The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017728	Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 strain SGSC 2193 chromosome, complete genome	4819807	1220522	1297254	4819807	protease,lysis,capsid,terminase,tail,transposase,tRNA,integrase,holin,head,portal	Salmonella_phage(42.11%)	87	1213979:1213995	1303101:1303117
1213979:1213995	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000183639.1|1220522_1221203_-|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_001098732.1|1221275_1221695_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_000997368.1|1221898_1222936_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1223051_1223741_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1224059_1224443_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023139269.1|1224504_1225092_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001526875.1|1225194_1226094_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1226111_1227446_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083343.1|1227576_1228314_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989177.1|1228298_1229921_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_014344135.1|1230184_1230349_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1230345_1230921_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1230952_1231603_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1231602_1232559_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589087.1|1232555_1233035_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007939.1|1233532_1234762_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.4	2.9e-233
WP_001670787.1|1234739_1235024_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1235064_1235304_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1235346_1236504_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017125.1|1236466_1239394_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	99.3	0.0e+00
WP_001539619.1|1239520_1239871_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1239892_1240051_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_001009037.1|1240449_1240854_-	transcriptional regulator	NA	H6WRX4	Salmonella_phage	99.3	1.6e-71
WP_000869364.1|1240983_1241220_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	100.0	1.8e-38
WP_001574095.1|1241185_1241560_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000062941.1|1241644_1242628_+	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_000800010.1|1242630_1243380_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000113623.1|1243390_1243738_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	90.4	4.8e-53
WP_000065105.1|1243734_1244259_+	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	99.4	1.8e-91
WP_000445792.1|1244258_1244732_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	80.1	1.6e-67
WP_001217666.1|1245596_1245836_+	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	1.1e-37
WP_000929803.1|1246170_1246773_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	1.1e-108
WP_001096550.1|1246981_1247593_+	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	99.0	1.2e-91
WP_000801757.1|1247589_1247730_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1247726_1248404_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_000211410.1|1248676_1249240_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1249746_1249935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1250149_1250836_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1251111_1251441_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_015701345.1|1251424_1251877_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001533543.1|1251894_1252347_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1252582_1252984_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1253270_1253816_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1253787_1255719_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1255702_1255906_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1255902_1257483_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1257472_1258969_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1258981_1259329_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1259383_1260412_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1260469_1260829_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083294.1|1260839_1261223_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1261250_1261829_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1261877_1263008_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1263116_1263518_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1263525_1264272_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1264322_1264718_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1264714_1265053_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372065.1|1265024_1268120_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	1.7e-274
WP_000447369.1|1268122_1268452_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_071590651.1|1269166_1269904_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.6	2.6e-128
WP_023198525.1|1269801_1270449_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	3.5e-89
WP_000514917.1|1270510_1273873_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1273911_1274154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1274207_1276580_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1276576_1277401_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1277390_1277969_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1278065_1278293_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_001738443.1|1278399_1278612_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_001526383.1|1279364_1279484_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1280196_1280334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078097128.1|1280776_1282270_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	99.4	1.7e-259
WP_000790154.1|1282674_1284474_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1284490_1285465_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1285738_1286419_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1286415_1287321_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1287332_1288061_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1288072_1288804_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986043.1|1288803_1289184_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196290.1|1289295_1289556_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.4e-17
WP_001022463.1|1289593_1290520_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	3.0e-09
WP_001276370.1|1290635_1291832_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684022.1|1291853_1292771_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995703.1|1292809_1293658_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1293773_1294667_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1294677_1296039_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000253558.1|1296042_1296678_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134566.1|1296702_1297254_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1303101:1303117	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP017728	Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 strain SGSC 2193 chromosome, complete genome	4819807	1649940	1679534	4819807	protease,holin,tail	Salmonella_phage(41.67%)	31	NA	NA
