The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019198	Salmonella enterica subsp. enterica serovar Muenster str. 0315 chromosome, complete genome	4879583	93420	102202	4879583	integrase,capsid	Enterobacteria_phage(100.0%)	10	91087:91108	102363:102384
91087:91108	attL	TTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_023136633.1|93420_95754_-	P4-specific DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.9	0.0e+00
WP_023136634.1|95768_96089_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_060641628.1|96309_96861_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	75.0	4.5e-37
WP_023136638.1|96857_97076_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	73.6	3.5e-25
WP_162493623.1|97229_97373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162493621.1|97597_98407_+|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_000468231.1|98410_98650_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_023136640.1|98665_99232_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	2.5e-59
WP_023136641.1|99648_101013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023136642.1|101017_102202_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.5	1.3e-209
102363:102384	attR	TTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP019198	Salmonella enterica subsp. enterica serovar Muenster str. 0315 chromosome, complete genome	4879583	124259	138661	4879583	integrase	Morganella_phage(37.5%)	18	121428:121443	138832:138847
121428:121443	attL	GTTGAATTTTGCTGAT	NA	NA	NA	NA
WP_010835592.1|124259_127229_-	hypothetical protein	NA	F1C5E9	Cronobacter_phage	35.4	3.9e-82
WP_001651021.1|127238_127559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023223122.1|127900_128275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023223121.1|128374_128650_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001651019.1|128642_129131_-	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_001651017.1|129344_132107_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	1.6e-295
WP_001651016.1|132099_132447_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	62.2	2.1e-32
WP_001651015.1|132456_133083_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	39.0	6.3e-27
WP_001651014.1|133079_133301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024423.1|133297_133561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001651013.1|133557_134241_-	ash family protein	NA	A0A0P0ZE80	Stx2-converting_phage	45.0	1.2e-07
WP_001651012.1|134237_134735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001651011.1|134731_134911_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001651010.1|134903_135713_-	DNA primase core	NA	A0A0R6PJV6	Moraxella_phage	55.2	4.3e-28
WP_001651009.1|135725_136157_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	50.3	1.3e-26
WP_001651008.1|136156_136360_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001651007.1|136453_137305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001651006.1|137401_138661_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	79.4	2.8e-199
138832:138847	attR	GTTGAATTTTGCTGAT	NA	NA	NA	NA
>prophage 3
NZ_CP019198	Salmonella enterica subsp. enterica serovar Muenster str. 0315 chromosome, complete genome	4879583	664477	739440	4879583	integrase,tail,lysis,portal,head,capsid,plate,terminase,tRNA	Salmonella_phage(47.56%)	92	679795:679824	710780:710809
WP_023136705.1|664477_665521_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	58.7	7.4e-113
WP_023212685.1|665535_666348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023136703.1|666349_666940_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	38.7	3.6e-32
WP_023136702.1|667070_667292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023136699.1|669866_670799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023136698.1|670788_671529_+	Hiran domain protein	NA	NA	NA	NA	NA
WP_000218395.1|671999_673037_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.1	1.1e-198
WP_001217271.1|673036_673615_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.0	3.5e-64
WP_000135597.1|673745_674009_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	3.3e-38
WP_000459332.1|674039_674549_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.8	6.2e-89
WP_000920168.1|674556_674784_+	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	97.3	2.1e-36
WP_000085639.1|674770_674971_+	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
WP_001246236.1|675040_675268_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.6e-31
WP_000752604.1|675267_675492_+	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	100.0	6.5e-35
WP_153259982.1|675513_676107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077911188.1|676105_678373_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	93.2	0.0e+00
WP_023223545.1|678489_678930_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	90.5	1.2e-64
WP_023223240.1|679009_679741_+	hypothetical protein	NA	Q37850	Escherichia_phage	94.7	7.9e-130
679795:679824	attL	GGTTGAACAACGAGCCACGCGAGGCGTTAG	NA	NA	NA	NA
WP_023223238.1|680837_681875_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	79.3	1.2e-163
WP_023223237.1|681874_683644_-|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	4.2e-286
WP_023223236.1|683808_684672_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	76.3	1.7e-118
WP_023223235.1|684703_685864_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	63.4	3.3e-130
WP_023223234.1|685867_686626_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_000177982.1|686723_687224_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_001100637.1|687223_687427_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000524754.1|687417_687639_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_023223233.1|687622_688132_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.0	1.3e-75
WP_023223232.1|688128_688542_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.1	1.2e-34
WP_023223231.1|688649_689117_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	70.3	7.5e-57
WP_023223230.1|689109_689577_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.5	2.0e-49
WP_049883896.1|689614_690958_+	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_023223228.1|691034_691676_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	82.2	1.6e-94
WP_023223227.1|691672_692020_+|plate	phage baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	71.3	9.5e-41
WP_023223226.1|692024_692933_+|plate	baseplate assembly protein	plate	Q37840	Escherichia_phage	84.1	2.0e-138
