The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011396	Salmonella enterica subsp. enterica serovar Thompson str. ATCC 8391 isolate CFSAN000736 chromosome, complete genome	4690430	1675013	1684184	4690430	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1675013_1675961_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1675944_1676676_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1676656_1676764_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1676823_1677555_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1677777_1679463_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1679459_1680179_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1680225_1680693_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_017465874.1|1680749_1681280_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703143.1|1681451_1681910_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_000195330.1|1682150_1684184_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
NZ_CP011396	Salmonella enterica subsp. enterica serovar Thompson str. ATCC 8391 isolate CFSAN000736 chromosome, complete genome	4690430	1853797	1864413	4690430		Morganella_phage(25.0%)	12	NA	NA
WP_017465538.1|1853797_1854271_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	76.6	1.6e-38
WP_001736108.1|1854917_1855208_-	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
WP_017465540.1|1855579_1856377_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001532308.1|1856857_1857019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394197.1|1857145_1857565_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_017465541.1|1857567_1858836_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	3.5e-226
WP_000208509.1|1859290_1859503_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1859513_1859702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017465542.1|1859961_1861173_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	4.4e-109
WP_000107439.1|1861822_1862134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377042.1|1862213_1862909_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157305.1|1862982_1864413_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 3
NZ_CP011396	Salmonella enterica subsp. enterica serovar Thompson str. ATCC 8391 isolate CFSAN000736 chromosome, complete genome	4690430	4245193	4292265	4690430	tail,plate,tRNA	Burkholderia_phage(36.36%)	48	NA	NA
WP_017465897.1|4245193_4246192_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4246279_4247590_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4247836_4248352_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4248451_4248661_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4248682_4248796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128112.1|4248792_4250118_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4250296_4250905_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4251013_4251382_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4251552_4253973_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4254071_4254944_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4254957_4255455_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4255636_4256554_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_017465895.1|4256717_4258076_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4258164_4259274_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4259635_4260826_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382570.1|4260957_4262502_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4262516_4263407_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4263572_4263983_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750810.1|4264125_4266222_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977968.1|4266221_4266959_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_126489750.1|4266955_4267624_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4267657_4267900_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4268343_4269993_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4270337_4271687_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4271817_4272165_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4272741_4273029_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_017465893.1|4273031_4273637_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_017465892.1|4273649_4273964_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	1.1e-19
WP_000875314.1|4274575_4274773_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4274762_4276190_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4276189_4276714_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003639.1|4276765_4277083_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4277042_4277171_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262486.1|4277267_4279622_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	4.0e-66
WP_017465891.1|4279621_4280575_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_017465890.1|4280574_4280784_+	membrane protein	NA	A4JWL2	Burkholderia_virus	58.8	2.8e-16
WP_017465889.1|4280771_4281815_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	6.5e-77
WP_017465888.1|4281824_4282547_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4282874_4283237_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703628.1|4283233_4284163_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_001095011.1|4284162_4285710_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4285873_4286233_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951730.1|4286223_4287339_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_000359504.1|4287331_4287964_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_017465887.1|4287966_4289736_+|tail	tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.5	3.2e-52
WP_017465886.1|4289740_4290346_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_017465885.1|4290342_4290798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022544687.1|4291536_4292265_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	7.3e-35
>prophage 4
NZ_CP011396	Salmonella enterica subsp. enterica serovar Thompson str. ATCC 8391 isolate CFSAN000736 chromosome, complete genome	4690430	4407835	4473128	4690430	tail,portal,capsid,protease,holin,integrase,head	Cronobacter_phage(52.94%)	73	4437699:4437743	4468503:4468547
