The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016357	Salmonella enterica subsp. enterica serovar Newport str. WA_14882 chromosome, complete genome	4712541	1126940	1135877	4712541	integrase	Enterobacteria_phage(83.33%)	11	1129470:1129484	1148209:1148223
WP_023165629.1|1126940_1129274_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.9	0.0e+00
WP_023165628.1|1129288_1129609_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
1129470:1129484	attL	TCGGCGGCAATGGCG	NA	NA	NA	NA
WP_001216602.1|1129605_1129833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065304909.1|1129829_1130381_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	72.2	4.4e-32
WP_023165627.1|1130377_1130644_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	72.7	8.9e-31
WP_023168253.1|1131193_1131937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023165625.1|1131940_1132177_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.1e-19
WP_023165624.1|1132192_1132759_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	6.7e-60
WP_023165623.1|1133154_1134048_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_077910011.1|1134215_1134653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023165621.1|1134683_1135877_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	1.4e-107
1148209:1148223	attR	TCGGCGGCAATGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP016357	Salmonella enterica subsp. enterica serovar Newport str. WA_14882 chromosome, complete genome	4712541	1661926	1671097	4712541	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1661926_1662874_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1662857_1663589_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1663569_1663677_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|1663736_1664468_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1664690_1666376_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1666372_1667092_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1667138_1667606_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|1667662_1668193_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|1668364_1668823_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|1669063_1671097_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 3
NZ_CP016357	Salmonella enterica subsp. enterica serovar Newport str. WA_14882 chromosome, complete genome	4712541	1739187	1749694	4712541		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111837.1|1739187_1740591_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981471.1|1740768_1741662_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|1742038_1743124_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|1743123_1744023_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|1744070_1744949_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|1744949_1745501_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|1745506_1746481_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|1746496_1747270_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|1747274_1748354_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126351.1|1748380_1749694_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 4
NZ_CP016357	Salmonella enterica subsp. enterica serovar Newport str. WA_14882 chromosome, complete genome	4712541	1846225	1853476	4712541		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1846225_1846645_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457658.1|1846647_1847916_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000208509.1|1848370_1848583_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|1848593_1848782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|1849039_1850236_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107431.1|1850885_1851197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377036.1|1851276_1851972_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_001157313.1|1852045_1853476_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 5
NZ_CP016357	Salmonella enterica subsp. enterica serovar Newport str. WA_14882 chromosome, complete genome	4712541	1956151	2044862	4712541	integrase,transposase,terminase,head,protease,portal,tail,holin,lysis,capsid	Enterobacteria_phage(32.69%)	96	1958361:1958383	2019923:2019945
WP_000856224.1|1956151_1956382_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_000168395.1|1956519_1956894_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000979686.1|1956894_1957770_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000722368.1|1957786_1958140_+	YebY family protein	NA	NA	NA	NA	NA
1958361:1958383	attL	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_000078710.1|1958512_1959592_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.4	3.3e-100
WP_031603794.1|1959572_1959845_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	1.8e-10
WP_023165615.1|1959905_1960334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000280164.1|1960432_1960618_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	59.6	2.9e-12
WP_001126028.1|1960664_1961495_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_023168696.1|1961487_1964178_-	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	83.5	2.0e-117
WP_000799629.1|1964318_1964654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023165608.1|1964728_1965013_-	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_001674119.1|1965394_1965550_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	4.7e-08
WP_023165607.1|1965860_1966286_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	56.3	9.3e-14
WP_023165606.1|1966382_1966637_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	59.4	1.2e-16
WP_001534383.1|1966623_1967118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023165605.1|1967162_1968032_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	62.4	9.1e-32
