The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022364	Escherichia coli LY180, complete sequence	4835601	197062	270411	4835601	protease,transposase,plate,tRNA	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_001346129.1|197062_198415_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|198444_200877_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|200998_201484_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|201487_202513_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|202617_203073_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|203076_203865_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139667.1|203864_205013_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|205009_205606_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|205642_209125_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|209137_210097_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|210195_212337_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|212393_212783_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176578.1|212847_214146_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|214194_214455_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|214441_214642_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|214807_215353_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|215349_215772_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|215785_216496_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001297208.1|216650_217475_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260712.1|217528_219247_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|219357_220065_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|220061_220466_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|220583_221399_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|221438_222092_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|222084_223116_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|223303_223879_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997038.1|229637_230441_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_000648576.1|230437_231352_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|231592_232393_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211687.1|232470_233241_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|233288_234647_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|234718_235474_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001298887.1|235507_236230_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|236226_236694_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|236758_237490_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086142.1|238029_238815_+	aminopeptidase	NA	NA	NA	NA	NA
WP_001236649.1|238951_239431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908052.1|239440_240355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|240398_240881_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087745.1|240904_242257_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122986077.1|242267_245702_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240545.1|245810_247223_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|247227_247971_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614350.1|247967_250775_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.9	1.2e-80
WP_000343298.1|250783_251545_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246449.1|251549_252881_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|252883_253408_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|253404_254685_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|254709_255792_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|255755_257606_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|257609_258023_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|258029_259505_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|259555_259780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037395.1|259814_260315_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|261012_261531_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001297813.1|261563_261701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000103316.1|261740_263882_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001350059.1|263957_268007_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_001350058.1|267966_268404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420794.1|269274_270411_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NC_022364	Escherichia coli LY180, complete sequence	4835601	292364	332044	4835601	protease,plate,transposase,tail,head	Escherichia_phage(60.38%)	54	NA	NA
WP_000859525.1|292364_292760_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_000514023.1|292914_293610_-	hypothetical protein	NA	A0A0C4UQZ7	Shigella_phage	99.1	9.5e-133
WP_001300256.1|293560_293749_-	Com family DNA-binding transcriptional regulator	NA	A0A0C4UQS3	Shigella_phage	100.0	1.3e-31
WP_000905064.1|293843_294425_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	99.5	1.6e-104
WP_001112250.1|294454_295450_+	hypothetical protein	NA	A0A077SK37	Escherichia_phage	94.7	6.4e-183
WP_000972171.1|295452_295986_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	98.9	1.2e-95
WP_000972119.1|296014_296542_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	1.2e-92
WP_000499360.1|296544_298059_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	90.2	1.7e-259
WP_000301695.1|298058_298601_-	DUF2313 domain-containing protein	NA	C9DGQ7	Escherichia_phage	99.4	4.8e-100
WP_000331815.1|298591_299674_-|plate	baseplate J/gp47 family protein	plate	C9DGQ6	Escherichia_phage	98.9	1.1e-204
WP_000130548.1|299674_300112_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	100.0	1.0e-79
WP_000442748.1|300108_300702_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	99.0	1.2e-107
WP_000072824.1|300689_301829_-|plate	baseplate protein	plate	C9DGQ3	Escherichia_phage	98.9	3.4e-212
WP_000461070.1|301821_303309_-	DNA circularization protein	NA	A0A0C4UR32	Shigella_phage	98.2	6.6e-240