WP_000781589.1|1649940_1650435_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1650848_1651340_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1651329_1651593_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1651589_1654076_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1654082_1654778_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_023198261.1|1654764_1655634_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1655749_1656199_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1656208_1656811_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888541.1|1656831_1657449_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	2.2e-11
WP_000990028.1|1657445_1658105_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000266008.1|1658156_1658894_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1658890_1659103_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1659099_1659579_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982518.1|1659575_1661507_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1661503_1662061_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_023198513.1|1662057_1663101_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1663144_1663792_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1664521_1665085_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1665276_1665480_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1665782_1666574_+|tail	tail fiber protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1666870_1667074_+|tail	tail protein	tail	NA	NA	NA	NA
WP_031602376.1|1669938_1670928_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.0	1.7e-188
WP_010989045.1|1670942_1671311_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894640.1|1671339_1672671_-	AAA family ATPase	NA	R9TRQ8	Vibrio_phage	28.5	2.1e-19
WP_001120499.1|1672967_1673297_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1673889_1675131_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1675133_1675661_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1676038_1676482_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000639473.1|1676535_1678365_-	acyltransferase	NA	C6ZR20	Salmonella_phage	29.6	3.0e-61
WP_000884778.1|1678712_1679003_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1679030_1679534_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 3
NZ_CP017728	Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 strain SGSC 2193 chromosome, complete genome	4819807	1751096	1760267	4819807	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569166.1|1751096_1752044_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
WP_023198442.1|1752027_1752759_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1752739_1752847_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1752906_1753638_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272845.1|1753860_1755546_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	6.2e-279
WP_000598637.1|1755542_1756262_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1756308_1756776_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197952.1|1756832_1757363_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1757534_1757993_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195332.1|1758233_1760267_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP017728	Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 strain SGSC 2193 chromosome, complete genome	4819807	1828575	1839081	4819807		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111841.1|1828575_1829979_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	27.1	3.1e-21
WP_000981469.1|1830156_1831050_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1831426_1832512_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1832511_1833411_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1833458_1834337_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1834337_1834889_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000018226.1|1834894_1835887_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648784.1|1835883_1836657_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1836661_1837741_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1837767_1839081_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 5
NZ_CP017728	Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 strain SGSC 2193 chromosome, complete genome	4819807	1925074	1975834	4819807	protease,lysis,terminase,plate,tail,integrase,holin,head,portal	Salmonella_phage(90.32%)	67	1919653:1919667	1936128:1936142
1919653:1919667	attL	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001219015.1|1925074_1925548_-	peptidase	NA	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	77.6	7.1e-39
WP_023139094.1|1926857_1927655_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000532847.1|1927946_1928936_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	100.0	8.6e-196
WP_001527041.1|1928937_1929165_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	100.0	3.2e-37
WP_001061334.1|1929204_1929774_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	100.0	7.1e-110
WP_000208068.1|1929777_1930611_-	hypothetical protein	NA	Q8HAA7	Salmonella_phage	100.0	4.7e-163
WP_000065095.1|1930607_1931225_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	100.0	2.6e-113
WP_000071070.1|1931221_1931737_-	DUF262 domain-containing protein	NA	Q8HAA5	Salmonella_phage	100.0	7.4e-98
WP_000764235.1|1931733_1931964_-	hypothetical protein	NA	Q8HAA4	Salmonella_phage	100.0	2.0e-34
WP_000008351.1|1932034_1932574_-	hypothetical protein	NA	A0A192Y8M4	Salmonella_phage	100.0	2.6e-98
WP_000080415.1|1932710_1933538_-	DUF2303 family protein	NA	Q8HAA2	Salmonella_phage	100.0	7.5e-153
WP_000997190.1|1933595_1933967_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	100.0	1.1e-63
WP_001020636.1|1934781_1935477_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	100.0	3.2e-128
WP_001191666.1|1935574_1935799_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_000509731.1|1935827_1936382_+	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
1936128:1936142	attR	AATCAGCGCCTGCTG	NA	NA	NA	NA
WP_001087402.1|1936378_1937536_+	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	100.0	4.2e-218
WP_000620702.1|1937532_1937757_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_000061500.1|1937753_1938572_+	helix-turn-helix domain-containing protein	NA	Q8HA96	Salmonella_phage	100.0	2.8e-136
WP_001684745.1|1938573_1939056_+	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	100.0	1.1e-87
WP_000066908.1|1939055_1939949_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	100.0	7.6e-175
WP_023139095.1|1939945_1940335_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8HA93	Salmonella_phage	99.2	2.4e-69
WP_001061457.1|1940351_1941212_+	KilA-N domain-containing protein	NA	Q8HA92	Salmonella_phage	100.0	2.9e-163
