The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP012346	Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 chromosome, complete genome	4555576	1108781	1115533	4555576		Enterobacteria_phage(85.71%)	9	NA	NA
WP_001592532.1|1108781_1109282_-	hypothetical protein	NA	A0A2H4J2P5	uncultured_Caudovirales_phage	61.3	8.9e-40
WP_023209823.1|1109732_1112066_-	hypothetical protein	NA	Q7M2A8	Enterobacteria_phage	84.0	0.0e+00
WP_023209824.1|1112080_1112401_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216600.1|1112397_1112625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980374.1|1112621_1113170_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	9.7e-32
WP_001673700.1|1113166_1113433_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	73.9	3.6e-32
WP_000149860.1|1113970_1114708_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
WP_024146987.1|1114704_1114950_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	75.3	4.1e-30
WP_023209739.1|1114966_1115533_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	64.3	4.8e-58
>prophage 2
NZ_CP012346	Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 chromosome, complete genome	4555576	1118611	1185006	4555576	portal,lysis,transposase,capsid,head,tRNA,tail,plate,integrase,terminase	Salmonella_phage(87.23%)	68	1119980:1120027	1155309:1155356
WP_023209741.1|1118611_1119799_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.6	8.4e-105
1119980:1120027	attL	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000834152.1|1120140_1121352_-	hypothetical protein	NA	E5G6K9	Salmonella_phage	47.5	6.3e-108
WP_001528621.1|1121348_1122374_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.3	1.2e-192
WP_000616881.1|1122375_1123008_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	89.5	3.5e-102
WP_000102529.1|1123127_1123376_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	67.9	6.4e-23
WP_000460863.1|1123408_1123918_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	92.9	1.3e-83
WP_000794278.1|1124004_1124280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001528723.1|1124364_1124559_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	84.1	5.3e-25
WP_000963476.1|1124522_1124864_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	84.1	6.0e-48
WP_001178763.1|1124931_1125159_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	64.0	8.1e-17
WP_015406335.1|1125158_1125386_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	65.3	2.7e-20
WP_001528700.1|1125382_1126240_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	93.7	3.5e-153
WP_015406336.1|1126230_1128642_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	97.0	0.0e+00
WP_015406337.1|1128797_1128986_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	1.0e-25
WP_015406338.1|1128997_1129234_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	95.7	1.9e-29
WP_015406339.1|1129350_1130028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001655629.1|1130369_1131476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024138933.1|1131488_1131923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015406341.1|1131922_1132588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001655631.1|1132657_1133692_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	94.8	3.3e-182
WP_001098431.1|1133691_1135458_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_001655635.1|1135600_1136434_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
WP_001655636.1|1136450_1137533_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	96.3	8.5e-189
WP_015406342.1|1137536_1138190_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.9	1.3e-110
WP_000673541.1|1138285_1138750_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.8	7.9e-83
WP_000868184.1|1138749_1138953_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_000171565.1|1138956_1139172_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	100.0	5.9e-33
WP_001069919.1|1139152_1139662_+	lysozyme	NA	A0A1S6KZY9	Salmonella_phage	98.8	2.2e-94
WP_015406343.1|1139666_1140062_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	100.0	6.5e-62
WP_001655639.1|1140043_1140469_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	99.3	3.8e-68
WP_001039961.1|1140564_1140996_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	99.3	1.1e-75
WP_001655640.1|1140988_1141435_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	90.4	1.3e-66
WP_000993749.1|1141503_1142082_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	99.5	3.9e-108
WP_000177403.1|1142078_1142438_+|plate	baseplate assembly protein	plate	E5G6N7	Salmonella_phage	98.3	8.0e-59
WP_001655641.1|1142424_1143333_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	99.3	3.5e-159
WP_001086807.1|1143325_1143931_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	98.0	4.1e-116
WP_015406344.1|1143927_1145733_+|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	76.7	5.9e-227
WP_015406345.1|1145732_1146308_+|tail	tail fiber assembly protein	tail	E5G6P1	Salmonella_phage	97.9	2.4e-105
WP_072209236.1|1146904_1147153_-|tail	phage tail protein	tail	A0A1B0VCD0	Salmonella_phage	69.6	2.9e-23
WP_015406347.1|1147186_1147411_+	helix-turn-helix domain-containing protein	NA	E5G6P5	Salmonella_phage	97.3	1.2e-33
WP_015406348.1|1147513_1148686_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	99.5	5.7e-223
WP_001207652.1|1148695_1149211_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	98.8	7.9e-92
WP_001280967.1|1149265_1149568_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	99.0	9.4e-45
WP_000763317.1|1149582_1149702_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	8.8e-15
WP_015406349.1|1149694_1152502_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	99.5	0.0e+00
WP_000980409.1|1152498_1152984_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	99.2	8.3e-67
WP_001657019.1|1152980_1154081_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	98.6	4.5e-193
WP_000972388.1|1154147_1154366_+	hypothetical protein	NA	Q53ZE7	Salmonella_virus	76.4	8.3e-27
WP_001668082.1|1154650_1155241_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	75.9	4.4e-46
WP_072101449.1|1155744_1156908_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
1155309:1155356	attR	ATTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000196150.1|1156915_1159096_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.0	9.9e-19
