The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022566	Klebsiella pneumoniae CG43, complete sequence	5166857	1002928	1012392	5166857	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1002928_1004044_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004209695.1|1004040_1005981_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1006057_1006279_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1006604_1006922_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1006952_1009232_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1009352_1009571_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|1009924_1010626_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004209699.1|1010670_1012392_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 2
NC_022566	Klebsiella pneumoniae CG43, complete sequence	5166857	1572322	1677098	5166857	capsid,transposase,portal,protease,tail,holin,integrase,head,terminase	Escherichia_phage(17.5%)	104	1608904:1608922	1658903:1658921
WP_022615511.1|1572322_1573441_-|transposase	IS481-like element ISKpn28 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	21.9	1.4e-05
WP_004179669.1|1573685_1574714_+	magnesium transporter CorA	NA	NA	NA	NA	NA
WP_004176351.1|1574727_1575900_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_004210340.1|1575951_1577544_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_004148253.1|1577716_1578745_+	Mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_004210343.1|1578784_1580362_-	YdgA family protein	NA	NA	NA	NA	NA
WP_002903312.1|1580448_1581627_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002903313.1|1581828_1583475_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_004176339.1|1583814_1585215_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_004148259.1|1585204_1586137_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_004140030.1|1586212_1587514_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.3	1.3e-18
WP_002903374.1|1587770_1588133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002903377.1|1588375_1589095_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_002903379.1|1589223_1589559_+	GlpM family protein	NA	NA	NA	NA	NA
WP_004140019.1|1589555_1590278_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_004183892.1|1590314_1591697_-	amino acid permease	NA	NA	NA	NA	NA
WP_002903384.1|1591874_1592825_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004140012.1|1592821_1593004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004148265.1|1593346_1594876_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_002903386.1|1594886_1596275_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_002903388.1|1596423_1596612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002903391.1|1596721_1597672_-	universal stress protein UspE	NA	NA	NA	NA	NA
WP_002903394.1|1597810_1598563_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_004213367.1|1598757_1599273_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	54.9	2.0e-23
WP_002903398.1|1599565_1599724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530209.1|1600335_1600596_-	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_004213359.1|1600715_1600901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016530208.1|1600897_1601560_-	hypothetical protein	NA	Q71T76	Escherichia_phage	56.0	2.2e-54
WP_004213355.1|1601552_1601897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213351.1|1602024_1602810_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	5.3e-63
WP_004213349.1|1602809_1603109_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	9.4e-13
WP_016530207.1|1603876_1604536_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.7	7.3e-74
WP_016530206.1|1604628_1604826_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|1604851_1605313_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_004184738.1|1605550_1605730_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	75.0	1.6e-15
WP_016530204.1|1606653_1607463_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	4.5e-110
WP_004184734.1|1607472_1607850_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_032427779.1|1607862_1608843_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.3	4.6e-133
WP_004213332.1|1608856_1609435_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.1	3.5e-48
1608904:1608922	attL	GAAAACGCTGGAGGCCATC	NA	NA	NA	NA
WP_148673038.1|1609546_1609966_+	MFS transporter	NA	NA	NA	NA	NA
WP_016530201.1|1610593_1610875_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	71.0	1.6e-30
WP_016530200.1|1610874_1611504_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	88.0	1.4e-103
WP_016530199.1|1611511_1611787_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	36.0	1.7e-05
WP_022615516.1|1612010_1612946_+	DUF4747 family protein	NA	NA	NA	NA	NA
WP_016530196.1|1612950_1613577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530194.1|1614210_1614561_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	79.8	7.8e-51
WP_016530193.1|1614719_1615217_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	73.9	5.7e-63
WP_016530190.1|1617121_1618348_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	3.2e-208
WP_000999827.1|1618340_1618940_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_004104235.1|1618949_1620188_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_016530189.1|1620265_1620583_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.0	1.8e-22
WP_016530188.1|1620591_1620930_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	70.5	7.8e-40
WP_016530187.1|1620926_1621376_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	7.4e-62
WP_016530186.1|1621372_1621720_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_016530185.1|1621776_1622481_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	6.6e-81
WP_016530184.1|1622511_1622916_+|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	57.4	3.2e-32
WP_016530183.1|1622918_1623224_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	4.7e-28
WP_016530182.1|1623297_1623531_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_016530181.1|1623591_1626981_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	60.6	0.0e+00
WP_004177132.1|1627001_1627475_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004864228.1|1627461_1627938_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_022615519.1|1627950_1628331_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	80.2	1.6e-57
WP_016530179.1|1628327_1631405_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	61.5	0.0e+00
WP_022615520.1|1631477_1633631_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	42.2	6.2e-90
