The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022584	Streptococcus sp. I-G2, complete genome	1992567	12421	20195	1992567		Streptococcus_phage(66.67%)	8	NA	NA
WP_023026414.1|12421_15286_+	DEAD/DEAH box helicase	NA	U3PFS7	Lactobacillus_phage	28.7	2.1e-24
WP_023026418.1|15683_16076_-	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_023026420.1|16263_16569_-	hypothetical protein	NA	E4ZFJ0	Streptococcus_phage	46.7	4.2e-16
WP_023026422.1|16549_16921_-	hypothetical protein	NA	A0A1B0RXA8	Streptococcus_phage	40.2	1.4e-13
WP_023026424.1|16917_18330_-	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	66.5	4.0e-178
WP_042360991.1|18332_19010_-	helix-turn-helix transcriptional regulator	NA	A0A1B0RXB1	Streptococcus_phage	47.8	8.0e-52
WP_042360992.1|19192_19732_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_023026429.1|19721_20195_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	28.5	2.1e-14
>prophage 2
NC_022584	Streptococcus sp. I-G2, complete genome	1992567	949577	961575	1992567		Streptococcus_phage(64.29%)	14	NA	NA
WP_023027122.1|949577_950570_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.6	8.0e-16
WP_023027123.1|951117_951942_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	36.6	3.7e-19
WP_023027124.1|952125_953667_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	4.4e-53
WP_023027125.1|953896_954250_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	59.8	7.9e-35
WP_023027126.1|954259_954748_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	45.2	8.4e-35
WP_023027127.1|954740_955313_-	GNAT family N-acetyltransferase	NA	M1PSC3	Streptococcus_phage	57.2	8.3e-58
WP_023027128.1|955302_956187_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	71.5	1.5e-111
WP_023024026.1|956189_956510_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	65.1	1.8e-30
WP_023024028.1|956514_957414_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	52.0	3.5e-79
WP_023024030.1|957410_958049_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	63.6	3.9e-72
WP_023024032.1|958221_959109_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	51.2	1.1e-80
WP_023024035.1|959148_959805_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	75.5	3.5e-84
WP_003008277.1|960100_960811_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.1	2.3e-17
WP_023024036.1|960810_961575_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.7	1.8e-15
>prophage 3
NC_022584	Streptococcus sp. I-G2, complete genome	1992567	1150305	1185530	1992567	protease,holin,transposase,integrase	Chrysochromulina_ericina_virus(18.18%)	39	1175680:1175731	1185639:1185690
WP_023027229.1|1150305_1150938_-|holin	1-alkyl-2-acetylglycerophosphocholine esterase	holin	A0A2K9L661	Tupanvirus	26.2	4.8e-06
WP_042361230.1|1150990_1151824_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_023027230.1|1152073_1152949_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_123160843.1|1153455_1154064_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_081697786.1|1153994_1154882_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	48.1	4.4e-66
WP_156023429.1|1154931_1155096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081698213.1|1155123_1155348_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	46.3	5.6e-10
WP_023027233.1|1155452_1157120_-	methionine ABC transporter substrate-binding protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	25.2	2.8e-13
WP_023027234.1|1157138_1158476_-	CapA family protein	NA	A0A0N9SJ77	Staphylococcus_phage	26.3	2.5e-28
WP_023027235.1|1158666_1159602_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_042361233.1|1159872_1160229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023027237.1|1160356_1161292_-	dihydroorotate oxidase	NA	A0A1V0SH91	Hokovirus	43.5	5.1e-65
WP_023027239.1|1161667_1163014_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_023027240.1|1163258_1164401_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	30.5	5.6e-21
WP_023027241.1|1164668_1165301_-	4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein	NA	NA	NA	NA	NA
WP_023027242.1|1165503_1167327_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	47.1	1.9e-132
WP_023027243.1|1167550_1168093_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_023027244.1|1168099_1169134_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_023027245.1|1169301_1170075_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_023027246.1|1170067_1170766_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_023027247.1|1170807_1171524_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_023027248.1|1171657_1172995_-	PFL family protein	NA	NA	NA	NA	NA
WP_006595627.1|1173013_1173280_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_023024357.1|1173426_1174032_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_023024359.1|1174146_1174854_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_021154436.1|1175312_1175516_+	CsbD family protein	NA	NA	NA	NA	NA
1175680:1175731	attL	ATTAACGTTTTGAGAATTGTGATGCTTTACGAGCTTTCTTAAGACCTGGTTT	NA	NA	NA	NA
WP_000126416.1|1176044_1177094_-	DUF389 domain-containing protein	NA	NA	NA	NA	NA
WP_001253404.1|1177090_1177414_-	two pore domain potassium channel family protein	NA	A0A1B0Y2S3	Lactobacillus_phage	40.3	7.1e-06
WP_000397556.1|1177427_1177769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081698226.1|1177693_1177996_-	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_002902313.1|1178565_1178886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902311.1|1178919_1179075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000711078.1|1179097_1179436_-	Cd(II)/Zn(II)-sensing metalloregulatory transcriptional regulator CadX	NA	E4ZFI8	Streptococcus_phage	33.3	1.7e-10
WP_071788354.1|1179447_1180074_-	CadD family cadmium resistance transporter	NA	NA	NA	NA	NA
WP_002893754.1|1180361_1182425_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	26.9	5.3e-54
WP_002902306.1|1182426_1182705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002893757.1|1183766_1184003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023027249.1|1184455_1185064_+	DUF1269 domain-containing protein	NA	NA	NA	NA	NA