WP_000788954.1|1968038_1968791_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	76.5	5.9e-104
WP_000089406.1|1968808_1969204_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	37.0	5.4e-16
WP_000687977.1|1969200_1969473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|1969676_1969832_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_001637498.1|1970082_1970331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023165603.1|1970394_1970994_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	82.9	2.1e-96
WP_000784704.1|1970990_1971185_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	61.5	7.9e-13
WP_001736205.1|1971166_1971475_+	hypothetical protein	NA	G8C7V5	Escherichia_phage	76.7	6.5e-33
WP_001204682.1|1971484_1971847_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	80.8	1.3e-53
WP_023165602.1|1971959_1974416_-	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_023165601.1|1974773_1974962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023165600.1|1975130_1975337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023165599.1|1975327_1975876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001525456.1|1976050_1976353_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_023165598.1|1976330_1976870_+	lysozyme	NA	S5MQK2	Escherichia_phage	74.7	2.0e-77
WP_134794495.1|1977187_1977643_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.1	1.8e-55
WP_023165596.1|1977869_1978271_-	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_001102153.1|1978556_1979102_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623088.1|1979073_1981005_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_000201416.1|1980988_1981192_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	70.8	2.1e-16
WP_000831820.1|1981188_1982769_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	1.2e-188
WP_023165595.1|1982758_1984255_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.7	9.6e-98
WP_000011260.1|1984267_1984615_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1984669_1985698_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_023165594.1|1985755_1986127_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000083292.1|1986137_1986521_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.2e-28
WP_000817265.1|1986553_1987684_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	98.1	4.0e-213
WP_000677089.1|1987792_1988371_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000033885.1|1988367_1988769_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1988776_1989523_+	Ig-like domain-containing protein	NA	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1989573_1989969_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1989965_1990304_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_023165593.1|1990275_1993371_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.8	2.2e-277
WP_000447370.1|1993373_1993703_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_001156291.1|1993712_1994411_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.4	4.6e-103
WP_000662736.1|1994417_1995155_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	4.0e-129
WP_000246124.1|1995052_1995700_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	9.3e-90
WP_023165592.1|1995761_1999124_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	80.2	0.0e+00
WP_000178851.1|1999162_1999405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023165591.1|1999458_2002140_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1B0VFW4	Salmonella_phage	64.2	2.4e-147
WP_023165590.1|2002154_2002673_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	4.5e-47
WP_023165589.1|2002843_2003485_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_000836775.1|2003759_2003993_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	97.4	1.8e-35
WP_125468752.1|2004066_2004180_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	91.9	1.8e-09
WP_000842530.1|2004240_2004642_-	hypothetical protein	NA	A0A192Y6F0	Salmonella_phage	89.7	4.7e-60
WP_001093795.1|2004638_2004851_-	hypothetical protein	NA	A0A192Y5V6	Salmonella_phage	92.9	1.6e-27
WP_023165588.1|2006171_2006867_-	T3SS effector NleG family protein	NA	NA	NA	NA	NA
WP_023165586.1|2008001_2008802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087646.1|2009744_2010824_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.5	8.7e-101
WP_000789530.1|2013032_2013200_-	lytic enzyme	NA	NA	NA	NA	NA
WP_001521334.1|2013264_2013453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023165585.1|2013925_2014801_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	74.3	3.1e-64
WP_031604217.1|2014904_2015105_-	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000457876.1|2015673_2015799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000951652.1|2016312_2016459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000848072.1|2016946_2017561_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_000480735.1|2017570_2017729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001233445.1|2017861_2018776_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001617922.1|2021902_2022043_-	hypothetical protein	NA	NA	NA	NA	NA
2019923:2019945	attR	GGAATCGTATTCGGTCTCTTTTT	NA	NA	NA	NA
WP_001752421.1|2022207_2022477_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_000354410.1|2022846_2023266_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023168584.1|2026338_2027352_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000774038.1|2028048_2028252_-	outer membrane fimbrial usher protein	NA	NA	NA	NA	NA
WP_000143844.1|2028435_2028720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000974708.1|2029879_2030089_+	CZB domain-containing protein	NA	NA	NA	NA	NA