WP_001202277.1|1941219_1942209_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.6	4.9e-191
WP_000188927.1|1942219_1942843_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	100.0	9.1e-119
WP_001527054.1|1942975_1943233_+	hypothetical protein	NA	Q8HA88	Salmonella_phage	100.0	5.2e-44
WP_014343859.1|1943162_1943597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001527046.1|1943758_1944103_+|holin	phage holin, lambda family	holin	Q8HA87	Salmonella_phage	100.0	5.3e-44
WP_001005901.1|1944105_1944720_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	100.0	9.3e-116
WP_001050825.1|1944716_1945202_+|lysis	lysis protein	lysis	Q8HA85	Salmonella_phage	100.0	5.9e-81
WP_000877027.1|1945414_1945834_+	KilA-N domain-containing protein	NA	Q8HA84	Salmonella_phage	100.0	4.8e-71
WP_001292890.1|1946053_1946356_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	100.0	3.6e-52
WP_001135225.1|1946416_1946767_+	HNH endonuclease	NA	Q8HA82	Salmonella_phage	100.0	2.5e-65
WP_000929191.1|1946892_1947387_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	100.0	4.6e-89
WP_000088182.1|1947383_1949117_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	100.0	0.0e+00
WP_000605609.1|1949128_1949311_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	100.0	1.0e-25
WP_000466254.1|1949310_1950552_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	99.8	2.0e-242
WP_001193639.1|1950529_1951180_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	100.0	1.5e-119
WP_000601353.1|1952460_1952661_+	hypothetical protein	NA	Q8HAD1	Salmonella_phage	100.0	1.4e-28
WP_000927378.1|1952663_1952987_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A192Y8J4	Salmonella_phage	100.0	6.3e-55
WP_000702408.1|1952983_1953388_+|head	phage head closure protein	head	Q8HAC9	Salmonella_phage	100.0	1.4e-72
WP_001135697.1|1953359_1953872_+	hypothetical protein	NA	Q8HAC8	Salmonella_phage	100.0	4.6e-92
WP_000779218.1|1953868_1954429_+	hypothetical protein	NA	Q8HAC7	Salmonella_phage	100.0	3.0e-105
WP_000497739.1|1954432_1954597_+	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_001007991.1|1954586_1956083_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	Q8HAC5	Salmonella_phage	100.0	2.7e-278
WP_000515952.1|1956082_1956439_+|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_000588852.1|1956435_1956762_+|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000785385.1|1956846_1958775_+|tail	phage tail tape measure protein	tail	Q8HAC2	Salmonella_phage	99.8	0.0e+00
WP_000863818.1|1958808_1960149_+	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.6	5.7e-251
WP_001066636.1|1960145_1961204_+	hypothetical protein	NA	Q8HAC0	Salmonella_phage	100.0	1.3e-202
WP_001273649.1|1961203_1961737_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	100.0	1.4e-96
WP_000605050.1|1961741_1962155_+	phage GP46 family protein	NA	Q8HAB8	Salmonella_phage	100.0	1.1e-75
WP_014343856.1|1962126_1962672_+|plate	baseplate J/gp47 family protein	plate	Q8HAB7	Salmonella_phage	100.0	9.2e-99
WP_014343855.1|1962706_1963228_+|plate	baseplate J/gp47 family protein	plate	Q8HAB6	Salmonella_phage	100.0	2.9e-94
WP_001207832.1|1963230_1963818_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	100.0	2.9e-114
WP_000554736.1|1963804_1965367_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	99.8	7.5e-287
WP_015701331.1|1965336_1965936_+|tail	tail fiber assembly protein	tail	Q8HAB3	Salmonella_phage	100.0	5.9e-107
WP_071184450.1|1966220_1967228_-	type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	99.7	5.1e-196
WP_001526483.1|1967440_1967662_+	helix-turn-helix domain-containing protein	NA	Q8HAB1	Salmonella_phage	100.0	1.2e-36
WP_000500831.1|1968292_1968454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394196.1|1968580_1969000_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457662.1|1969002_1970271_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	4.2e-227
WP_000208509.1|1970725_1970938_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1970948_1971137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080680.1|1971397_1972594_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	1.8e-110
WP_000107430.1|1973243_1973543_+	membrane protein	NA	NA	NA	NA	NA
WP_000377041.1|1973634_1974330_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157322.1|1974403_1975834_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 6
NZ_CP017728	Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 strain SGSC 2193 chromosome, complete genome	4819807	2605116	2661542	4819807	protease,tail,transposase,tRNA,integrase	Saccharomonospora_phage(11.11%)	62	2649596:2649618	2659311:2659333
WP_000502119.1|2605116_2605575_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000758418.1|2605765_2607451_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	3.8e-34
WP_000290594.1|2607655_2608237_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_001221014.1|2608308_2609004_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128807.1|2609061_2610972_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	4.5e-92
WP_000029550.1|2611102_2611447_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|2611452_2611632_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000978464.1|2611712_2613077_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	35.0	1.9e-44
WP_000381544.1|2613080_2613659_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_001738311.1|2613922_2615287_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001192513.1|2615424_2617026_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_023139113.1|2617047_2618607_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_000150521.1|2619079_2620048_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406918.1|2620100_2620901_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001518647.1|2620913_2621765_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_023198370.1|2621822_2622278_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001518359.1|2622690_2623257_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010923.1|2623253_2624063_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000730322.1|2624128_2625874_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|2626093_2626303_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001537930.1|2626315_2626459_-	YobF family protein	NA	NA	NA	NA	NA
WP_001000660.1|2627107_2627395_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714547.1|2627465_2627609_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001236777.1|2627766_2628006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262195.1|2628217_2629009_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_000416128.1|2629184_2630558_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984498.1|2630605_2631487_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_000502119.1|2631753_2632212_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_001091237.1|2632391_2634440_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|2634459_2635146_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|2635243_2635741_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|2635869_2637153_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_023198371.1|2637121_2639755_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001542138.1|2639832_2641272_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131108.1|2641389_2641626_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457836.1|2641736_2641928_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986176.1|2641946_2642597_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134856.1|2642820_2642985_-	membrane protein	NA	NA	NA	NA	NA