WP_023223225.1|692925_693459_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	88.6	5.6e-93
WP_023223224.1|693466_695218_+|tail	tail fiber domain-containing protein	tail	Q37842	Escherichia_phage	76.2	8.9e-95
WP_023223223.1|695220_695745_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	32.0	5.7e-13
WP_023223222.1|695874_697062_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	82.8	1.1e-189
WP_023223221.1|697074_697593_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.6	2.0e-71
WP_023223220.1|697655_697937_+|tail	phage tail assembly protein	tail	A0A0F7LBN9	Escherichia_phage	79.1	4.7e-30
WP_000763326.1|697969_698089_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	84.6	3.7e-13
WP_023223219.1|698081_700511_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	72.4	2.1e-275
WP_023223218.1|700522_700987_+|tail	phage tail protein	tail	A0A0F7LBX3	Escherichia_phage	74.8	1.3e-61
WP_023223217.1|700989_702183_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.6	7.8e-167
WP_023223216.1|702222_702441_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	86.1	4.6e-33
WP_023223463.1|702757_703771_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.5	9.7e-118
WP_023223462.1|703776_704325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024147846.1|704349_704964_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	40.9	2.3e-37
WP_015386350.1|705065_705302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023206291.1|705336_705846_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.7e-83
WP_015386352.1|705853_706054_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_013098807.1|706017_706359_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	7.6e-51
WP_023223460.1|706426_706660_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	77.9	4.6e-23
WP_013098805.1|706659_706887_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	5.1e-35
WP_023223459.1|706883_707744_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	81.4	3.4e-132
WP_023223458.1|707734_710143_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	97.0	0.0e+00
WP_001154443.1|710304_710493_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_001217561.1|710504_710738_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_023223457.1|711118_712174_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	1.8e-175
710780:710809	attR	GGTTGAACAACGAGCCACGCGAGGCGTTAG	NA	NA	NA	NA
WP_023223456.1|712170_712896_-	hypothetical protein	NA	E5FFI8	Burkholderia_phage	33.1	1.9e-22
WP_023223455.1|712895_714662_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	95.2	0.0e+00
WP_023223454.1|714804_715638_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	97.1	2.5e-127
WP_023223453.1|715654_716716_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	98.9	2.3e-194
WP_023223452.1|716719_717370_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	99.1	3.2e-114
WP_023223451.1|717463_717928_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	95.5	5.1e-82
WP_023223450.1|717927_718131_+|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	98.5	6.5e-34
WP_000171565.1|718134_718350_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069919.1|718330_718840_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_023223449.1|718844_719222_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	97.6	2.0e-60
WP_024147844.1|719218_719647_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	97.9	1.6e-66
WP_023223447.1|719742_720174_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	98.6	1.9e-75
WP_023223446.1|720166_720613_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	89.7	6.4e-66
WP_023223445.1|720681_721260_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	97.9	2.6e-107
WP_023223444.1|721256_721616_+|plate	phage baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	92.4	1.4e-55
WP_023223443.1|721602_722511_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	92.1	8.3e-145
WP_039505106.1|722503_723031_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	84.1	8.1e-84
WP_075995154.1|723038_725072_+	hypothetical protein	NA	Q37842	Escherichia_phage	80.0	1.7e-89
WP_023223490.1|725097_725508_+|tail	phage tail fiber assembly protein	tail	A0A291LAV4	Bordetella_phage	28.6	2.6e-05
WP_023223489.1|725641_726814_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	94.1	1.0e-211
WP_001207650.1|726823_727339_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	98.8	2.3e-91
WP_023223488.1|727393_727696_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	98.0	1.4e-43
WP_000763315.1|727710_727830_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	94.9	1.2e-14
WP_023223487.1|727822_730615_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	73.1	7.9e-295
WP_023223486.1|730611_731097_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	93.9	3.8e-64
WP_023223485.1|731093_732194_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	92.1	4.6e-190
WP_024146528.1|732263_732482_+	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	75.0	4.9e-27
WP_000237780.1|732819_733326_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001183951.1|733382_733946_-	NADAR family protein	NA	A8E2M1	Enterococcus_phage	44.7	1.4e-33
WP_001519776.1|734005_735853_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000918865.1|736002_737748_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001144069.1|737983_738199_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_023136697.1|738426_739440_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	3.7e-109
>prophage 4
NZ_CP019198	Salmonella enterica subsp. enterica serovar Muenster str. 0315 chromosome, complete genome	4879583	1199759	1287315	4879583	integrase,tail,portal,head,transposase,capsid,plate,terminase,tRNA	Salmonella_phage(85.19%)	82	1203070:1203119	1238273:1238322
WP_000190917.1|1199759_1200332_-	flagellar phase variation DNA invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	72.1	2.0e-67
WP_023181669.1|1200423_1201944_+	flagellin FliC	NA	NA	NA	NA	NA
WP_024147812.1|1202011_1202551_+	phase 1 flagellin gene repressor FljA	NA	NA	NA	NA	NA
1203070:1203119	attL	TTATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001536726.1|1203236_1204262_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	100.0	9.9e-203
WP_000616878.1|1204265_1204898_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	100.0	1.1e-116
WP_000102102.1|1205017_1205260_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	100.0	1.1e-38