WP_002893762.1|1185308_1185530_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
1185639:1185690	attR	ATTAACGTTTTGAGAATTGTGATGCTTTACGAGCTTTCTTAAGACCTGGTTT	NA	NA	NA	NA
>prophage 4
NC_022584	Streptococcus sp. I-G2, complete genome	1992567	1551675	1559849	1992567		Synechococcus_phage(33.33%)	6	NA	NA
WP_023027448.1|1551675_1551921_+	acyl carrier protein	NA	E3SMK8	Prochlorococcus_phage	37.3	1.6e-05
WP_023027449.1|1552090_1552798_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D8KNF0	Synechococcus_phage	39.7	3.9e-41
WP_023027450.1|1552849_1556575_+	phosphoribosylformylglycinamidine synthase	NA	A6N228	Microbacterium_phage	25.6	3.1e-36
WP_023027451.1|1556587_1558027_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.6	5.9e-52
WP_023027452.1|1558272_1559295_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	44.3	4.3e-65
WP_023027453.1|1559294_1559849_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.3	2.6e-24
>prophage 5
NC_022584	Streptococcus sp. I-G2, complete genome	1992567	1753520	1816063	1992567	protease,integrase,tRNA,bacteriocin	Staphylococcus_phage(16.67%)	54	1746896:1746911	1782281:1782296
1746896:1746911	attL	TTTATCTCATCTAAAT	NA	NA	NA	NA
WP_023027598.1|1753520_1754648_+|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	30.5	6.2e-41
WP_023027599.1|1755066_1756338_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	46.8	8.2e-98
WP_023027600.1|1756452_1756923_+	DUF3013 family protein	NA	NA	NA	NA	NA
WP_023027601.1|1756940_1758014_+	peptidase M50	NA	NA	NA	NA	NA
WP_023027602.1|1758036_1758579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023027603.1|1758628_1759072_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_023027604.1|1759058_1759532_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_156023436.1|1759670_1760621_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_023027606.1|1760622_1761372_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_023027607.1|1761412_1763881_-	bifunctional 2',3'-cyclic-nucleotide 2'-phosphodiesterase/3'-nucleotidase	NA	NA	NA	NA	NA
WP_006595074.1|1764141_1766361_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	36.5	5.0e-10
WP_023027608.1|1766564_1767008_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_023027609.1|1767301_1767955_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_042361347.1|1768095_1769121_+	DUF3114 domain-containing protein	NA	NA	NA	NA	NA
WP_023027611.1|1769230_1769725_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_023027612.1|1769811_1770744_-	metal ABC transporter substrate-binding lipoprotein/fibrin-binding adhesin FimA	NA	NA	NA	NA	NA
WP_023022124.1|1770755_1771598_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_023022125.1|1771594_1772317_-	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.6e-18
WP_023027613.1|1772465_1774361_+	endopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.6	9.4e-74
WP_023027615.1|1774898_1775675_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_023027616.1|1775804_1776548_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_023027617.1|1776562_1777534_+	sugar-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_006595062.1|1777701_1778025_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_006595061.1|1778035_1778347_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_006595060.1|1778358_1779660_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_023027619.1|1779801_1782240_+	glycyl radical protein	NA	Q66LZ4	Escherichia_phage	56.6	9.4e-10
WP_023027620.1|1782255_1782924_+	fructose-6-phosphate aldolase	NA	M4QRR4	Synechococcus_phage	31.0	1.7e-22
1782281:1782296	attR	ATTTAGATGAGATAAA	NA	NA	NA	NA
WP_042361352.1|1782938_1784030_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_006595056.1|1784241_1784382_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_006595055.1|1784476_1785151_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_023027622.1|1785338_1787321_+	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023027623.1|1787605_1790107_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	66.3	0.0e+00
WP_023027624.1|1790231_1790945_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023027625.1|1791268_1791427_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_023027627.1|1791641_1791830_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_023027629.1|1791997_1792690_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_023027630.1|1792818_1794222_+	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_023027631.1|1794439_1795366_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023027632.1|1795830_1796760_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.2	1.3e-23
WP_023027633.1|1796752_1797631_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023027634.1|1797894_1799706_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	37.7	3.7e-96
WP_023027635.1|1799951_1801727_+	PTS mannitol transporter subunit IICBA	NA	NA	NA	NA	NA
WP_042361355.1|1801744_1803700_+	transcription antiterminator	NA	NA	NA	NA	NA
WP_023022143.1|1803701_1804139_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_023022144.1|1804200_1805337_+	mannitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_023027636.1|1806737_1807559_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_006596959.1|1807878_1808880_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_006595041.1|1808898_1809099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023027637.1|1809198_1810200_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_023027638.1|1810227_1811106_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023027639.1|1811172_1811865_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023027640.1|1811868_1812555_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_023027641.1|1812574_1813339_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.6	9.7e-38
WP_023027642.1|1813957_1816063_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	38.2	3.0e-121