WP_000533869.1|1159092_1160502_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_023212153.1|1160566_1172041_-	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_001518569.1|1172655_1173138_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_000242604.1|1173287_1173764_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001112990.1|1173753_1174044_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203445.1|1174204_1174543_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880965.1|1174691_1176353_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059155.1|1176438_1177317_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001518875.1|1177439_1178030_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_000502119.1|1178209_1178668_+|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_023212948.1|1178775_1179381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127172650.1|1179501_1180788_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001537507.1|1180807_1181599_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460052.1|1181764_1183126_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256453.1|1183378_1183627_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043266.1|1183645_1184194_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000469807.1|1184238_1185006_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP012346	Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 chromosome, complete genome	4555576	1670959	1680130	4555576	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1670959_1671907_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824854.1|1671890_1672622_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1672602_1672710_-	protein YohO	NA	NA	NA	NA	NA
WP_023212309.1|1672769_1673501_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.4	1.7e-100
WP_000272850.1|1673723_1675409_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1675405_1676125_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1676171_1676639_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_023137005.1|1676695_1677226_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703136.1|1677397_1677856_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	73.2	7.6e-54
WP_023212308.1|1678096_1680130_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP012346	Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 chromosome, complete genome	4555576	1747297	1757804	4555576		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001144954.1|1747297_1748701_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	28.2	3.1e-21
WP_023212543.1|1748878_1749772_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	3.6e-44
WP_000697846.1|1750148_1751234_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.6e-102
WP_015405858.1|1751233_1752133_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	6.7e-30
WP_015405859.1|1752180_1753059_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	2.7e-108
WP_000973709.1|1753059_1753611_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.3e-52
WP_001528498.1|1753616_1754591_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648785.1|1754606_1755380_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001528452.1|1755384_1756464_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	2.3e-16
WP_000126349.1|1756490_1757804_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP012346	Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 chromosome, complete genome	4555576	1847055	1854307	4555576		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1847055_1847475_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_023212516.1|1847477_1848746_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.4	6.4e-228
WP_000208509.1|1849200_1849413_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1849423_1849612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023212515.1|1849870_1851067_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.6	7.4e-109
WP_023212514.1|1851716_1852028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023212513.1|1852107_1852803_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.7	4.3e-08
WP_023212512.1|1852876_1854307_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	58.1	7.8e-105
>prophage 6
NZ_CP012346	Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 chromosome, complete genome	4555576	1956970	1965006	4555576	tail,integrase	Enterobacteria_phage(28.57%)	12	1951413:1951427	1962312:1962326
1951413:1951427	attL	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000856225.1|1956970_1957201_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_001633679.1|1957338_1957713_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_001633680.1|1957713_1958589_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1958605_1958959_+	YebY family protein	NA	NA	NA	NA	NA
WP_001633682.1|1959341_1960421_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	3.3e-100
WP_001530910.1|1960417_1961524_-	exodeoxyribonuclease 8 (exodeoxyribonuclease viii)	NA	Q9QF34	Lambdoid_phage	66.7	3.3e-55
WP_001655735.1|1961554_1961842_+	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.9	9.6e-39
WP_001633683.1|1961838_1962372_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	42.4	1.6e-10
1962312:1962326	attR	AATGACGTGTGAACG	NA	NA	NA	NA
WP_000789530.1|1962628_1962796_-	lytic enzyme	NA	NA	NA	NA	NA
WP_024134652.1|1962860_1963043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053296629.1|1963110_1963590_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	54.5	7.7e-41
WP_023212566.1|1964142_1965006_+|tail	phage tail protein	tail	Q1MVL8	Enterobacteria_phage	44.1	1.2e-52
>prophage 7
NZ_CP012346	Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 chromosome, complete genome	4555576	2137348	2144092	4555576		Salmonella_phage(28.57%)	10	NA	NA
WP_023212459.1|2137348_2138155_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	27.4	4.6e-14
WP_001128869.1|2138156_2139149_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_001146150.1|2139148_2140039_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_024138900.1|2140162_2140564_+	DUF4102 domain-containing protein	NA	K7PGY1	Enterobacteria_phage	58.4	1.1e-32
WP_023212458.1|2140943_2141666_-	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	39.3	1.1e-35
WP_001096568.1|2142136_2142319_+	hypothetical protein	NA	S4TSR3	Salmonella_phage	77.6	1.0e-22
WP_071825182.1|2142568_2142709_+	pertussis toxin subunit	NA	A0A0U2KD26	Escherichia_phage	74.3	3.2e-08
WP_001605118.1|2142747_2143047_+	putative pertussis-like toxin subunit	NA	A0A0U2KD26	Escherichia_phage	54.3	3.2e-13
WP_000727928.1|2142973_2143399_+	peptidase	NA	NA	NA	NA	NA
WP_077905325.1|2143777_2144092_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	86.1	4.3e-40
>prophage 8
NZ_CP012346	Salmonella enterica subsp. enterica serovar Panama str. ATCC 7378 chromosome, complete genome	4555576	2611442	2619720	4555576		Escherichia_phage(42.86%)	9	NA	NA
WP_000497451.1|2611442_2611682_+	virulence protein MsgA	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_001036548.1|2611892_2612057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001529135.1|2612554_2613364_+	cytolethal distending toxin S-CDT	NA	A5LH53	Enterobacteria_phage	50.0	2.1e-62
WP_023212261.1|2613436_2613814_+	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.4	2.8e-14
WP_000158843.1|2613961_2614504_-	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	67.0	6.2e-71
WP_000733630.1|2614696_2615425_-	pertussis-like toxin subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	52.5	1.6e-61
WP_023212262.1|2615441_2615855_-	subtilase cytotoxin subunit B	NA	A0A0U2KD34	Escherichia_phage	38.6	5.5e-19
WP_023212263.1|2616899_2618024_-	type III secretion system effector SopF	NA	NA	NA	NA	NA
WP_000444506.1|2618469_2619720_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	2.0e-19