WP_000460858.1|1205292_1205802_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	100.0	1.6e-89
WP_000956168.1|1205809_1206010_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	100.0	3.2e-33
WP_000963480.1|1205973_1206315_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	100.0	2.1e-56
WP_021293768.1|1206382_1206616_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	100.0	9.8e-34
WP_021293767.1|1206615_1206843_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	100.0	1.4e-37
WP_023171084.1|1206839_1207424_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	100.0	4.3e-110
WP_021293766.1|1207420_1208278_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	100.0	4.4e-164
WP_023171083.1|1208268_1210680_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	99.9	0.0e+00
WP_001154444.1|1210835_1211024_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	100.0	2.7e-26
WP_021293765.1|1211035_1211269_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	100.0	1.2e-36
WP_021293764.1|1211397_1212138_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	100.0	5.7e-144
WP_023171082.1|1212539_1213535_+	hypothetical protein	NA	A0A1S6KZY1	Salmonella_phage	100.0	7.8e-197
WP_023171081.1|1213591_1214551_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	100.0	6.6e-185
WP_021293761.1|1214622_1215657_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	100.0	1.0e-199
WP_023171080.1|1215656_1217423_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	100.0	0.0e+00
WP_023171079.1|1217565_1218399_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	100.0	9.3e-135
WP_021293760.1|1218415_1219480_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	100.0	8.4e-197
WP_000059172.1|1219483_1220134_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	100.0	2.2e-115
WP_021293758.1|1220227_1220692_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	100.0	5.8e-86
WP_021293757.1|1220691_1220895_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	100.0	2.2e-34
WP_000171565.1|1220898_1221114_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_021293756.1|1221094_1221604_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	100.0	5.8e-95
WP_000731036.1|1221608_1221986_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	8.1e-62
WP_024143846.1|1221982_1222411_+	hypothetical protein	NA	A0A1S6KZX8	Salmonella_phage	100.0	6.0e-69
WP_023171077.1|1222506_1222938_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	100.0	1.3e-76
WP_021293753.1|1222930_1223380_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	100.0	3.4e-75
WP_023171076.1|1223394_1224330_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	100.0	5.0e-185
WP_021293752.1|1224414_1224993_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	100.0	9.4e-110
WP_021293751.1|1224989_1225349_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	100.0	2.1e-59
WP_023171075.1|1225335_1226244_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	100.0	1.6e-159
WP_021293749.1|1226236_1226842_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	100.0	2.6e-118
WP_031623795.1|1226838_1228494_+|tail	tail protein	tail	A0A1S6KZZ8	Salmonella_phage	100.0	0.0e+00
WP_023171104.1|1228496_1229036_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	100.0	2.9e-97
WP_077915194.1|1229039_1229657_-|tail	phage tail protein	tail	A0A1S6KZY8	Salmonella_phage	100.0	5.7e-113
WP_049842359.1|1229626_1230616_-	hypothetical protein	NA	A0A1S6KZZ0	Salmonella_phage	100.0	3.1e-193
WP_021293543.1|1230645_1231203_+	serine-type DNA invertase Fin	NA	A0A1S6L009	Salmonella_phage	100.0	2.9e-100
WP_021293542.1|1231305_1232478_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	100.0	2.0e-223
WP_001207647.1|1232487_1233003_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	100.0	9.3e-93
WP_001280962.1|1233057_1233360_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	100.0	2.5e-45
WP_000763316.1|1233374_1233494_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	100.0	1.8e-15
WP_023223497.1|1233486_1236294_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	100.0	0.0e+00
WP_023171106.1|1236290_1236776_+|tail	phage tail protein	tail	A0A1S6L003	Salmonella_phage	100.0	3.4e-68
WP_021293540.1|1236772_1237873_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	100.0	5.1e-197
WP_000980498.1|1237941_1238160_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_000342601.1|1238711_1239875_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1238273:1238322	attR	TTATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196155.1|1239882_1242063_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_001528538.1|1242059_1243469_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_023136474.1|1243533_1255008_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1255622_1256105_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242604.1|1256254_1256731_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1256720_1257011_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1257171_1257510_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1257658_1259320_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1259405_1260284_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1260406_1260997_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023136472.1|1261031_1261637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1261757_1263044_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1263063_1263855_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1264020_1265382_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1265634_1265883_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1265901_1266450_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1266494_1267262_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065257.1|1267302_1267650_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_001030989.1|1267805_1269026_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	36.2	5.8e-08
WP_001212375.1|1269018_1269537_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001168062.1|1269976_1271047_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_023136471.1|1271056_1272178_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001607154.1|1272235_1273144_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_000200082.1|1273104_1274265_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_010989056.1|1274364_1274412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178449.1|1274515_1274854_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197660.1|1275125_1275863_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079130.1|1275994_1276975_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000992639.1|1276971_1277703_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235092.1|1277832_1280406_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.5	2.6e-127
