The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019184	Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 chromosome, complete genome	4592393	1632993	1642164	4592393	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1632993_1633941_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1633924_1634656_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1634636_1634744_-	protein YohO	NA	NA	NA	NA	NA
WP_001240416.1|1634803_1635535_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272847.1|1635757_1637443_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.8e-278
WP_000598637.1|1637439_1638159_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950412.1|1638205_1638673_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	1.8e-74
WP_001221797.1|1638729_1639260_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703136.1|1639431_1639890_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_023217517.1|1640130_1642164_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.1	3.6e-55
>prophage 2
NZ_CP019184	Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 chromosome, complete genome	4592393	1804679	1811946	4592393		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1804679_1805099_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457654.1|1805101_1806370_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.9e-227
WP_000208509.1|1806824_1807037_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1807047_1807236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023217297.1|1807494_1808706_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	2.0e-109
WP_000107432.1|1809355_1809655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377042.1|1809746_1810442_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001633536.1|1810515_1811946_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	58.1	7.8e-105
>prophage 3
NZ_CP019184	Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 chromosome, complete genome	4592393	1915867	1925102	4592393	tail,integrase	Salmonella_phage(28.57%)	12	1910310:1910324	1921219:1921233
1910310:1910324	attL	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000856225.1|1915867_1916098_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_001633679.1|1916235_1916610_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_001633680.1|1916610_1917486_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1917502_1917856_+	YebY family protein	NA	NA	NA	NA	NA
WP_001633682.1|1918248_1919328_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.3e-100
WP_001530910.1|1919324_1920431_-	exodeoxyribonuclease 8 (exodeoxyribonuclease viii)	NA	Q9QF34	Lambdoid_phage	66.7	3.3e-55
WP_001014089.1|1920461_1920749_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	95.1	1.9e-39
WP_001633683.1|1920745_1921279_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	42.4	1.6e-10
1921219:1921233	attR	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000789530.1|1921535_1921703_-	lytic enzyme	NA	NA	NA	NA	NA
WP_024147269.1|1921767_1921950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348550.1|1922004_1922496_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	56.2	7.6e-44
WP_071785322.1|1924601_1925102_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	78.0	6.7e-64
>prophage 4
NZ_CP019184	Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 chromosome, complete genome	4592393	2099444	2106106	4592393		Salmonella_phage(33.33%)	9	NA	NA
WP_000230462.1|2099444_2100251_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2100252_2101245_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146139.1|2101244_2102135_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001605114.1|2102957_2103680_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	38.9	4.3e-35
WP_001096568.1|2104150_2104333_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	77.6	1.0e-22
WP_001605117.1|2104582_2104723_+	hypothetical protein	NA	A0A0U2KD26	Escherichia_phage	77.1	6.5e-09
WP_001605118.1|2104761_2105061_+	putative pertussis-like toxin subunit	NA	A0A0U2KD26	Escherichia_phage	54.3	3.2e-13
WP_000727928.1|2104987_2105413_+	peptidase	NA	NA	NA	NA	NA
WP_077905325.1|2105791_2106106_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 5
