	A0A0M4RTP2	Salmonella_phage	68.8	7.5e-06
WP_000480002.1|1953792_1954494_+	T3SS effector NleG family protein	NA	B6DZC0	Enterobacteria_phage	29.2	1.3e-15
WP_001093795.1|1955724_1955937_+	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	92.9	1.6e-27
WP_000842530.1|1955933_1956335_+	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	89.7	4.7e-60
WP_125468752.1|1956395_1956509_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	91.9	1.8e-09
WP_000836775.1|1956582_1956816_+	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	97.4	1.8e-35
WP_023219780.1|1957090_1957732_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_023228228.1|1957902_1958421_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.2	2.3e-46
WP_023228229.1|1958435_1961117_-|tail	side tail fiber protein	tail	A0A1B0VFW4	Salmonella_phage	64.2	2.4e-147
WP_000178853.1|1961172_1961415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070811210.1|1961453_1964816_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000246124.1|1964877_1965525_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
WP_000662736.1|1965422_1966160_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	4.0e-129
WP_001156291.1|1966166_1966865_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	4.6e-103
WP_000447370.1|1966874_1967204_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_001623563.1|1967206_1970302_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.6	1.4e-276
WP_010989052.1|1970273_1970612_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|1970608_1971004_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971954.1|1971054_1971801_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|1971808_1972210_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|1972206_1972785_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817265.1|1972893_1974024_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	98.1	4.0e-213
WP_000083292.1|1974056_1974440_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.2e-28
WP_000201485.1|1974450_1974816_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_001623560.1|1974873_1975902_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.3e-114
WP_000011260.1|1975956_1976304_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_023226259.1|1976316_1977813_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.7	4.3e-98
WP_001623362.1|1977802_1979383_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.6	2.8e-188
WP_000201415.1|1979379_1979583_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_023187571.1|1979566_1981498_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.7e-259
WP_070793402.1|1981469_1982015_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	79.1	7.4e-56
WP_023227962.1|1982059_1982251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031622290.1|1982273_1982777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023227960.1|1982879_1983422_-	DUF2514 family protein	NA	NA	NA	NA	NA
WP_023227959.1|1983418_1984033_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	91.7	2.3e-106
WP_001623358.1|1984035_1984377_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	81.3	4.3e-46
WP_001624514.1|1985986_1986175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024148263.1|1986677_1987511_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023227958.1|1987803_1988607_-	antitermination protein	NA	F1C595	Cronobacter_phage	71.5	4.8e-104
WP_001624522.1|1988603_1988876_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	82.9	1.7e-29
WP_070804833.1|1988890_1989880_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.8	2.6e-192
WP_023227955.1|1989887_1990688_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	72.2	8.7e-106
WP_001529171.1|1990704_1991094_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	86.8	9.2e-61
WP_023227954.1|1991090_1991744_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	87.6	1.3e-112
WP_023227953.1|1991743_1992226_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	96.9	2.5e-84
WP_076018227.1|1992227_1993172_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	85.7	1.3e-129
WP_000620702.1|1993168_1993393_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_023228495.1|1993389_1994229_-	putative antirepressor from phage	NA	A0A1C9IHV9	Salmonella_phage	97.8	8.2e-147
WP_024131287.1|1994253_1994583_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	90.8	2.6e-40
WP_000147078.1|1994572_1994881_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	93.1	2.5e-45
WP_001525520.1|1994899_1995076_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	94.6	4.6e-28
WP_070811212.1|1995215_1995770_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	98.4	7.6e-101
WP_001191666.1|1995798_1996023_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_001020640.1|1996120_1996816_+	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_001624554.1|1997150_1997348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000997190.1|1997886_1998258_+	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_070811010.1|1998315_1999143_+	YfdQ family protein	NA	A0A192Y6E5	Salmonella_phage	98.9	1.1e-151
WP_000008351.1|1999279_1999819_+	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_024148247.1|2000527_2000815_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	58.8	3.2e-26
WP_023227853.1|2000818_2001244_+	HNH endonuclease	NA	C6ZR29	Salmonella_phage	83.8	6.8e-65
WP_023227852.1|2001240_2001678_+	hypothetical protein	NA	Q5G8V2	Enterobacteria_phage	56.9	1.8e-44
WP_023227851.1|2001804_2002014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001623414.1|2002016_2003195_+	hypothetical protein	NA	A0A2D1GN00	Marinobacter_phage	30.1	1.8e-30
WP_001623413.1|2003315_2004374_+	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	42.1	4.6e-62