WP_088137194.1|1286060_1287315_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.5	2.2e-18
>prophage 5
NZ_CP019198	Salmonella enterica subsp. enterica serovar Muenster str. 0315 chromosome, complete genome	4879583	1756378	1765549	4879583	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1756378_1757326_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1757309_1758041_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1758021_1758129_-	protein YohO	NA	NA	NA	NA	NA
WP_001240416.1|1758188_1758920_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1759142_1760828_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1760824_1761544_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1761590_1762058_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_023137005.1|1762114_1762645_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703136.1|1762816_1763275_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_023137006.1|1763515_1765549_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP019198	Salmonella enterica subsp. enterica serovar Muenster str. 0315 chromosome, complete genome	4879583	1832777	1839074	4879583		Enterobacteria_phage(50.0%)	6	NA	NA
WP_023136762.1|1832777_1834181_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.3	3.1e-21
WP_000981469.1|1834358_1835252_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697850.1|1835628_1836714_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.4e-103
WP_023223157.1|1836713_1837613_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_023136761.1|1837660_1838539_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.8	6.6e-107
WP_001100807.1|1838543_1839074_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	57.1	3.7e-52
>prophage 7
NZ_CP019198	Salmonella enterica subsp. enterica serovar Muenster str. 0315 chromosome, complete genome	4879583	2023613	2113431	4879583	integrase,tail,portal,head,capsid,holin,tRNA,terminase	Salmonella_phage(33.33%)	101	2091842:2091856	2110166:2110180
WP_001025360.1|2023613_2025347_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.4	4.9e-85
WP_000024796.1|2025583_2026153_+	VOC family protein	NA	NA	NA	NA	NA
WP_023137480.1|2026172_2026919_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_000569026.1|2027154_2028126_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019609.1|2028122_2028866_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	5.4e-25
WP_000252975.1|2028906_2029302_-	membrane protein	NA	NA	NA	NA	NA
WP_045888880.1|2029354_2030128_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	80.3	5.5e-57
WP_000357987.1|2030106_2031420_-|integrase	site-specific integrase	integrase	Q8W658	Enterobacteria_phage	87.6	1.0e-228
WP_006669544.1|2031478_2031715_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	93.6	4.2e-40
WP_006669542.1|2031753_2032323_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	83.1	4.3e-91
WP_023223558.1|2032326_2033373_-	DUF550 domain-containing protein	NA	Q8HAA7	Salmonella_phage	46.7	6.3e-64
WP_023223559.1|2034705_2035326_-	ead/Ea22-like family protein	NA	A0A0M5M1J9	Salmonella_phage	65.3	5.1e-53
WP_000008351.1|2035396_2035936_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_023223560.1|2036072_2036900_-	YfdQ family protein	NA	Q8HAA2	Salmonella_phage	98.5	1.2e-150
WP_000997190.1|2036957_2037329_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001020640.1|2038143_2038839_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	99.6	4.6e-127
WP_001191666.1|2038936_2039161_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|2039189_2039744_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_031606483.1|2039740_2040895_+	peptidase	NA	A0A1C9IHV9	Salmonella_phage	87.8	6.8e-184
WP_023223563.1|2041112_2042057_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	85.7	6.6e-129
WP_001669427.1|2042058_2042541_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	98.1	6.0e-86
WP_023223564.1|2042540_2043434_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	93.6	1.6e-161
WP_000767086.1|2043430_2043820_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	97.7	1.6e-68
WP_023223565.1|2043836_2044697_+	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	98.3	4.6e-161
WP_006762306.1|2044704_2045694_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	3.2e-190
WP_023195405.1|2045708_2046287_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.8	3.2e-49
WP_001539755.1|2046511_2046931_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	75.5	6.0e-58
WP_001294873.1|2047431_2047821_+	membrane protein	NA	K7PHB9	Enterobacterial_phage	72.5	4.8e-41
WP_000226306.1|2047807_2048089_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.3e-36
WP_023195402.1|2048088_2048703_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	92.2	1.6e-107
WP_000636436.1|2048699_2049242_+	DUF2514 family protein	NA	NA	NA	NA	NA
WP_023223568.1|2049344_2049848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023223569.1|2049870_2050062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|2050106_2050652_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_023223570.1|2050623_2052555_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	1.7e-259
WP_000201415.1|2052538_2052742_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|2052738_2054319_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_006669512.1|2054308_2055805_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.4	9.6e-98
WP_000011260.1|2055817_2056165_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_023223571.1|2056219_2057248_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	60.5	4.3e-113
WP_000201485.1|2057305_2057671_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083293.1|2057681_2058059_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000677089.1|2058045_2058624_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000033885.1|2058620_2059022_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|2059029_2059776_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|2059826_2060222_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_077905125.1|2060218_2060557_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	63.6	3.5e-32
