The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019176	Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 strain SGSC 2215 chromosome, complete genome	4751206	1618435	1648021	4751206	protease,tail,holin	Salmonella_phage(33.33%)	31	NA	NA
WP_001538284.1|1618435_1618930_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_000228070.1|1619343_1619835_+	ferredoxin-type protein NapF	NA	NA	NA	NA	NA
WP_001260058.1|1619824_1620088_+	chaperone NapD	NA	NA	NA	NA	NA
WP_000778097.1|1620084_1622571_+	nitrate reductase catalytic subunit NapA	NA	NA	NA	NA	NA
WP_000091673.1|1622577_1623273_+	ferredoxin-type protein NapG	NA	NA	NA	NA	NA
WP_000013529.1|1623259_1624129_+	quinol dehydrogenase ferredoxin subunit NapH	NA	NA	NA	NA	NA
WP_000835182.1|1624244_1624694_+	nitrate reductase cytochrome c-type subunit	NA	NA	NA	NA	NA
WP_000431778.1|1624703_1625306_+	cytochrome c-type protein NapC	NA	NA	NA	NA	NA
WP_000888542.1|1625326_1625944_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2R8FG22	Brazilian_cedratvirus	29.8	1.1e-10
WP_000990032.1|1625940_1626600_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_000265997.1|1626651_1627389_+	heme ABC transporter permease	NA	NA	NA	NA	NA
WP_000074110.1|1627385_1627598_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_001053618.1|1627594_1628074_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_000982517.1|1628070_1630002_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_000828296.1|1629998_1630556_+	thiol:disulfide interchange protein DsbE	NA	NA	NA	NA	NA
WP_001238312.1|1630552_1631596_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_001115498.1|1631639_1632287_-	nitrate/nitrite response regulator protein NarP	NA	NA	NA	NA	NA
WP_000281877.1|1633016_1633580_+	acyloxyacyl hydrolase	NA	NA	NA	NA	NA
WP_001653202.1|1633771_1633975_-	virulence protein MsgA	NA	NA	NA	NA	NA
WP_000624225.1|1634277_1635069_+|tail	tail protein	tail	Q1MVL8	Enterobacteria_phage	31.6	1.7e-48
WP_001113462.1|1635365_1635569_+|tail	tail protein	tail	NA	NA	NA	NA
WP_001115840.1|1635737_1638104_+	SPI-2 type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.7	2.9e-72
WP_001202279.1|1638432_1639422_+	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	97.3	6.0e-189
WP_010989045.1|1639436_1639805_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_000894638.1|1639833_1641165_-	NTPase	NA	R9TRQ8	Vibrio_phage	28.5	4.6e-19
WP_001120499.1|1641461_1641791_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	94.6	3.9e-36
WP_000554739.1|1642383_1643625_+	hypothetical protein	NA	Q8HAB4	Salmonella_phage	95.3	1.0e-52
WP_001215679.1|1643627_1644155_+|tail	tail fiber assembly protein	tail	A0A1S6KZZ1	Salmonella_phage	31.3	3.1e-11
WP_000022213.1|1644532_1644976_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	43.9	1.4e-28
WP_000884778.1|1647199_1647490_-	DinI family protein	NA	S4TND2	Salmonella_phage	83.3	4.7e-25
WP_000806401.1|1647517_1648021_+	LexA family transcriptional regulator	NA	Q1MVE7	Enterobacteria_phage	71.3	9.5e-50
>prophage 2
NZ_CP019176	Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 strain SGSC 2215 chromosome, complete genome	4751206	1720071	1729242	4751206	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569165.1|1720071_1721019_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
WP_000824857.1|1721002_1721734_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1721714_1721822_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|1721881_1722613_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1722835_1724521_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1724517_1725237_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1725283_1725751_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1725807_1726338_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1726509_1726968_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1727208_1729242_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP019176	Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 strain SGSC 2215 chromosome, complete genome	4751206	1799097	1808021	4751206		Enterobacteria_phage(42.86%)	8	NA	NA
WP_000981469.1|1799097_1799991_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1800367_1801453_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023662.1|1801452_1802352_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.3	1.4e-30
WP_000857529.1|1802399_1803278_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	9.3e-109
WP_000973708.1|1803278_1803830_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	2.2e-52
WP_000648784.1|1804823_1805597_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565905.1|1805601_1806681_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.1	6.6e-16
WP_000126349.1|1806707_1808021_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	7.0e-52
>prophage 4
NZ_CP019176	Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 strain SGSC 2215 chromosome, complete genome	4751206	1897362	1904614	4751206		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1897362_1897782_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457664.1|1897784_1899053_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.2e-226