WP_076018228.1|2007783_2008146_-|tail	phage tail protein	tail	S4TUB9	Salmonella_phage	86.5	2.5e-52
WP_024131629.1|2008229_2009021_-|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	9.7e-49
WP_023227850.1|2009149_2009338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001142121.1|2009324_2009513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000281877.1|2009704_2010268_-	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001115497.1|2010997_2011645_+	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_001238328.1|2011688_2012732_-	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_000828299.1|2012728_2013286_-	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001625168.1|2013282_2015214_-	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_001053607.1|2015210_2015690_-	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000074110.1|2015686_2015899_-	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_023228369.1|2015895_2016633_-	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000990033.1|2016684_2017344_-	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_076018229.1|2017340_2017958_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	8.2e-11
WP_023228100.1|2017978_2018581_-	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000835182.1|2018590_2019040_-	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_001625189.1|2019155_2020025_-	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000091679.1|2020011_2020707_-	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000778097.1|2020713_2023200_-	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_001260058.1|2023196_2023460_-	chaperone NapD	NA	NA	NA	NA	NA
WP_023228101.1|2023449_2023941_-	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_000781589.1|2024354_2024849_+|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
>prophage 8
NZ_CP019181	Salmonella enterica subsp. enterica serovar Inverness str. ATCC 10720 chromosome, complete genome	4865682	3049663	3143462	4865682	tRNA,protease,tail,terminase,integrase,plate,capsid,holin,portal	Vibrio_phage(28.0%)	104	3073897:3073918	3146654:3146675
WP_000366112.1|3049663_3050164_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	55.8	2.5e-26
WP_000257298.1|3050169_3050808_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_000950539.1|3051070_3051823_-	DUF695 domain-containing protein	NA	NA	NA	NA	NA
WP_000829815.1|3052022_3052415_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_000847559.1|3052430_3052859_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_001191222.1|3053160_3054285_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_001519074.1|3054477_3054876_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_000716690.1|3055032_3056400_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	26.3	2.7e-22
WP_023228163.1|3056492_3057563_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_023228162.1|3057596_3058328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070801135.1|3058347_3059649_-	oxalacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_070801136.1|3059661_3061437_-	sodium-extruding oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_000180119.1|3061453_3061696_-	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_000162405.1|3061852_3062470_-	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_000045349.1|3062469_3063369_-	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_000433390.1|3063401_3064670_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.0	1.1e-59
WP_023227848.1|3064880_3065546_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000723776.1|3065532_3066162_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000861586.1|3066281_3067220_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_001257852.1|3067633_3068104_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000695695.1|3068468_3068732_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_000853277.1|3068835_3069102_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_001103887.1|3069161_3069434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000510913.1|3069605_3071573_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_000855134.1|3071578_3072511_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_000051840.1|3072518_3072722_-	AaeX family protein	NA	NA	NA	NA	NA
WP_000440300.1|3072903_3073833_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
3073897:3073918	attL	ATGGCGCTGCGCTTATCAGGCC	NA	NA	NA	NA
WP_000055940.1|3073955_3075401_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_001253500.1|3075545_3079346_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_000123188.1|3079452_3080922_-	ribonuclease G	NA	NA	NA	NA	NA
WP_000210303.1|3080911_3081505_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_000179403.1|3081513_3082002_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_000802538.1|3082004_3083057_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000913396.1|3083121_3084165_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_001241381.1|3084472_3086413_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_001148246.1|3086616_3087591_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000723872.1|3087703_3088708_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240053.1|3088708_3089308_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000354626.1|3089700_3090171_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_000884627.1|3090181_3091531_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_000340018.1|3091639_3091882_+	YhdT family protein	NA	NA	NA	NA	NA
WP_001175682.1|3091871_3093323_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_001145849.1|3093334_3094216_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_001219664.1|3094876_3095842_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|3095867_3096164_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_001623424.1|3098073_3098883_+	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	47.0	1.6e-59