WP_023223572.1|2060528_2063570_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	65.1	2.7e-296
WP_000447370.1|2063572_2063902_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_023223573.1|2063911_2064610_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	3.2e-104
WP_031606484.1|2064616_2065354_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	1.5e-128
WP_001736578.1|2065251_2065899_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	2.7e-89
WP_023223575.1|2065960_2069323_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.3	0.0e+00
WP_023223576.1|2069361_2069604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149866846.1|2071447_2072290_+|tail	phage tail protein	tail	Q6K1H2	Salmonella_virus	55.8	5.6e-79
WP_023223580.1|2072292_2072826_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	74.7	7.2e-72
WP_023223579.1|2072829_2073348_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	63.4	1.9e-45
WP_075995157.1|2073362_2074613_-|tail	phage tail protein	tail	A0A1B0VFW4	Salmonella_phage	64.9	2.3e-145
WP_024147847.1|2074641_2075199_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	87.4	1.2e-88
WP_023223471.1|2075370_2075790_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023223470.1|2075792_2077061_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	94.1	1.2e-234
WP_023223469.1|2077146_2077578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023223468.1|2077603_2078275_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.9	3.4e-79
WP_023137479.1|2078597_2079164_-	hydrolase	NA	NA	NA	NA	NA
WP_001258629.1|2079488_2081261_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000653693.1|2081363_2081816_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907242.1|2081845_2082586_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000022509.1|2082622_2083144_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.6e-10
WP_023137478.1|2083145_2083745_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_023137477.1|2083953_2084646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580333.1|2085004_2085616_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568504.1|2085624_2086635_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	2.4e-07
WP_000571508.1|2086713_2087499_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000203023.1|2087495_2088251_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	8.5e-18
WP_000939597.1|2088329_2089274_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184030.1|2089289_2090609_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
WP_000448401.1|2090725_2091697_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_000091156.1|2091768_2093211_-	pyruvate kinase	NA	NA	NA	NA	NA
2091842:2091856	attL	ACCAGGTCGCCGGAA	NA	NA	NA	NA
WP_001056718.1|2093334_2094204_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000301711.1|2094545_2096021_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
WP_001069118.1|2096255_2098067_+	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000800494.1|2098104_2098746_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000173436.1|2098845_2100024_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000257723.1|2100154_2100445_+	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001042123.1|2100512_2100866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000024707.1|2100959_2101619_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_000936990.1|2101831_2103883_+	oligopeptidase B	NA	NA	NA	NA	NA
WP_000944280.1|2103919_2104618_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	2.8e-07
WP_000100257.1|2104641_2105298_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000856225.1|2105405_2105636_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_001633679.1|2105773_2106148_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_001633680.1|2106148_2107024_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|2107040_2107394_+	YebY family protein	NA	NA	NA	NA	NA
WP_023137474.1|2107767_2108847_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	53.2	1.3e-101
WP_023137473.1|2108843_2109950_-	exodeoxyribonuclease 8	NA	Q9QF34	Lambdoid_phage	66.7	3.3e-55
WP_001014089.1|2109980_2110268_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.1	1.9e-39
2110166:2110180	attR	TTCCGGCGACCTGGT	NA	NA	NA	NA
WP_001633683.1|2110264_2110798_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	42.4	1.6e-10
WP_000789530.1|2111054_2111222_-	lytic enzyme	NA	NA	NA	NA	NA
WP_024134652.1|2111286_2111469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348550.1|2111523_2112015_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.6e-44
WP_001633687.1|2112702_2113431_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	42.8	7.8e-45
>prophage 8
NZ_CP019198	Salmonella enterica subsp. enterica serovar Muenster str. 0315 chromosome, complete genome	4879583	2772135	2780406	4879583		Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2772135_2772375_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036547.1|2772585_2772750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2773247_2774057_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2774129_2774507_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158845.1|2774654_2775197_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_000733630.1|2775380_2776109_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
WP_000275697.1|2776125_2776539_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	37.7	3.2e-19
WP_023136605.1|2777583_2778708_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444508.1|2779155_2780406_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
>prophage 9
NZ_CP019198	Salmonella enterica subsp. enterica serovar Muenster str. 0315 chromosome, complete genome	4879583	2968591	2979398	4879583	integrase,tail	Salmonella_phage(100.0%)	11	2957278:2957297	2993522:2993541
2957278:2957297	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_023223252.1|2968591_2969167_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	90.5	5.9e-96
WP_023223254.1|2970569_2971250_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	98.7	1.4e-128
WP_023223255.1|2971246_2972446_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	98.0	5.9e-215
WP_023223256.1|2972446_2972800_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	96.6	6.0e-59
WP_023223257.1|2972799_2973555_-	bacteriophage protein	NA	A0A0M5M1K7	Salmonella_phage	92.8	1.0e-127
WP_023209959.1|2973614_2973788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023223259.1|2974327_2974675_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.6	8.3e-29