WP_000208509.1|1899507_1899720_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1899730_1899919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080662.1|1900176_1901373_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107434.1|1902023_1902335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377037.1|1902414_1903110_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	1.6e-07
WP_001157304.1|1903183_1904614_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	7.8e-105
>prophage 5
NZ_CP019176	Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 strain SGSC 2215 chromosome, complete genome	4751206	2803721	2887627	4751206	protease,transposase,terminase,lysis,integrase,portal,tail,tRNA	Salmonella_phage(47.27%)	94	2835916:2835934	2880913:2880931
WP_000938191.1|2803721_2804402_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	70.6	8.3e-81
WP_000374046.1|2805022_2805682_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2805768_2806098_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2806094_2806376_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548082.1|2806424_2807204_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2807229_2807778_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2807992_2809204_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2809261_2809579_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2809623_2810037_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847716.1|2810210_2810873_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2810967_2811426_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420505.1|2811461_2813516_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2813639_2814086_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950880.1|2814104_2816258_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2816244_2816850_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2817066_2817576_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2817932_2818985_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2819056_2819509_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156454.1|2819694_2821455_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2821523_2822042_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2822141_2822309_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2822564_2823128_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433414.1|2823124_2824765_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2824769_2826023_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2826037_2827945_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2827957_2830066_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224069.1|2830164_2831274_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2831270_2831813_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2831978_2832989_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193784.1|2833196_2835809_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	6.3e-20
2835916:2835934	attL	GCTACATTTTTATAACATG	NA	NA	NA	NA
WP_071531551.1|2836243_2836741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343758.1|2836737_2837958_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_000388788.1|2838177_2838396_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	89.7	1.7e-24
WP_000161705.1|2838608_2839331_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143158.1|2839527_2840109_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_031618324.1|2840098_2840419_-	hypothetical protein	NA	A0A0M4QWS3	Salmonella_phage	79.2	4.9e-44
WP_001532020.1|2840919_2843295_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	64.9	1.9e-87
WP_000178849.1|2843348_2843591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077906512.1|2843629_2844505_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	78.8	2.6e-50
WP_020867839.1|2847051_2847756_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	2.0e-66
WP_000606356.1|2847653_2848391_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	75.6	5.2e-113
WP_001152416.1|2848400_2849096_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.0e-89
WP_000877926.1|2849185_2849719_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000410972.1|2849808_2850333_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	35.3	1.8e-19
WP_000978295.1|2850431_2850764_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	2.6e-35
WP_065305406.1|2850760_2853748_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.0	2.5e-262
WP_010989009.1|2853827_2854157_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478858.1|2854153_2854552_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132755.1|2854597_2855347_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196703.1|2855358_2855760_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	2.0e-42
WP_000453192.1|2855756_2856323_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	95.7	2.1e-13
WP_000774239.1|2856303_2856603_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|2856595_2856919_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_001009205.1|2859010_2860558_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	63.8	1.1e-176