WP_022615521.1|1633643_1634378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022615522.1|1634433_1635078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004214894.1|1635245_1635545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004214887.1|1636745_1637846_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.8	8.3e-115
WP_022615523.1|1637974_1639093_-	AbgT family transporter	NA	NA	NA	NA	NA
WP_022615524.1|1639212_1640658_-	amidohydrolase	NA	NA	NA	NA	NA
WP_004214881.1|1640657_1641968_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_004148273.1|1642134_1643043_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004143055.1|1643144_1643708_+	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_004151560.1|1643704_1644511_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002903522.1|1644680_1645367_+	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_004176317.1|1645377_1646034_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_004214878.1|1646044_1647247_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_020316475.1|1647256_1648609_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_004215412.1|1648598_1649363_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_004143067.1|1649355_1649745_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_023302609.1|1650334_1651951_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_004152246.1|1652113_1653766_-	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_004148278.1|1653820_1655332_-	anion permease	NA	NA	NA	NA	NA
WP_004209796.1|1655974_1658752_+	flavocytochrome c	NA	A0A2P0ZL82	Lactobacillus_phage	31.0	6.8e-65
WP_004209794.1|1658819_1659770_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
1658903:1658921	attR	GATGGCCTCCAGCGTTTTC	NA	NA	NA	NA
WP_004176303.1|1659750_1660470_-	two-component system response regulator DcuR	NA	NA	NA	NA	NA
WP_004183910.1|1660466_1662083_-	two-component system sensor histidine kinase DcuS	NA	NA	NA	NA	NA
WP_004179716.1|1662238_1662595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004209791.1|1662758_1663679_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_022615525.1|1663943_1665599_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_004148289.1|1665756_1666683_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004209787.1|1666672_1667575_-	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_004209784.1|1667574_1668192_-	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_004209783.1|1668195_1669155_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	90.3	2.7e-53
WP_004209782.1|1669291_1670092_-	biotin-independent malonate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004143105.1|1670091_1670925_-	biotin-independent malonate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_002903639.1|1670917_1671217_-	malonate decarboxylase acyl carrier protein	NA	NA	NA	NA	NA
WP_004143107.1|1671234_1672077_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_002903677.1|1672076_1673732_-	malonate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_002903679.1|1673956_1674991_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002903681.1|1675433_1675796_+	multidrug efflux SMR transporter subunit KpnE	NA	NA	NA	NA	NA
WP_002903683.1|1675782_1676112_+	multidrug efflux SMR transporter subunit KpnF	NA	NA	NA	NA	NA
WP_002903685.1|1676155_1676272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004209779.1|1676285_1677098_-|protease	serine protease	protease	NA	NA	NA	NA
>prophage 3
NC_022566	Klebsiella pneumoniae CG43, complete sequence	5166857	1712305	1723192	5166857		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|1712305_1712926_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004183946.1|1712918_1714184_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	6.6e-233
WP_002903955.1|1714195_1715098_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004209817.1|1715358_1716120_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.6	5.5e-134
WP_001620095.1|1716140_1717001_-	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_004176262.1|1717298_1717559_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004209813.1|1717645_1718734_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.0e-210
WP_004176258.1|1718764_1720030_-	MFS transporter	NA	NA	NA	NA	NA
WP_004209809.1|1720084_1723192_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.5	0.0e+00
>prophage 4
NC_022566	Klebsiella pneumoniae CG43, complete sequence	5166857	2682856	2689761	5166857	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004214740.1|2682856_2684335_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.4e-29
WP_004201558.1|2684331_2685054_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|2685372_2686734_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|2686976_2687873_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004214747.1|2688113_2688887_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	5.1e-26
WP_004180551.1|2688897_2689761_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 5
NC_022566	Klebsiella pneumoniae CG43, complete sequence	5166857	3031658	3046380	5166857	tail,integrase	Morganella_phage(50.0%)	18	3026545:3026565	3046608:3046628
3026545:3026565	attL	TTATTTGCTTTTCTTGATGTG	NA	NA	NA	NA
WP_004213175.1|3031658_3034724_-|tail	phage tail length tape measure family protein	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
WP_004213174.1|3034731_3035058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213173.1|3035057_3035228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213172.1|3035411_3035885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213171.1|3035889_3036273_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032424539.1|3036253_3036700_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_004213169.1|3037039_3039802_-	TOPRIM and DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	56.1	2.8e-292
WP_004213168.1|3039794_3040145_-	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	70.0	3.4e-38
WP_004213167.1|3040154_3040781_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.6e-25
WP_004213166.1|3040777_3040987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213165.1|3040983_3041487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023302683.1|3041483_3042449_-	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
WP_004213162.1|3042445_3042625_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_004213161.1|3042624_3043227_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
WP_004213160.1|3043240_3043675_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
WP_004213159.1|3043674_3043893_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004213158.1|3044023_3045031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213157.1|3045126_3046380_-|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	3.2e-147
3046608:3046628	attR	TTATTTGCTTTTCTTGATGTG	NA	NA	NA	NA