NZ_CP019184	Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 chromosome, complete genome	4592393	2574989	2582534	4592393	transposase	Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2574989_2575229_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036548.1|2575439_2575604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2576101_2576911_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_001277616.1|2576983_2577361_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.2e-14
WP_000158843.1|2577508_2578051_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_065348541.1|2578243_2578972_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.0	1.3e-60
WP_023217438.1|2578988_2579402_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	4.2e-19
WP_075995179.1|2580447_2581572_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_075995180.1|2582075_2582534_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	7.7e-14
>prophage 6
NZ_CP019184	Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 chromosome, complete genome	4592393	2885708	2894926	4592393	tail,integrase	Salmonella_phage(80.0%)	12	2883327:2883340	2902372:2902385
2883327:2883340	attL	TCAAGCTGACCGAT	NA	NA	NA	NA
WP_031603936.1|2885708_2886164_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	7.5e-62
WP_023212958.1|2888156_2889029_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	76.6	3.3e-114
WP_001633063.1|2888997_2889321_-	DUF3850 domain-containing protein	NA	A0A1S6KVH3	Escherichia_phage	45.9	6.2e-10
WP_001633062.1|2889317_2889545_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	88.0	2.4e-32
WP_023212957.1|2889537_2889756_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	93.8	9.2e-26
WP_023212956.1|2889823_2890165_-	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	95.6	4.8e-53
WP_071785514.1|2890209_2890329_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	94.9	2.5e-17
WP_023212955.1|2890336_2890846_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	88.2	2.9e-78
WP_023212954.1|2890878_2891100_-	regulator for prophage	NA	NA	NA	NA	NA
WP_001633058.1|2891195_2891786_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	40.3	6.1e-40
WP_023212953.1|2891813_2893802_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001633054.1|2893882_2894926_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	54.6	5.5e-100
2902372:2902385	attR	ATCGGTCAGCTTGA	NA	NA	NA	NA
>prophage 7
NZ_CP019184	Salmonella enterica subsp. enterica serovar Minnesota str. ATCC 49284 chromosome, complete genome	4592393	3193246	3231815	4592393	integrase,protease,portal,coat,lysis,holin	Salmonella_phage(59.02%)	65	3190751:3190797	3231829:3231875
3190751:3190797	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
WP_023217178.1|3193246_3193498_+	Arc family DNA-binding protein	NA	B8K1J0	Salmonella_phage	98.8	9.2e-38
WP_001085430.1|3193597_3193777_+	hypothetical protein	NA	B8K1I9	Salmonella_phage	100.0	2.1e-28
WP_000757526.1|3193790_3194156_-	hypothetical protein	NA	A0A192Y6W5	Salmonella_phage	100.0	2.1e-67
WP_023217179.1|3194190_3194676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023217180.1|3194914_3196828_-	hypothetical protein	NA	E7C9U6	Salmonella_phage	95.9	0.0e+00
WP_031603940.1|3196827_3198150_-	phage DNA ejection protein	NA	A0A220NR03	Salmonella_phage	96.6	1.3e-231
WP_023206221.1|3198192_3198882_-	hypothetical protein	NA	B9UDK9	Salmonella_phage	99.6	2.3e-102
WP_023206220.1|3198884_3199340_-	DUF2824 family protein	NA	E7C9U3	Salmonella_phage	99.3	5.2e-87
WP_023217182.1|3199339_3200041_-	hypothetical protein	NA	A0A0M4QWW6	Salmonella_phage	93.1	6.8e-70
WP_023217183.1|3200044_3201463_-	hypothetical protein	NA	E7C9U1	Salmonella_phage	97.5	4.7e-272
WP_001166101.1|3201422_3201923_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	98.8	5.5e-90
WP_023217184.1|3201906_3202467_-	hypothetical protein	NA	C6ZR11	Salmonella_phage	98.9	1.8e-102
WP_023217185.1|3202507_3203800_-|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.5	1.9e-243
WP_023217186.1|3203799_3204711_-	scaffolding protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	8.3e-161
WP_023217187.1|3204724_3206902_-|portal	portal protein	portal	A0A1R3Y5N6	Salmonella_virus	99.7	0.0e+00
WP_023217188.1|3206901_3208362_-	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.5	3.3e-220
WP_001629224.1|3208361_3208820_-	hypothetical protein	NA	A0A2P1MXF5	Escherichia_phage	66.2	3.3e-49
WP_023217189.1|3208832_3209237_-	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	9.0e-67
WP_023217190.1|3209239_3209482_-	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	98.8	1.9e-35
WP_023217191.1|3209839_3210361_-	phage protein	NA	K7P7K9	Enterobacteria_phage	98.8	2.5e-93