WP_000196190.1|2860554_2860761_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989238.1|2860757_2862896_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	6.9e-291
WP_000371784.1|2862852_2863386_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001080030.1|2863596_2864091_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.3	2.2e-59
WP_000301013.1|2864398_2864938_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	72.4	2.2e-76
WP_001682303.1|2864915_2865218_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658038.1|2865420_2865609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000508329.1|2865889_2866108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|2866274_2867072_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|2867061_2867208_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096547.1|2867204_2867816_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_000929790.1|2868024_2868627_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.5	7.5e-110
WP_014343878.1|2868661_2868910_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2869026_2869260_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000877758.1|2869490_2870135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208143.1|2870242_2870644_-	hypothetical protein	NA	I6R0R2	Salmonella_phage	82.0	1.2e-18
WP_000224239.1|2870654_2870912_-	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	95.3	4.5e-40
WP_000215887.1|2870913_2871447_-	hypothetical protein	NA	A0A192Y7N1	Salmonella_phage	89.8	8.1e-92
WP_023602525.1|2871443_2871845_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	98.5	5.4e-72
WP_000788826.1|2871889_2872591_-	hypothetical protein	NA	A0A0M3ULE2	Salmonella_phage	99.1	1.9e-128
WP_000024046.1|2872587_2873493_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	99.7	9.1e-176
WP_015675517.1|2873584_2873959_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	1.9e-63
WP_000992434.1|2873924_2874161_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_001230956.1|2874265_2874661_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_000439725.1|2874703_2875129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000091280.1|2875130_2875565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000373338.1|2875591_2875798_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	67.6	1.6e-16
WP_000186242.1|2876085_2876286_+	cell division protein FtsZ	NA	G8C7T2	Escherichia_phage	48.4	2.4e-12
WP_000995352.1|2876376_2876673_+	host-nuclease inhibitor protein Gam	NA	A0A0M5M5Z9	Salmonella_phage	100.0	1.1e-48
WP_000100830.1|2876678_2877464_+	phage recombination protein Bet	NA	A0A0M4RD39	Salmonella_phage	98.8	2.4e-148
WP_000187054.1|2877460_2878141_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	97.8	3.3e-130
WP_000189634.1|2878137_2879007_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	86.3	7.2e-146
WP_001682304.1|2879012_2879252_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	3.3e-37
WP_000065276.1|2879292_2879541_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2879585_2880878_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_000191413.1|2881072_2882275_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
2880913:2880931	attR	GCTACATTTTTATAACATG	NA	NA	NA	NA
WP_000893206.1|2882355_2883789_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544849.1|2884033_2885248_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2885564_2886026_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|2886226_2887627_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
>prophage 6
NZ_CP019176	Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 strain SGSC 2215 chromosome, complete genome	4751206	2952286	2960239	4751206	protease,transposase	Ralstonia_phage(14.29%)	8	NA	NA
WP_001531374.1|2952286_2952664_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	40.2	1.7e-19
WP_001117984.1|2952825_2953023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000502119.1|2953296_2953755_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.0e-13
WP_000934063.1|2953944_2956221_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|2956251_2956572_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|2956895_2957117_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125890.1|2957246_2959193_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_071591206.1|2959189_2960239_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.3e-08
>prophage 7
NZ_CP019176	Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 strain SGSC 2215 chromosome, complete genome	4751206	3564238	3607834	4751206	protease,terminase,lysis,coat,integrase,portal	Enterobacteria_phage(44.44%)	64	3564678:3564723	3603943:3603988
WP_001683918.1|3564238_3564514_-	DUF4102 domain-containing protein	NA	Q7M297	Enterobacteria_phage	64.1	1.9e-23
3564678:3564723	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000915528.1|3565011_3565374_+	GtrA family protein	NA	A0A192Y6N5	Salmonella_phage	100.0	5.0e-61
WP_000703640.1|3565370_3566303_+	glycosyltransferase family 2 protein	NA	A0A192Y8W7	Salmonella_phage	100.0	5.5e-176