WP_000147074.1|303313_305386_-	tape measure protein	NA	C9DGQ1	Escherichia_phage	96.4	3.8e-312
WP_000344073.1|305530_305965_-|tail	phage tail assembly protein	tail	C9DGP9	Escherichia_phage	97.9	3.8e-71
WP_000918402.1|305974_306331_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	94.9	4.2e-60
WP_001280310.1|306340_307828_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	99.6	1.3e-280
WP_000979227.1|307824_308031_-	DUF2635 domain-containing protein	NA	A0A0C4UR31	Shigella_phage	98.5	1.4e-28
WP_000888926.1|308014_308563_-	DUF1834 family protein	NA	C9DGP5	Escherichia_phage	99.5	1.9e-104
WP_001104973.1|308562_308988_-	DUF1320 family protein	NA	C9DGP4	Escherichia_phage	97.2	8.8e-73
WP_000017158.1|308984_309395_-	hypothetical protein	NA	C9DGP3	Escherichia_phage	98.5	6.1e-63
WP_000637410.1|309461_310379_-|head	Mu-like prophage major head subunit gpT family protein	head	C9DGP2	Escherichia_phage	99.3	5.2e-179
WP_000716025.1|310375_311461_-|protease	phage protease	protease	C9DGP0	Escherichia_phage	98.3	5.2e-194
WP_001350023.1|311657_312128_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	99.4	3.8e-85
WP_001136431.1|312124_313444_-|head	phage head morphogenesis protein	head	C9DGN7	Escherichia_phage	98.2	1.5e-248
WP_000532638.1|313424_314963_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	99.0	1.5e-295
WP_001097325.1|314962_316618_-	hypothetical protein	NA	C9DGN5	Escherichia_phage	97.8	0.0e+00
WP_000375394.1|316625_317201_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	100.0	9.1e-97
WP_000606409.1|317212_317503_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	100.0	7.4e-47
WP_000364295.1|317499_317799_-	DUF2730 family protein	NA	C9DGN2	Escherichia_phage	100.0	5.8e-47
WP_001001316.1|317798_317993_-	hypothetical protein	NA	C9DGN1	Escherichia_phage	100.0	6.2e-34
WP_001350022.1|318151_318538_-	hypothetical protein	NA	C9DGN0	Escherichia_phage	97.7	2.2e-62
WP_000907405.1|318521_319037_-	lysozyme	NA	C9DGM9	Escherichia_phage	99.4	1.9e-93
WP_001163387.1|319131_319554_-	positive regulator of late transcription	NA	C9DGM8	Escherichia_phage	99.3	2.2e-76
WP_000004161.1|319695_320058_-	hypothetical protein	NA	C9DGM6	Escherichia_phage	99.2	4.1e-63
WP_000515807.1|320050_320269_-	hypothetical protein	NA	C9DGM5	Escherichia_phage	100.0	5.6e-39
WP_000133853.1|320346_320736_-	hypothetical protein	NA	A0A0C4UR27	Shigella_phage	98.4	2.3e-67
WP_000091782.1|320732_321284_-	regulatory protein GemA	NA	A0A0C4UQU3	Shigella_phage	96.7	1.2e-98
WP_000431116.1|321354_321621_+	hypothetical protein	NA	Q38493	Escherichia_phage	98.9	2.3e-39
WP_001058561.1|321559_321862_-	hypothetical protein	NA	A0A0C4UQY6	Shigella_phage	99.0	1.4e-48
WP_000429765.1|321863_322046_-	hypothetical protein	NA	A0A0C4UR26	Shigella_phage	83.3	1.4e-24
WP_000465551.1|322032_322563_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	97.2	6.4e-97
WP_000227260.1|322562_323093_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	95.5	4.2e-96
WP_001107930.1|323191_323716_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	100.0	1.5e-90
WP_001372708.1|323735_324023_-	hypothetical protein	NA	C9DGL7	Escherichia_phage	100.0	2.5e-47
WP_001101152.1|324035_324455_-	hypothetical protein	NA	C9DGL6	Escherichia_phage	95.7	8.7e-73
WP_001151288.1|324469_324733_-	hypothetical protein	NA	A0A0C4UQU1	Shigella_phage	96.6	2.5e-38
WP_000968312.1|324977_325205_-	hypothetical protein	NA	C9DGL3	Escherichia_phage	100.0	3.2e-37
WP_001026710.1|325220_326159_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	98.1	1.3e-169
WP_000424754.1|326197_328189_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	C9DGL1	Escherichia_phage	93.5	0.0e+00
WP_000337186.1|328190_328418_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	66.7	4.8e-17
WP_000840061.1|328587_329178_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001143092.1|329599_332044_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
>prophage 3
NC_022364	Escherichia coli LY180, complete sequence	4835601	1444260	1500802	4835601	plate,holin,tail,terminase,tRNA	Escherichia_phage(75.44%)	64	NA	NA
WP_001307164.1|1444260_1445493_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1445747_1446731_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123740.1|1447208_1448582_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157422.1|1448710_1449646_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	4.5e-146
WP_000040852.1|1449697_1450933_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1450934_1451150_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1451228_1451438_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1451430_1451625_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1451681_1452491_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105152.1|1452483_1455084_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.8e-248
WP_001349884.1|1455185_1455461_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	6.3e-40
WP_001349883.1|1455535_1455706_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	6.7e-24
WP_000560220.1|1455705_1455927_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_001169153.1|1456347_1456500_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000233319.1|1456930_1457350_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1457429_1457684_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693802.1|1457680_1458103_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	6.9e-70
WP_000899746.1|1458115_1458973_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788973.1|1458979_1459726_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_000450660.1|1459748_1460510_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.0	1.7e-114
WP_001151237.1|1460525_1460948_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.9	7.4e-64
WP_000228824.1|1461131_1462259_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000569066.1|1462251_1463361_+	DUF3696 domain-containing protein	NA	NA	NA	NA	NA
WP_000064766.1|1463357_1464335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813259.1|1464965_1465121_+	type I toxin-antitoxin system Hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	96.1	5.5e-17