WP_000182072.1|2643269_2643992_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422882.1|2644675_2645071_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	9.2e-16
WP_000030934.1|2645400_2645877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354408.1|2646264_2646684_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001752421.1|2647053_2647323_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|2647488_2647629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000684835.1|2649092_2649461_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	39.8	5.4e-18
2649596:2649618	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_001233446.1|2650764_2651679_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|2651811_2651970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|2651979_2652594_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_001520350.1|2653081_2653228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000457876.1|2653741_2653867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989029.1|2654436_2654637_+	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000275418.1|2654733_2655615_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_001521334.1|2656087_2656276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789530.1|2656340_2656508_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050882.1|2656764_2657298_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	48.3	1.4e-11
WP_001013467.1|2657351_2657582_-	hypothetical protein	NA	Q8HA86	Salmonella_phage	93.7	6.1e-28
WP_010989030.1|2657771_2658266_+	hypothetical protein	NA	A0A0U2I1R6	Escherichia_phage	68.9	8.2e-22
WP_176731523.1|2658337_2659180_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.9	3.3e-71
WP_000722368.1|2659553_2659907_-	YebY family protein	NA	NA	NA	NA	NA
2659311:2659333	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_000979702.1|2659923_2660799_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168393.1|2660799_2661174_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|2661311_2661542_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
>prophage 7
NZ_CP017728	Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 strain SGSC 2193 chromosome, complete genome	4819807	2876268	2960985	4819807	protease,lysis,terminase,tail,tRNA,holin,portal	Salmonella_phage(44.44%)	92	NA	NA
WP_000938191.1|2876268_2876949_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374050.1|2877569_2878229_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	51.9	2.3e-43
WP_000904446.1|2878315_2878645_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2878641_2878923_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2878971_2879751_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000859419.1|2879776_2880325_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2880539_2881751_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2881808_2882126_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2882170_2882584_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2882757_2883420_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2883514_2883973_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2884008_2886063_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2886186_2886633_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2886651_2888805_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2888791_2889397_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2889613_2890123_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2890479_2891532_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2891603_2892056_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156453.1|2892241_2894002_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2894070_2894589_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2894688_2894856_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2895111_2895675_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2895671_2897312_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2897316_2898570_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2898584_2900492_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2900504_2902613_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2902711_2903821_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001220671.1|2903817_2904360_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2904525_2905536_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2905743_2908356_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
WP_000497441.1|2908782_2908974_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|2909244_2909931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|2909915_2910215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|2910283_2910910_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001533476.1|2911557_2912526_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	99.7	7.9e-194
WP_000143167.1|2913001_2913583_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|2913582_2916021_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|2916074_2916317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|2916355_2919706_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000246065.1|2919777_2920482_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|2920379_2921117_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|2921126_2921822_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|2921911_2922445_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|2922561_2923059_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|2923157_2923490_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|2923486_2926474_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|2926553_2926883_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|2926879_2927278_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|2927323_2928073_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|2928084_2928486_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|2928482_2929049_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|2929029_2929329_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2929321_2929645_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|2929735_2931817_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_001009207.1|2931740_2933288_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	64.3	2.8e-177
WP_000196190.1|2933284_2933491_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_078097134.1|2933487_2935623_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.3	1.2e-287