WP_000671495.1|3566292_3567750_+	hypothetical protein	NA	A0A192Y7W8	Salmonella_phage	100.0	4.5e-241
WP_000129930.1|3567808_3569812_-	endorhamnosidase	NA	A0A2H4FWI0	Salmonella_phage	99.9	0.0e+00
WP_000287064.1|3569947_3570202_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	63.3	4.4e-19
WP_000749288.1|3570604_3571090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001029838.1|3571180_3573178_-	hypothetical protein	NA	Q716G2	Shigella_phage	94.9	0.0e+00
WP_000246945.1|3573177_3574473_-	phage DNA ejection protein	NA	Q716G3	Shigella_phage	84.5	2.1e-181
WP_000964902.1|3574482_3575175_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	98.7	1.2e-108
WP_000627697.1|3575177_3575633_-	DUF2824 family protein	NA	A0A192Y6V9	Salmonella_phage	100.0	5.2e-87
WP_000774927.1|3575632_3576334_-	hypothetical protein	NA	A0A192Y6T9	Salmonella_phage	100.0	8.8e-78
WP_001122424.1|3576337_3577756_-	Packaged DNA stabilization protein gp10	NA	A0A075B8I2	Enterobacteria_phage	100.0	7.6e-278
WP_001166098.1|3577715_3578216_-	packaged DNA stabilization protein p27	NA	I1TEJ0	Salmonella_phage	99.4	5.5e-90
WP_000684729.1|3578199_3578409_-	hypothetical protein	NA	A0A192Y697	Salmonella_phage	100.0	1.3e-32
WP_001196938.1|3578447_3579740_-|coat	coat protein	coat	A0A192Y6V4	Salmonella_phage	100.0	3.2e-243
WP_000433852.1|3579739_3580651_-	scaffold protein	NA	A0A192Y6T4	Salmonella_phage	100.0	4.9e-161
WP_000774656.1|3580664_3582842_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	99.9	0.0e+00
WP_000417849.1|3582841_3584341_-|terminase	terminase	terminase	A0A192Y824	Salmonella_phage	99.8	1.4e-306
WP_000729925.1|3584318_3584807_-	hypothetical protein	NA	O80290	Bacteriophage	100.0	2.9e-88
WP_001278047.1|3584830_3585010_-	hypothetical protein	NA	Q9AZ02	Salmonella_phage	91.5	3.0e-22
WP_000807785.1|3585011_3585254_-	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_001177703.1|3585556_3586243_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	99.6	4.7e-124
WP_001531485.1|3586455_3586893_-|lysis	lysis protein	lysis	O80289	Bacteriophage	99.3	9.1e-73
WP_000074137.1|3586981_3587479_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	97.0	6.0e-89
WP_000286100.1|3587456_3587660_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001235453.1|3588098_3588722_-	antitermination protein	NA	A0A075B8H9	Enterobacteria_phage	100.0	2.3e-114
WP_000219131.1|3588718_3588898_-	hypothetical protein	NA	A0A1U8QR34	Salmonella_phage	100.0	1.4e-24
WP_000149925.1|3588878_3589082_-	protein ninH	NA	A0A075B8J4	Enterobacteria_phage	100.0	7.2e-33
WP_000036317.1|3589078_3589303_-	hypothetical protein	NA	Q5G8R9	Enterobacteria_phage	100.0	2.2e-38
WP_001129733.1|3589299_3589911_-	recombination protein NinG	NA	A0A075B8E9	Enterobacteria_phage	100.0	1.3e-98
WP_000950959.1|3589903_3590080_-	protein ninF	NA	I6S668	Salmonella_phage	100.0	2.5e-26
WP_001531428.1|3590072_3590405_-	DUF2591 domain-containing protein	NA	A0A075B8G3	Enterobacteria_phage	100.0	3.5e-61
WP_000113772.1|3590407_3590584_-	NinE family protein	NA	I6RSQ2	Salmonella_phage	100.0	4.6e-28
WP_000679702.1|3590550_3590724_-	hypothetical protein	NA	C6ZR56	Salmonella_phage	100.0	5.2e-32
WP_000736921.1|3590720_3591158_-	recombination protein NinB	NA	A8CGE3	Salmonella_phage	100.0	1.3e-79
WP_001248406.1|3591231_3592608_-	DNA helicase	NA	A0A075B8G2	Enterobacteria_phage	100.0	3.3e-254
WP_000067075.1|3592604_3593420_-	replication protein	NA	A0A075B8J2	Enterobacteria_phage	100.0	9.4e-148
WP_001125981.1|3593412_3593559_-	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_000424167.1|3593593_3593872_-	transcriptional regulator	NA	Q5G8T2	Enterobacteria_phage	100.0	2.5e-44
WP_000276884.1|3593978_3594164_-	hypothetical protein	NA	Q5G8T3	Enterobacteria_phage	100.0	5.4e-27
WP_001095984.1|3594244_3594895_+	LexA family transcriptional regulator	NA	B1B6L9	Salmonella_phage	100.0	5.4e-122
WP_000216175.1|3595248_3595551_+	hypothetical protein	NA	B8K1E6	Salmonella_phage	98.0	1.1e-48
WP_001682202.1|3595571_3596150_-	superinfection exclusion protein B	NA	A0A075B8E6	Enterobacteria_phage	100.0	8.8e-92
WP_000213983.1|3596364_3596559_+	hypothetical protein	NA	A0A075B8G0	Enterobacteria_phage	100.0	2.5e-30
WP_000651935.1|3596595_3596832_+	hypothetical protein	NA	A0A075B8J0	Enterobacteria_phage	100.0	4.3e-37
WP_001737461.1|3596831_3597035_+	DUF551 domain-containing protein	NA	A0A0N7CAQ5	Salmonella_phage	100.0	1.7e-34
WP_000776964.1|3597182_3597494_+	superinfection exclusion protein	NA	A0A075B8E5	Enterobacteria_phage	100.0	1.1e-48
WP_000582314.1|3597579_3597738_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A075B8H4	Enterobacteria_phage	100.0	4.0e-23
WP_000158027.1|3597718_3597907_+	DUF5444 family protein	NA	A0A075B8F9	Enterobacteria_phage	100.0	1.4e-30
WP_001163402.1|3597896_3598040_+	hypothetical protein	NA	A0A075B8I9	Enterobacteria_phage	100.0	3.2e-19
WP_000031375.1|3598036_3598654_+	ERF family protein	NA	A0A0N7CFJ3	Salmonella_phage	100.0	3.3e-105
WP_001111313.1|3598984_3599281_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	90.8	3.9e-43
WP_001682200.1|3599291_3599456_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	1.6e-22