WP_000940320.1|1465589_1466189_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228041.1|1466188_1466479_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	4.3e-47
WP_000640164.1|1466475_1467012_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.1	6.3e-68
WP_001349882.1|1468282_1468675_+|holin	holin	holin	Q8W636	Enterobacteria_phage	96.2	8.4e-54
WP_000950573.1|1468664_1468940_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	97.8	5.5e-44
WP_000014545.1|1468942_1469320_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	3.0e-64
WP_133301706.1|1469334_1469517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001291099.1|1469921_1470710_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.1	2.5e-49
WP_001204039.1|1470702_1471635_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	7.1e-83
WP_001307172.1|1471570_1471822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089432.1|1471825_1472917_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	92.1	1.0e-144
WP_000021163.1|1472906_1474235_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.9	8.4e-263
WP_021036437.1|1474253_1475690_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	95.6	2.6e-265
WP_001018386.1|1475634_1476468_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	97.8	1.2e-153
WP_000059667.1|1476448_1477771_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.2	6.8e-188
WP_001349881.1|1477763_1478381_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	100.0	5.9e-118
WP_001272365.1|1478395_1479424_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.4	3.3e-190
WP_000780861.1|1479481_1479952_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_000175376.1|1479951_1480392_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000762302.1|1480388_1480829_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
WP_001139506.1|1480815_1481760_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.4	2.2e-172
WP_000506600.1|1481759_1483097_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	1.0e-244
WP_000613371.1|1483120_1483552_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	2.8e-74
WP_000703979.1|1483548_1484166_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	98.0	4.2e-108
WP_000016439.1|1484229_1486218_+	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	94.4	0.0e+00
WP_000056323.1|1486221_1486890_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	98.6	4.3e-122
WP_000209259.1|1486886_1487153_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	94.3	2.7e-43
WP_001271172.1|1487152_1488160_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	96.1	1.2e-189
WP_000063616.1|1488159_1488873_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	96.6	1.8e-126
WP_001261334.1|1489569_1489917_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	94.8	4.1e-60
WP_000733802.1|1490307_1490847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001349878.1|1490868_1492095_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	98.8	5.8e-226
WP_001199732.1|1492078_1492705_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	99.0	2.2e-120
WP_000600270.1|1492701_1494255_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	79.2	4.6e-228
WP_000902859.1|1494257_1494803_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	76.4	3.8e-76
WP_000117760.1|1494826_1497967_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0U2SH60	Escherichia_phage	71.2	0.0e+00
WP_000701877.1|1497981_1498554_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	75.3	1.8e-76
WP_001082294.1|1499093_1499528_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837909.1|1499668_1500802_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 4
NC_022364	Escherichia coli LY180, complete sequence	4835601	1665278	1741706	4835601	capsid,transposase,integrase,terminase,lysis,tail,head,portal	Enterobacteria_phage(42.11%)	92	1684949:1685008	1733913:1735241
WP_001339197.1|1665278_1666487_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_001022785.1|1666668_1668342_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001296721.1|1668397_1668709_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_001349922.1|1668736_1670059_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000722571.1|1670173_1670485_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577184.1|1670683_1671382_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087220.1|1671426_1672326_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054196.1|1672520_1673708_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|1673834_1673930_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592814.1|1674148_1675039_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
WP_000671744.1|1675293_1675686_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024810.1|1675961_1676480_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001299399.1|1676524_1678570_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636571.1|1678706_1679453_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|1679541_1680228_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|1680405_1680609_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527779.1|1680644_1682105_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
WP_120795384.1|1684081_1684195_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1684263_1684497_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_016230953.1|1684813_1684993_+	recombinase family protein	NA	NA	NA	NA	NA
1684949:1685008	attL	CTGAGAGATCCCCTCATAATTTCCCCAAAGCGTAACCATGTGTGAATAAATTTTGAGCTA	NA	NA	NA	NA
WP_001339197.1|1684961_1686170_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_077631333.1|1686268_1686742_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	39.6	9.6e-20
WP_000885611.1|1686839_1687415_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000279140.1|1687414_1690489_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_001233072.1|1690553_1691153_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.0	9.7e-110