WP_000371784.1|2935579_2936113_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|2936320_2936800_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_015701345.1|2936817_2937270_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.0	1.0e-79
WP_001574216.1|2937253_2937583_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001110783.1|2937858_2938545_+|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_000798705.1|2938889_2939339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2939474_2939600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|2939773_2940091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023139173.1|2940157_2940955_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.2	5.8e-150
WP_001617856.1|2940944_2941091_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|2941087_2941699_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_000929805.1|2941907_2942510_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|2942592_2942814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|2942925_2943159_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|2943450_2943741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|2943818_2944130_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|2944126_2944474_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|2944484_2945234_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|2945236_2946220_-	replication protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|2946304_2946679_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|2946644_2946884_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|2947003_2947414_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|2947463_2947724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|2947716_2947875_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|2947896_2948196_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_071184461.1|2948322_2951208_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	97.2	0.0e+00
WP_001539618.1|2951170_2952328_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2952370_2952610_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2952650_2952899_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|2952943_2954236_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191399.1|2954430_2955633_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893207.1|2955710_2957147_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2957391_2958606_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2958922_2959384_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2959584_2960985_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
>prophage 8
NZ_CP017728	Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 strain SGSC 2193 chromosome, complete genome	4819807	3025151	3033883	4819807	protease,transposase	Enterobacteria_phage(14.29%)	7	NA	NA
WP_085983316.1|3025151_3026406_+|transposase	IS3-like element ISSen1 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.9	5.4e-17
WP_000502119.1|3026869_3027328_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|3027519_3029796_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3029826_3030147_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3030470_3030692_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125877.1|3030821_3032768_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	43.1	2.0e-39
WP_001201749.1|3032764_3033883_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
>prophage 9
NZ_CP017728	Salmonella enterica subsp. enterica serovar Typhimurium str. SARA13 strain SGSC 2193 chromosome, complete genome	4819807	4399787	4444306	4819807	plate,holin,tRNA,tail	Burkholderia_phage(42.86%)	46	NA	NA
WP_001182237.1|4399787_4400786_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039339.1|4400873_4402184_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4402431_4402947_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4403045_4403255_-	CsbD family protein	NA	NA	NA	NA	NA
WP_010989093.1|4403276_4403390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128116.1|4403386_4404712_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4404890_4405499_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002902.1|4405607_4405976_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017359.1|4406146_4408567_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4408665_4409538_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4409551_4410049_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782504.1|4410229_4411147_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973645.1|4411310_4412669_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4412757_4413867_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_023198113.1|4414228_4415419_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4415550_4417095_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4417109_4418000_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4418165_4418576_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4418718_4420815_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4420814_4421552_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_014343934.1|4421548_4422217_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4422250_4422493_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4422936_4424586_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4424930_4426280_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4426412_4426760_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4427335_4427623_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4427625_4428231_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4428243_4428558_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4428717_4429173_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_000875314.1|4429169_4429367_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_001741803.1|4429356_4430784_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.7	1.5e-193
WP_000907494.1|4430783_4431308_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003642.1|4431359_4431677_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4431636_4431765_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262500.1|4431861_4434216_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	6.9e-66
WP_000271423.1|4434215_4435169_+	methyl-accepting chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4435168_4435378_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4435365_4436409_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_023139147.1|4436418_4437141_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4437468_4437831_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_023139146.1|4437827_4438757_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.4	2.0e-149
WP_001095011.1|4438756_4440304_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4440467_4440827_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951736.1|4440817_4441933_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	1.8e-101
WP_000359500.1|4441925_4442558_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	6.6e-24
WP_023139145.1|4442560_4444306_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	51.7	5.5e-52