WP_000030945.1|2030316_2030793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422887.1|2031108_2031504_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	32.8	7.0e-16
WP_000182072.1|2032187_2032910_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_001134856.1|2033194_2033359_+	membrane protein	NA	NA	NA	NA	NA
WP_000986175.1|2033582_2034233_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.9	2.7e-57
WP_000457836.1|2034251_2034443_-	YebW family protein	NA	NA	NA	NA	NA
WP_024131167.1|2034553_2034790_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001670762.1|2034907_2036347_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001521100.1|2036424_2039058_-	PqiB family protein	NA	NA	NA	NA	NA
WP_001207294.1|2039026_2040310_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001518229.1|2040438_2040936_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_000431401.1|2041033_2041720_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001091239.1|2041739_2043788_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000984498.1|2043980_2044862_+|protease	protease HtpX	protease	NA	NA	NA	NA
>prophage 6
NZ_CP016357	Salmonella enterica subsp. enterica serovar Newport str. WA_14882 chromosome, complete genome	4712541	2804716	2845113	4712541	tail,plate,protease	Escherichia_phage(23.08%)	40	NA	NA
WP_000938182.1|2804716_2805397_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
WP_000374046.1|2806015_2806675_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2806761_2807091_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2807087_2807369_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|2807417_2808197_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859429.1|2808222_2808771_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140482.1|2808985_2810197_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2810254_2810572_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2810616_2811030_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|2811203_2811866_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2811960_2812419_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420513.1|2812454_2814509_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_001261222.1|2814632_2815079_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|2815097_2817251_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2817237_2817843_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|2818059_2818569_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|2818925_2819978_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|2820049_2820502_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_023165475.1|2820687_2822448_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2822516_2823035_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2823134_2823302_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2823557_2824121_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|2824117_2825758_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|2825762_2827016_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2827030_2828938_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
WP_001086485.1|2828950_2831059_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224072.1|2831157_2832267_+	YcbX family protein	NA	NA	NA	NA	NA
WP_001670452.1|2832263_2832806_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2832971_2833982_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193770.1|2834189_2836802_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000497461.1|2837228_2837468_+	DinI family protein	NA	K7PKM2	Enterobacterial_phage	92.2	2.1e-31
WP_000102290.1|2837566_2838514_+	hypothetical protein	NA	A5LH79	Enterobacteria_phage	45.1	2.6e-64
WP_000080923.1|2838531_2838972_+	hypothetical protein	NA	A5LH78	Enterobacteria_phage	44.5	1.3e-23
WP_102136365.1|2838995_2839280_-	helix-turn-helix domain-containing protein	NA	F1C5B3	Cronobacter_phage	54.9	8.1e-06
WP_000364380.1|2839348_2839525_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000161710.1|2840070_2840793_+	SPI-1 type III secretion system guanine nucleotide exchange factor SopE	NA	NA	NA	NA	NA
WP_000143178.1|2840989_2841571_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	87.4	1.8e-92
WP_000583377.1|2841570_2843280_-|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	65.6	7.6e-91
WP_000729405.1|2843276_2843903_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	71.2	9.6e-92
WP_001281711.1|2843886_2845113_-|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	65.4	3.6e-151
>prophage 7
NZ_CP016357	Salmonella enterica subsp. enterica serovar Newport str. WA_14882 chromosome, complete genome	4712541	2855126	2881689	4712541	holin,lysis,terminase	Salmonella_phage(70.97%)	33	NA	NA
WP_001110972.1|2855126_2856158_-	DUF2184 domain-containing protein	NA	A0A0U2QQI2	Escherichia_phage	45.5	1.5e-73
WP_023168991.1|2856175_2857021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000860554.1|2857068_2858643_-	NUDIX domain-containing protein	NA	Q6UJ14	Burkholderia_virus	48.6	1.7e-20
WP_001084019.1|2858643_2859519_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	45.5	2.0e-55
WP_001150141.1|2859490_2860921_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	38.1	1.8e-93
WP_000179871.1|2860920_2862192_-	hypothetical protein	NA	A0A0U2JTW9	Escherichia_phage	38.8	6.1e-85
WP_001118139.1|2862181_2863153_-|terminase	terminase small subunit	terminase	I6NV32	Burkholderia_virus	33.2	2.0e-24
WP_000971525.1|2863596_2864067_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	73.9	2.7e-54
WP_001222798.1|2864063_2864513_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	96.0	9.6e-78
WP_165798564.1|2864499_2864844_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	80.7	5.1e-47
WP_000357058.1|2865081_2865579_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	53.3	8.2e-38