WP_077911190.1|2976332_2977490_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	1.6e-217
WP_001237031.1|2977532_2977772_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2977812_2978061_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2978105_2979398_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
2993522:2993541	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 10
NZ_CP019198	Salmonella enterica subsp. enterica serovar Muenster str. 0315 chromosome, complete genome	4879583	3397756	3482590	4879583	integrase,lysis,tail,portal,coat,holin,terminase,protease	Salmonella_phage(55.17%)	121	3397166:3397212	3482604:3482650
3397166:3397212	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_023223394.1|3397756_3399679_+	acyltransferase	NA	C6ZR20	Salmonella_phage	99.4	0.0e+00
WP_023223393.1|3400024_3402142_-	hypothetical protein	NA	C6ZR19	Salmonella_phage	98.6	0.0e+00
WP_023223392.1|3402297_3404289_-	hypothetical protein	NA	Q76H13	Enterobacteria_phage	85.7	3.4e-308
WP_031601948.1|3404288_3405593_-	phage DNA ejection protein	NA	A0A220NR03	Salmonella_phage	95.2	1.1e-227
WP_023223390.1|3405635_3406325_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	91.7	2.3e-91
WP_000627703.1|3406327_3406783_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	100.0	1.8e-87
WP_023223389.1|3406782_3407484_-	hypothetical protein	NA	Q76H17	Enterobacteria_phage	98.7	4.1e-75
WP_023223388.1|3407487_3408906_-	hypothetical protein	NA	I1TEJ1	Salmonella_phage	99.4	2.3e-274
WP_023223387.1|3408865_3409366_-	hypothetical protein	NA	I1TEJ0	Salmonella_phage	99.4	4.2e-90
WP_023223386.1|3409349_3409910_-	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	9.1e-102
WP_001196937.1|3409950_3411243_-|coat	coat protein	coat	Q76H21	Enterobacteria_phage	100.0	1.1e-243
WP_023223385.1|3411242_3412154_-	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
WP_023223384.1|3412167_3414345_-|portal	portal protein	portal	A0A075B8I1	Enterobacteria_phage	98.6	0.0e+00
WP_001749919.1|3414344_3415805_-	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.5	4.3e-220
WP_001629224.1|3415804_3416263_-	hypothetical protein	NA	A0A2P1MXF5	Escherichia_phage	66.2	3.3e-49
WP_024147842.1|3416275_3416680_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	97.8	5.8e-66
WP_023223383.1|3416682_3416925_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	98.8	3.7e-36
WP_001028471.1|3417257_3417779_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	98.8	5.5e-93
WP_075995160.1|3417997_3418435_-|lysis	lysis protein	lysis	K7P7F7	Enterobacteria_phage	97.2	8.5e-71
WP_023223366.1|3418431_3418908_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	4.9e-88
WP_000783734.1|3418891_3419215_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_023223365.1|3419687_3420194_-	DUF1133 family protein	NA	A0A1R3Y5U9	Salmonella_virus	95.8	6.1e-89
WP_023223364.1|3420190_3420370_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	96.6	3.5e-23
WP_000188967.1|3420350_3420554_-	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	98.5	2.7e-32
WP_023223363.1|3420550_3421153_-	recombination endonuclease	NA	A0A1U9AJF8	Stx1_converting_phage	94.6	2.1e-91
WP_001108084.1|3421127_3421694_-	endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_000566872.1|3421686_3421857_-	protein ninF	NA	K7PM86	Enterobacteria_phage	100.0	1.2e-25
WP_010835565.1|3422032_3422560_-	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	98.3	1.0e-99
WP_023223362.1|3422556_3423003_-	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	80.4	4.9e-66
WP_001736911.1|3423142_3423406_-	hypothetical protein	NA	A0A192Y6R5	Salmonella_phage	97.7	2.6e-43
WP_023223361.1|3423407_3423623_-	hypothetical protein	NA	A0A0P0ZC82	Stx2-converting_phage	98.6	9.0e-34
WP_023223360.1|3423893_3424172_-	hypothetical protein	NA	Q5G8S7	Enterobacteria_phage	95.7	7.1e-47
WP_023233621.1|3424172_3426053_-	bifunctional DNA primase/helicase	NA	Q5G8S8	Enterobacteria_phage	98.2	0.0e+00
WP_023233620.1|3426160_3427009_-	replication protein	NA	C6ZR51	Salmonella_phage	94.7	8.0e-150
WP_000424167.1|3427191_3427470_-	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_000276884.1|3427576_3427762_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|3427842_3428493_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_023216151.1|3428831_3429134_+	hypothetical protein	NA	I6S5Z3	Salmonella_phage	95.0	1.6e-47
WP_023223357.1|3429212_3429926_+	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	88.2	1.1e-78
WP_001670815.1|3430120_3430294_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	I6R987	Salmonella_phage	100.0	8.9e-24
WP_000156731.1|3430274_3430463_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902091.1|3430452_3430596_+	hypothetical protein	NA	I6S1M5	Salmonella_phage	100.0	4.2e-19
WP_020898894.1|3430592_3431300_+	recombinase	NA	I6R0N0	Salmonella_phage	98.3	1.9e-136
WP_000168281.1|3431300_3431807_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	100.0	1.0e-91
WP_023223613.1|3431815_3432364_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	97.3	2.4e-102
WP_023223614.1|3432380_3432677_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	5.0e-51
WP_001214448.1|3432687_3432855_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	1.1e-23
WP_000184762.1|3432851_3433496_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.6	8.2e-131
WP_023223615.1|3433492_3434128_+	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	94.1	5.7e-92
WP_023892125.1|3434959_3435220_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	95.3	2.1e-40
WP_016049827.1|3435325_3435676_+	hypothetical protein	NA	I6R980	Salmonella_phage	100.0	3.2e-60
WP_000443632.1|3435678_3436050_+	helix-turn-helix domain-containing protein	NA	B9UDM0	Salmonella_phage	96.7	6.8e-61
WP_077915031.1|3436877_3437177_+	DinI family protein	NA	S4TND2	Salmonella_phage	97.0	1.9e-29
WP_023223432.1|3437245_3438376_-|tail	tail fiber domain-containing protein	tail	S4TSP4	Salmonella_phage	99.5	8.3e-203
WP_023892136.1|3438386_3439346_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	98.7	1.5e-181
WP_023223430.1|3439354_3442525_-	host specificity protein J	NA	A0A1V0E5M1	Salmonella_phage	96.5	0.0e+00
WP_031606456.1|3442534_3443062_-|tail	tail assembly protein	tail	I6RSM0	Salmonella_phage	96.6	1.2e-66
WP_023223428.1|3443004_3443724_-	C40 family peptidase	NA	I6S1R8	Salmonella_phage	95.8	2.0e-141
WP_023223427.1|3443723_3444428_-|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	99.1	1.2e-135