WP_000812182.1|3599452_3600079_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	71.2	7.1e-71
WP_001289978.1|3600075_3600561_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	86.1	1.3e-43
WP_000224223.1|3600562_3600826_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	2.0e-30
WP_000208013.1|3600836_3601523_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.2	4.3e-53
WP_001277769.1|3601619_3601799_+	Eag protein	NA	A0A075B8F7	Enterobacteria_phage	98.3	1.6e-28
WP_000016640.1|3601899_3602535_+	hypothetical protein	NA	A0A075B8I7	Enterobacteria_phage	99.5	1.3e-120
WP_000051900.1|3602764_3603928_+|integrase	site-specific integrase	integrase	A0A075B8E2	Enterobacteria_phage	99.7	2.4e-229
WP_000893221.1|3604133_3605384_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	48.2	2.1e-98
3603943:3603988	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285275.1|3605395_3606499_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_001043660.1|3606781_3607834_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.5	2.2e-112
>prophage 8
NZ_CP019176	Salmonella enterica subsp. enterica serovar Heidelberg str. SARA35 strain SGSC 2215 chromosome, complete genome	4751206	4349532	4397053	4751206	plate,tail,tRNA	Burkholderia_phage(40.91%)	50	NA	NA
WP_001182224.1|4349532_4350531_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039342.1|4350618_4351929_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4352175_4352691_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4352789_4352999_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4353020_4353134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128112.1|4353130_4354456_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4354634_4355243_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4355351_4355720_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4355890_4358311_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4358409_4359282_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4359295_4359793_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4359973_4360891_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973681.1|4361054_4362413_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4362501_4363611_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4363972_4365163_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4365294_4366839_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4366853_4367744_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4367909_4368320_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4368462_4370559_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977979.1|4370558_4371296_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_022742863.1|4371292_4371961_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4371994_4372237_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790037.1|4372680_4374330_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4374674_4376024_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4376156_4376504_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4377079_4377367_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4377369_4377975_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4377987_4378302_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4378461_4378917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4378913_4379111_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4379100_4380528_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907497.1|4380527_4381052_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	2.3e-67
WP_001003642.1|4381103_4381421_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4381380_4381509_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262499.1|4381605_4383960_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.6	9.0e-66
WP_000271420.1|4383959_4384913_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4384912_4385122_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818154.1|4385109_4386153_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	2.5e-76
WP_000679398.1|4386162_4386885_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	41.0	3.3e-11
WP_000593182.1|4387212_4387575_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703633.1|4387571_4388501_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	1.4e-150
WP_000632053.1|4388500_4390048_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	3.8e-49
WP_001093501.1|4390211_4390571_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951734.1|4390561_4391677_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_000359509.1|4391669_4392302_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_000368193.1|4392304_4393963_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.8e-52
WP_001151758.1|4393969_4394584_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_000084336.1|4394580_4395036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024132246.1|4395416_4395833_+	serine acetyltransferase	NA	NA	NA	NA	NA
WP_000587739.1|4396411_4397053_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.9	4.6e-33