WP_023217192.1|3210579_3211017_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.2	7.2e-70
WP_023217193.1|3211105_3211603_-	lysozyme RrrD	NA	I6R0P2	Salmonella_phage	98.8	1.1e-90
WP_023135295.1|3211580_3211784_-|holin	holin	holin	I6R0S9	Salmonella_phage	98.5	1.5e-33
WP_001235461.1|3212459_3213083_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_023217194.1|3213079_3213268_-	hypothetical protein	NA	K7PH29	Enterobacteria_phage	98.4	5.5e-27
WP_001008200.1|3213264_3213627_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000002243.1|3213623_3213914_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001003984.1|3213913_3214636_-	DNA-binding protein	NA	K7P7L0	Enterobacteria_phage	99.6	7.1e-131
WP_023217195.1|3214628_3214805_-	hypothetical protein	NA	K7PGR9	Enterobacteria_phage	96.6	1.7e-25
WP_023217196.1|3214797_3215217_-	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	74.3	5.9e-53
WP_000113772.1|3215219_3215396_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000679702.1|3215362_3215536_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_023217197.1|3215532_3215979_-	recombination protein NinB	NA	A0A1R3Y605	Salmonella_virus	99.3	3.5e-80
WP_001748046.1|3215935_3216124_-	hypothetical protein	NA	A0A1R3Y6Z7	Salmonella_virus	93.5	1.5e-24
WP_024147251.1|3216126_3216420_-	hypothetical protein	NA	A0A220NQX3	Salmonella_phage	55.7	2.0e-20
WP_001227831.1|3216431_3216626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023217199.1|3216702_3218139_-	AAA family ATPase	NA	A0A220NQX0	Salmonella_phage	98.7	9.7e-273
WP_023217200.1|3218128_3219028_-	hypothetical protein	NA	A0A220NQX5	Salmonella_phage	98.3	1.4e-152
WP_001125981.1|3219020_3219167_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_001103492.1|3219201_3219483_-	hypothetical protein	NA	Q76H54	Enterobacteria_phage	100.0	4.3e-44
WP_000067726.1|3219593_3219809_-	helix-turn-helix transcriptional regulator	NA	A0A0M4RTV8	Salmonella_phage	100.0	4.1e-34
WP_000856894.1|3219927_3220590_+	LexA family transcriptional regulator	NA	A0A0M4QWY1	Salmonella_phage	99.5	1.7e-126
WP_000216186.1|3220940_3221243_+	hypothetical protein	NA	I6S5Z3	Salmonella_phage	94.0	4.5e-47
WP_001083253.1|3221324_3221825_+	HNH endonuclease	NA	A5H1L2	Xanthomonas_virus	44.5	5.2e-32
WP_000713611.1|3221858_3222146_+	hypothetical protein	NA	Q76H36	Enterobacteria_phage	98.9	7.8e-49
WP_023217201.1|3222453_3222768_+	Superinfection exclusion protein (protein gp17)	NA	E7C9Q4	Salmonella_phage	100.0	4.2e-56
WP_023217202.1|3222837_3223011_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	98.1	9.8e-23
WP_023217203.1|3222991_3223180_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	93.5	1.5e-29
WP_000902089.1|3223169_3223313_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	1.6e-18
WP_023217204.1|3223309_3224017_+	hypothetical protein	NA	Q76H40	Enterobacteria_phage	98.3	1.0e-137
WP_001253475.1|3224016_3224301_+	sigma-70 family RNA polymerase sigma factor	NA	E7C9P9	Salmonella_phage	100.0	2.3e-45
WP_023217205.1|3224347_3224641_+	DUF2856 family protein	NA	E7C9P8	Salmonella_phage	99.0	7.2e-50
WP_001214770.1|3224651_3224822_+	DUF2737 family protein	NA	I6S642	Salmonella_phage	100.0	6.1e-25
WP_023217206.1|3224818_3225361_+	hypothetical protein	NA	Q5G8U6	Enterobacteria_phage	75.9	6.4e-52
WP_049884219.1|3225390_3225996_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	85.6	8.6e-98
WP_023217208.1|3225992_3226340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023217209.1|3226336_3227197_+	DNA adenine methylase	NA	Q5QF26	Pseudomonas_virus	50.5	1.6e-68
WP_023217210.1|3227193_3227454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023217211.1|3227450_3227966_+	DUF262 domain-containing protein	NA	A0A2H4FWH2	Salmonella_phage	96.5	1.7e-94
WP_023217213.1|3228288_3228582_+	hypothetical protein	NA	A0A1V0E5L2	Salmonella_phage	97.9	7.2e-50
WP_023217214.1|3228578_3229307_+	hypothetical protein	NA	A0A1V0E5L6	Salmonella_phage	63.5	2.2e-71
WP_023217215.1|3229303_3229723_+	DUF551 domain-containing protein	NA	I6R0M4	Salmonella_phage	63.0	1.9e-64
WP_016049828.1|3229715_3230000_+	ASCH domain-containing protein	NA	I6S5Y4	Salmonella_phage	100.0	5.4e-50
WP_023217216.1|3230071_3230422_+	hypothetical protein	NA	I6R980	Salmonella_phage	98.3	3.9e-58
WP_075995182.1|3230651_3231815_+|integrase	site-specific integrase	integrase	B9UDL9	Salmonella_phage	97.9	3.0e-224
3231829:3231875	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGACCCACGGCTTAGAAG	NA	NA	NA	NA