WP_000208240.1|4407835_4408366_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017465972.1|4408375_4409707_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139639.1|4409773_4410703_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|4410795_4411281_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|4411502_4411742_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|4412140_4412986_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|4413006_4414515_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|4414626_4415637_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796303.1|4415733_4416480_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155239.1|4416586_4417015_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802245.1|4417115_4417712_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|4417824_4418592_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_023198653.1|4418683_4419448_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|4419457_4419748_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774147.1|4419830_4420706_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|4420734_4421757_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|4421785_4422787_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911134.1|4422783_4423827_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167250.1|4423820_4425356_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|4425611_4426571_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|4426657_4428250_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173083.1|4428263_4428614_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000621105.1|4428703_4428835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000060995.1|4428850_4429021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023193107.1|4429118_4429841_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557878.1|4429903_4430944_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646510.1|4430953_4431913_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777314.1|4431923_4433258_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750755.1|4433521_4434277_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|4434377_4435367_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|4435570_4436533_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|4436717_4437620_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4437699:4437743	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_000802618.1|4438407_4440132_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	63.0	1.3e-175
WP_000083770.1|4440139_4440682_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	56.0	7.1e-43
WP_023198655.1|4440653_4441376_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	40.3	1.2e-40
WP_023198656.1|4441365_4441953_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	55.8	2.2e-58
WP_023198657.1|4441952_4443899_-|tail	side tail fiber protein	tail	F1BUK3	Cronobacter_phage	67.8	8.6e-123
WP_000134369.1|4443910_4444504_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	63.8	4.7e-72
WP_023198658.1|4444496_4445681_-	hypothetical protein	NA	F1BUK6	Cronobacter_phage	69.0	4.4e-154
WP_000102748.1|4445673_4446009_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	60.6	4.3e-30
WP_023198659.1|4446005_4448120_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	41.3	1.4e-139
WP_023198660.1|4448121_4448301_-	hypothetical protein	NA	A5X9I8	Aeromonas_virus	63.0	6.4e-09
WP_000042652.1|4448309_4448579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023198661.1|4448681_4449065_-	hypothetical protein	NA	A0A2I6PD12	Escherichia_phage	39.5	8.4e-06
WP_023198662.1|4449064_4449403_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.1	6.2e-45
WP_023198663.1|4449389_4449701_-|holin	phage holin	holin	NA	NA	NA	NA
WP_000140062.1|4449705_4450161_-	DUF2597 family protein	NA	A5X9I1	Aeromonas_virus	52.3	1.5e-38
WP_023198664.1|4450164_4451307_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	62.1	2.9e-131
WP_047020810.1|4451309_4451966_-	phage protein	NA	F1BUL6	Cronobacter_phage	58.9	8.6e-67
WP_000080428.1|4452001_4452478_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_023198666.1|4452474_4452948_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	54.3	9.3e-31
WP_023198667.1|4453050_4453752_-	hypothetical protein	NA	F1BUM0	Cronobacter_phage	57.1	2.6e-69
WP_023198668.1|4453754_4454777_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	55.4	1.9e-97
WP_023198669.1|4454805_4455867_-	hypothetical protein	NA	F1BUM4	Cronobacter_phage	44.3	2.9e-32
WP_023198670.1|4456044_4457856_+	hypothetical protein	NA	F1BUM5	Cronobacter_phage	54.5	4.3e-185
WP_023198671.1|4457852_4458914_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	60.7	8.8e-122
WP_052765805.1|4458961_4459228_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	57.6	4.3e-25
WP_126489749.1|4459258_4459867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001656626.1|4459871_4460921_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	32.5	5.4e-23
WP_023198675.1|4461143_4463759_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	37.8	5.4e-128
WP_023198677.1|4464848_4465238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023198678.1|4465253_4465475_-	DUF2724 domain-containing protein	NA	A0A0M4S6M9	Salmonella_phage	50.0	1.7e-11
WP_023198679.1|4465612_4465891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023198680.1|4466111_4466582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023198681.1|4466598_4466883_-	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	47.7	2.9e-19
WP_023198682.1|4466997_4467318_+	helix-turn-helix transcriptional regulator	NA	Q1JS83	Enterobacteria_phage	33.3	6.1e-10
WP_023198683.1|4467402_4468386_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	67.3	1.3e-119
WP_001233463.1|4468571_4469072_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4468503:4468547	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTG	NA	NA	NA	NA
WP_001033731.1|4469222_4469921_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|4469917_4471291_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133442.1|4471341_4471737_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011233226.1|4471748_4472501_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|4472507_4473128_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