WP_023228120.1|3099043_3099409_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.2	9.4e-15
WP_023228121.1|3099585_3100128_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	65.4	4.0e-70
WP_001623421.1|3100328_3101060_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	51.2	1.9e-59
WP_024148288.1|3101075_3101501_-	subtilase	NA	NA	NA	NA	NA
WP_023228124.1|3102447_3102978_-|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	97.1	4.3e-93
WP_149866814.1|3102990_3104310_-|tail	phage tail protein	tail	Q8HAB4	Salmonella_phage	79.6	3.8e-183
WP_023228126.1|3105240_3105822_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	34.1	7.7e-19
WP_023228127.1|3105814_3106939_-|plate	baseplate J/gp47 family protein	plate	A0A0C5AEG2	Bacteriophage	43.9	3.0e-88
WP_021000619.1|3106935_3107259_-	hypothetical protein	NA	A0A067ZJ13	Vibrio_phage	41.3	6.0e-13
WP_001623398.1|3107255_3107723_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_001623397.1|3107719_3108340_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	55.9	1.3e-32
WP_001623396.1|3108340_3109342_-	phage late control D	NA	A0A0C5AJ59	Bacteriophage	36.3	1.8e-55
WP_001623395.1|3109331_3109550_-	hypothetical protein	NA	A0A0C5AEF4	Bacteriophage	50.0	3.2e-10
WP_077909340.1|3109542_3111447_-|tail	phage tail tape measure protein	tail	A0A097I4X9	Vibrio_phage	26.5	5.6e-42
WP_001623392.1|3112153_3112435_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001623391.1|3112444_3112966_-|tail	phage major tail tube protein	tail	A0A067ZJA9	Vibrio_phage	53.2	1.2e-47
WP_001623390.1|3112978_3114448_-|tail	major tail sheath protein	tail	A0A059WKP9	Vibrio_phage	54.5	7.6e-148
WP_001623389.1|3114447_3114747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021000628.1|3114746_3115232_-	hypothetical protein	NA	A0A067ZIL8	Vibrio_phage	36.0	8.4e-19
WP_001623387.1|3115228_3115573_-	hypothetical protein	NA	A0A067ZJA6	Vibrio_phage	43.9	1.0e-18
WP_001623386.1|3115569_3116034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228130.1|3116034_3117078_-|capsid	major capsid protein	capsid	A0A059WRQ2	Vibrio_phage	44.9	1.4e-71
WP_001623384.1|3117089_3117476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001623382.1|3117486_3118551_-|protease	Clp protease ClpP	protease	A0A067ZG37	Vibrio_phage	48.6	1.7e-80
WP_023228131.1|3118543_3120106_-|portal	phage portal protein	portal	A0A067ZJA4	Vibrio_phage	64.3	1.8e-187
WP_021000635.1|3120102_3120342_-	hypothetical protein	NA	A0A067ZJ01	Vibrio_phage	54.8	6.8e-14
WP_023228132.1|3120353_3122213_-|terminase	phage terminase large subunit family protein	terminase	A0A059WKL6	Vibrio_phage	63.7	1.3e-232
WP_024148290.1|3122218_3122770_-	hypothetical protein	NA	A0A067ZIZ9	Vibrio_phage	38.2	1.6e-18
WP_001623372.1|3122769_3123360_-	ParB N-terminal domain-containing protein	NA	A0A067ZI74	Vibrio_phage	56.5	1.5e-38
WP_024148291.1|3123868_3124585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023136440.1|3124857_3125361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023228134.1|3125463_3126006_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_023228135.1|3126002_3126629_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	78.3	1.3e-91
WP_023228136.1|3126628_3126910_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	79.6	1.3e-35
WP_001623349.1|3126896_3127286_-	hypothetical protein	NA	K7PHB9	Enterobacterial_phage	71.8	1.1e-40
WP_024156063.1|3127597_3128023_-	subtilase	NA	NA	NA	NA	NA
WP_071604142.1|3127949_3128504_-	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	64.5	3.0e-49
WP_024156062.1|3129465_3130302_-	antitermination protein	NA	A0A1B5FPA5	Escherichia_phage	84.8	8.5e-128
WP_001623343.1|3130298_3131147_-	hypothetical protein	NA	F1C596	Cronobacter_phage	75.5	5.8e-124
WP_023228520.1|3131146_3132115_-	phage DNA primase	NA	A0A1B5FPA8	Escherichia_phage	94.7	1.0e-177
WP_001623340.1|3132111_3133743_-	DEAD/DEAH box helicase	NA	A0A1B5FPA4	Escherichia_phage	87.1	2.1e-284
WP_024148337.1|3134165_3134462_-	hypothetical protein	NA	A0A1B5FPB9	Escherichia_phage	73.0	2.9e-30
WP_023237655.1|3134424_3134679_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JEY0	uncultured_Caudovirales_phage	52.9	5.7e-11
WP_000497764.1|3134791_3135487_+	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	67.5	7.4e-85
WP_023228516.1|3135666_3135984_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	51.0	3.0e-17
WP_023228515.1|3136167_3136353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000267316.1|3136540_3136750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023228514.1|3136730_3137090_+	hypothetical protein	NA	A0A1B5FPB3	Escherichia_phage	52.1	8.9e-26
WP_001623336.1|3137089_3137326_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	65.7	1.1e-21
WP_001623335.1|3137315_3137723_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	84.3	5.1e-62
WP_001623334.1|3137734_3138484_+	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	94.0	6.6e-132
WP_001623333.1|3138480_3139047_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	37.8	3.7e-26
WP_023228513.1|3139043_3139268_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	66.2	2.5e-18
WP_162096905.1|3139363_3139477_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	83.8	8.1e-10
WP_001193443.1|3140299_3140542_+	excisionase family protein	NA	A0A286S2A4	Klebsiella_phage	68.4	1.1e-22
WP_001623330.1|3140567_3141899_+|integrase	site-specific integrase	integrase	Q9XJG6	Enterobacteria_phage	64.6	2.8e-165
WP_001270724.1|3141988_3142504_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027186.1|3142733_3143462_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	5.1e-28
3146654:3146675	attR	GGCCTGATAAGCGCAGCGCCAT	NA	NA	NA	NA