WP_001047624.1|2865881_2866691_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	69.5	1.2e-110
WP_000801753.1|2866690_2866828_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	81.6	4.9e-09
WP_001096545.1|2866824_2867436_-	recombination protein NinG	NA	A0A0M4RU10	Salmonella_phage	98.5	7.9e-91
WP_000929789.1|2867644_2868247_-	DUF1367 family protein	NA	A0A0M4QX23	Salmonella_phage	98.0	1.4e-108
WP_031606790.1|2868281_2868530_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	98.8	8.0e-42
WP_001217669.1|2868649_2868883_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000704096.1|2869152_2870145_+	M85 family metallopeptidase	NA	NA	NA	NA	NA
WP_000065482.1|2870171_2870705_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	67.9	3.8e-41
WP_000113624.1|2870701_2871049_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	99.1	1.3e-58
WP_000800012.1|2871059_2871809_-	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_001736365.1|2871811_2872795_-	replication protein	NA	H6WRX7	Salmonella_phage	99.0	2.0e-160
WP_065304520.1|2872879_2873257_-	transcriptional regulator	NA	S4TTD7	Salmonella_phage	64.1	2.4e-37
WP_001013670.1|2873222_2873459_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	100.0	2.3e-38
WP_024136368.1|2873562_2873946_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	99.2	6.3e-62
WP_001230760.1|2873973_2874375_+	helix-turn-helix domain-containing protein	NA	A0A0M4REM4	Salmonella_phage	99.2	6.8e-67
WP_000551859.1|2874791_2874962_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	78.8	3.3e-15
WP_023165479.1|2874983_2875334_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000014350.1|2875460_2878661_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	S4TNL0	Salmonella_phage	78.7	0.0e+00
WP_001539618.1|2878623_2879781_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|2879823_2880063_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2880103_2880352_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2880396_2881689_+	DUF3596 domain-containing protein	NA	S4TSP2	Salmonella_phage	100.0	3.4e-253
>prophage 8
NZ_CP016357	Salmonella enterica subsp. enterica serovar Newport str. WA_14882 chromosome, complete genome	4712541	4302934	4347710	4712541	tail,plate,holin,tRNA	Burkholderia_phage(40.91%)	47	NA	NA
WP_001182228.1|4302934_4303933_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4304020_4305331_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|4305577_4306093_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4306192_4306402_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4306423_4306537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128103.1|4306533_4307859_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4308037_4308646_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4308754_4309123_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4309293_4311714_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4311812_4312685_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4312698_4313196_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4313376_4314294_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973678.1|4314457_4315816_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4315904_4317014_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4317375_4318566_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382575.1|4318697_4320242_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4320256_4321147_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4321312_4321723_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750806.1|4321865_4323962_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|4323961_4324699_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4324695_4325364_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4325397_4325640_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790036.1|4326083_4327733_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4328077_4329427_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4329557_4329905_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|4330482_4330770_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|4330772_4331378_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|4331390_4331705_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|4331864_4332320_+	Gp37 family protein	NA	NA	NA	NA	NA
WP_000875314.1|4332316_4332514_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729849.1|4332503_4333931_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000907495.1|4333930_4334455_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|4334506_4334824_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185656.1|4334783_4334912_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262484.1|4335008_4337363_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
WP_000271429.1|4337362_4338316_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|4338315_4338525_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818152.1|4338512_4339556_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_000679396.1|4339565_4340288_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
WP_000593184.1|4340611_4340974_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|4340970_4341900_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000632048.1|4341899_4343447_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_001093501.1|4343610_4343970_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951728.1|4343960_4345076_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	5.3e-101
WP_000359503.1|4345068_4345701_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000368212.1|4345703_4347185_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.6e-52
WP_001177098.1|4347194_4347710_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