WP_023223426.1|3444592_3444880_+	hypothetical protein	NA	A0A1V0E5N9	Salmonella_phage	97.9	6.2e-46
WP_023223425.1|3444884_3445145_-	DUF1327 domain-containing protein	NA	A0A1V0E5N5	Salmonella_phage	98.8	9.6e-38
WP_023223424.1|3445156_3445504_-|tail	phage tail protein	tail	H6WRV8	Salmonella_phage	94.8	5.3e-60
WP_001240563.1|3445559_3445781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023223423.1|3445808_3448064_-	tape measure protein	NA	A0A1V0E5N4	Salmonella_phage	98.1	1.6e-306
WP_016050276.1|3448103_3448490_-	hypothetical protein	NA	I6R0Q4	Salmonella_phage	100.0	5.4e-69
WP_023223422.1|3448574_3448961_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023223421.1|3449136_3450054_+	KilA-N domain-containing protein	NA	I6R977	Salmonella_phage	53.0	5.1e-49
WP_023223420.1|3450111_3450606_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_023223419.1|3450616_3450796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023223418.1|3450992_3451721_-	hypothetical protein	NA	I6S1R0	Salmonella_phage	99.6	1.5e-141
WP_023223417.1|3451941_3452595_-	hypothetical protein	NA	I6R0Q2	Salmonella_phage	99.1	1.9e-119
WP_023223416.1|3452640_3453378_-	hypothetical protein	NA	Q5G8X3	Enterobacteria_phage	88.2	4.5e-117
WP_023223415.1|3453393_3453780_-	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	93.8	6.8e-64
WP_001144356.1|3453776_3454172_-	hypothetical protein	NA	I6RSK8	Salmonella_phage	99.2	5.5e-69
WP_023223414.1|3454179_3454542_-	hypothetical protein	NA	I6S1Q5	Salmonella_phage	98.3	1.8e-66
WP_023223413.1|3454713_3455115_-	hypothetical protein	NA	I6S619	Salmonella_phage	97.0	3.9e-70
WP_001151798.1|3455166_3455346_-	hypothetical protein	NA	I6R9A3	Salmonella_phage	100.0	6.8e-27
WP_001747836.1|3455355_3456432_-	hypothetical protein	NA	I6RSK5	Salmonella_phage	100.0	2.4e-207
WP_000092739.1|3456449_3456899_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	98.7	1.6e-77
WP_023223412.1|3456911_3458177_-	hypothetical protein	NA	I6R0P6	Salmonella_phage	99.3	2.4e-235
WP_023223411.1|3458179_3459106_-	hypothetical protein	NA	I6S615	Salmonella_phage	99.0	1.5e-170
WP_023892134.1|3459065_3460415_-	DUF1073 domain-containing protein	NA	A0A1V0E5Q5	Salmonella_phage	97.3	1.4e-252
WP_023223409.1|3460547_3462026_-	hypothetical protein	NA	G0ZND4	Cronobacter_phage	85.8	2.8e-251
WP_023223408.1|3462012_3462444_-|terminase	terminase small subunit	terminase	A0A1V0E5Q4	Salmonella_phage	93.4	2.4e-54
WP_001028471.1|3462908_3463430_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	98.8	5.5e-93
WP_075995162.1|3463648_3464086_-|lysis	lysis protein	lysis	A0A0N6WGE8	Salmonella_phage	93.1	1.1e-65
WP_017441427.1|3464082_3464520_-	lysozyme	NA	Q5G8R3	Enterobacteria_phage	97.9	8.2e-74
WP_000738703.1|3464503_3464830_-|holin	phage holin, lambda family	holin	Q5G8R5	Enterobacteria_phage	100.0	1.7e-52
WP_017441426.1|3465063_3465261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235465.1|3465534_3466158_-	antitermination protein	NA	C6ZR62	Salmonella_phage	99.0	1.5e-113
WP_000219138.1|3466154_3466334_-	hypothetical protein	NA	A0A1V0E5I7	Salmonella_phage	100.0	7.1e-24
WP_000188966.1|3466314_3466518_-	protein ninH	NA	A0A1R3Y5V4	Salmonella_virus	100.0	1.6e-32
WP_023223589.1|3466514_3466739_-	hypothetical protein	NA	A0A1R3Y5U5	Salmonella_virus	97.3	1.8e-37
WP_023223590.1|3466735_3467341_-	recombination protein NinG	NA	K7PHP1	Enterobacterial_phage	97.5	5.2e-95
WP_016063555.1|3467333_3467504_-	hypothetical protein	NA	K7PMD9	Enterobacterial_phage	100.0	8.4e-27
WP_023892130.1|3467649_3467823_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	98.2	3.4e-31
WP_023223591.1|3467819_3468257_-	recombination protein NinB	NA	C6ZR55	Salmonella_phage	97.9	1.2e-77
WP_023223592.1|3468334_3470215_-	bifunctional DNA primase/helicase	NA	I6S1U6	Salmonella_phage	99.4	0.0e+00
WP_023223593.1|3470325_3471186_-	replication protein	NA	K7PL20	Enterobacteria_phage	99.3	2.5e-159
WP_001125982.1|3471178_3471325_-	DUF2740 family protein	NA	A0A0M4S617	Salmonella_phage	100.0	1.9e-19
WP_000424166.1|3471359_3471638_-	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	93.5	2.2e-40
WP_001059982.1|3471770_3471980_-	helix-turn-helix transcriptional regulator	NA	I6S1U2	Salmonella_phage	100.0	2.1e-35
WP_001104735.1|3472089_3472743_+	LexA family transcriptional regulator	NA	C6ZR47	Salmonella_phage	100.0	4.6e-129
WP_000968836.1|3472742_3473213_+	hypothetical protein	NA	B9UDH1	Salmonella_phage	100.0	3.6e-83
WP_000097748.1|3473199_3473511_+	hypothetical protein	NA	C6ZR45	Salmonella_phage	100.0	9.7e-45
WP_000834165.1|3473647_3473851_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	100.0	9.1e-28
WP_000198447.1|3474182_3474545_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	99.2	5.0e-61
WP_071786748.1|3474623_3475238_+	hypothetical protein	NA	Q8HAH0	Salmonella_phage	81.3	7.1e-39
WP_000067090.1|3475237_3475468_+	hypothetical protein	NA	A0A1B0VMC0	Pseudomonas_phage	46.8	3.7e-09
WP_001200014.1|3475664_3475805_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	84.8	3.5e-18
WP_000361564.1|3475797_3475911_+	host cell division inhibitory peptide Kil	NA	C6ZR39	Salmonella_phage	100.0	7.8e-13
WP_023223597.1|3476104_3476812_+	recombination protein	NA	K7PKU3	Enterobacteria_phage	97.9	1.8e-134
WP_023892127.1|3476812_3477328_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	95.3	1.9e-74
WP_023223613.1|3477336_3477885_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	97.3	2.4e-102
WP_023223614.1|3477901_3478198_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	99.0	5.0e-51
WP_001214448.1|3478208_3478376_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	96.4	1.1e-23
WP_000184762.1|3478372_3479017_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	98.6	8.2e-131
WP_023223615.1|3479013_3479649_+	ead/Ea22-like family protein	NA	Q6H9Z5	Enterobacteria_phage	94.1	5.7e-92
WP_023892125.1|3480480_3480741_+	hypothetical protein	NA	A0A077SLR0	Escherichia_phage	95.3	2.1e-40
WP_016049827.1|3480846_3481197_+	hypothetical protein	NA	I6R980	Salmonella_phage	100.0	3.2e-60
WP_023892124.1|3481426_3482590_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	97.2	7.4e-223
3482604:3482650	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
>prophage 11
NZ_CP019198	Salmonella enterica subsp. enterica serovar Muenster str. 0315 chromosome, complete genome	4879583	4601047	4666269	4879583	integrase,tail,lysis,portal,head,capsid,plate,holin,terminase,protease	Escherichia_phage(41.3%)	78	4630906:4630952	4661644:4661690
WP_000208240.1|4601047_4601578_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|4601587_4602919_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139642.1|4602985_4603915_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4604007_4604493_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4604714_4604954_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4605352_4606198_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_001523753.1|4606218_4607727_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250624.1|4607838_4608849_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796303.1|4608945_4609692_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155238.1|4609798_4610227_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802241.1|4610327_4610924_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|4611036_4611804_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_023137067.1|4611895_4612660_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|4612669_4612960_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_023137066.1|4613042_4613918_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4613946_4614969_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4614997_4615999_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|4615995_4617039_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|4617032_4618568_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4618823_4619783_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_023137065.1|4619871_4621464_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|4621477_4621828_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_072101541.1|4621917_4622055_-	CDP-diacylglycerol pyrophosphatase	NA	NA	NA	NA	NA
WP_000061014.1|4622064_4622229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001535809.1|4622326_4623049_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557882.1|4623111_4624152_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_023137064.1|4624161_4625121_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777307.1|4625131_4626466_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750757.1|4626728_4627484_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4627584_4628574_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4628777_4629740_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_023137063.1|4629924_4630827_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4630906:4630952	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|4631063_4631282_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882949.1|4631363_4632527_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_000978885.1|4632526_4633006_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_023223134.1|4633020_4635468_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.8	0.0e+00
WP_000785970.1|4635460_4635580_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4635612_4635888_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|4635944_4636463_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286720.1|4636475_4637666_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	4.8e-225
WP_010835363.1|4637725_4638319_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.8e-103
WP_022631136.1|4639125_4639659_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	80.3	5.7e-77
WP_010835343.1|4639663_4640281_-|tail	tail fiber assembly protein	tail	A0A1S6KZY8	Salmonella_phage	83.6	5.3e-95
WP_023210806.1|4640250_4641717_-|tail	phage tail-like protein	tail	A0A0F7LBW5	Escherichia_phage	84.6	1.1e-143
WP_023223103.1|4641773_4642325_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	1.5e-104
WP_001121478.1|4642317_4643226_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	100.0	8.8e-163
WP_000127163.1|4643230_4643578_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093737.1|4643574_4644210_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	9.0e-114
WP_001001780.1|4644276_4644729_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917156.1|4644721_4645189_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	8.7e-82
WP_001440152.1|4645151_4645325_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040673.1|4645296_4645722_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	4.7e-66
WP_000736607.1|4645709_4646135_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.8e-58
WP_001144101.1|4646149_4646647_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|4646646_4646928_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|4646931_4647135_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|4647134_4647644_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_023223104.1|4647743_4648487_-|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	98.0	3.1e-121
WP_001248558.1|4648490_4649564_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_001074420.1|4649622_4650477_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MF5	Enterobacteria_phage	99.6	2.2e-139
WP_000156844.1|4650650_4652423_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.8	0.0e+00
WP_006678249.1|4652422_4653457_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_023223105.1|4653797_4655630_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.5	4.1e-90
WP_023223106.1|4655746_4658029_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
WP_000027666.1|4658018_4658294_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	97.8	1.6e-43
WP_001113272.1|4658290_4658515_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	97.3	8.5e-35
WP_001277964.1|4658514_4658817_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	97.0	2.5e-45
WP_000288879.1|4658816_4659041_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	2.3e-32
WP_000217677.1|4659104_4659605_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001308179.1|4659774_4660047_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|4660183_4660477_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|4660546_4661527_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|4661712_4662213_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4661644:4661690	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|4662363_4663062_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4663058_4664432_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133441.1|4664482_4664878_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_077909921.1|4664889_4665642_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4665648_4666269_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