WP_000033679.1|1691223_1694637_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_000090891.1|1694697_1695330_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_001349921.1|1695266_1696010_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	6.8e-145
WP_001152622.1|1696015_1696714_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	1.6e-132
WP_000847360.1|1696713_1697043_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	9.6e-59
WP_000840335.1|1697039_1699601_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.3	0.0e+00
WP_000459457.1|1699593_1700028_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479150.1|1700009_1700432_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	98.6	1.3e-71
WP_001349920.1|1700447_1701188_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|1701195_1701591_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000985119.1|1701587_1702166_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000753007.1|1702177_1702531_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	99.1	4.4e-62
WP_000158921.1|1702542_1702941_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	4.5e-63
WP_000063280.1|1702982_1704008_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001295978.1|1704063_1704396_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123305.1|1704405_1705725_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_001349919.1|1705705_1707307_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000198149.1|1707303_1707510_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027259.1|1707506_1709432_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453611.1|1709406_1709952_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|1710340_1710574_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1710631_1711042_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1711193_1711367_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1711538_1711694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1711773_1711839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1711841_1712030_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1712040_1712253_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1712615_1713113_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1713109_1713643_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1713639_1713951_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1713955_1714171_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1714924_1715140_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1715440_1715653_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1715707_1715797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|1716074_1716827_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|1716840_1717890_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|1717891_1718170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1718236_1718488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1718704_1718860_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1718931_1719219_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1719218_1719458_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1719482_1719788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1719990_1720323_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|1720759_1722073_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001310834.1|1723739_1724096_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|1724092_1724515_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|1724555_1725521_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|1725501_1726023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1726006_1726237_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1726320_1726728_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1726894_1727050_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1727209_1727428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1727995_1728184_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1728180_1728372_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048348.1|1728464_1730942_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|1731014_1731266_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000876956.1|1731300_1732581_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	5.6e-155
WP_001339197.1|1732750_1733959_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_023352561.1|1733968_1734049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836076.1|1734106_1735126_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	1.3e-16
WP_001295394.1|1735137_1736352_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
1733913:1735241	attR	TAGCTCAAAATTTATTCACACATGGTTACGCTTTGGGGAAATTATGAGGGGATCTCTCAGAGCGCAGTGCCCAGCCATCCCGATACTGCTGCTTTCACCAAATCCTTAGTGCTTCTTTCATGTTTTTCTATTGTCATAATGGTTATCTCTAAAAAAGAGGTAAGATGCGTACTACTTACTCGCCGTTATTGGTATTATTCAGAAAAAGTGAGTAAGACTTTGCAGCAATGTTTTTGATCCTGTTCAAATAAACTAATGGCATCAGCAACATGCTGGAAATCAAACGTATGGGTAATTAATTTTTCTGGTTTAATTAACCCTTTACTTAACCAGTCGATAACAACCGGAAATTTATTTGCATTTAAGCGTGAAGAGAAAATAGAGAGTTCTTTTCCGGTAATTCCTTGCTGAATCACTTCAGACGGTTCACTGGAGAAGCCCATCAATACAATACGTGCCGCTGGAGAAGCCAGCGTTACGGCCTCTTTCAGGATAGAAGGATGACAAGCCGCATCGATAATTAATGTCGGCTTGATGCCTTTTTCAGCGAAAATCTCGCCAAGCGGTGTCTGGCTGTTATTAATCGCCCAGTCTGCCCCGCTCTCTTTCGCTTTTTCCAGTCGTTCATCAATGCGATCGGCAACAATCACATTTTTAACGTTATAGACGCCTTTTAATACCTGAACGATCGTCAGGCCGATTGGACCGGCACCATAAACCAGAACGGTATCATTTTCAGTCGGTTGACCATGACCGGTAACGTTAGCCGCAATGGTAAAAGGTTCGATCATCATCGCATATTGATCGGCCACTGCTTCAGGAATTTTCCACGCATTTTTTGCCGGAACCACGGCATATTCACTGAAACCACCGTCAGCGTGCACACCTAATACAGCAAGTGTCGTACAAACGTTCGGCTTACCTATAGAGCACGGATAGCAATGCCCACAGCTGACCACCGGATCGACAGCAACGCGTTCACCGACTCTGGCGCTTTCCACACCTTCACCCACCGCATCAATGACGCCAAAGAATTCATGACCAATGACGCGCGGATATTTCGCAAAAGGATTATGCCCACGGTAAATATGGCTATCTGAACCACAAATTCCGGCAAGTTTCACTTTTACTCGTACTTCACCCGCTGACGGGGTGGGTATTTCACGTTCGATAATCGACAGTTGATTCGGTTTTTCAATTAAAATGCTTTTCATTACCTTACTCCTTACCAGTTCCACAGCGTGCCATCTTCCAGACGTGCGACTGGCAGATAAGCAGGTTCATAGGGATATTTCGCCGCCAGCTTTTCATCGAATTCGATGCCAAGAC	NA	NA	NA	NA
WP_000598292.1|1736557_1736884_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1737018_1737360_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1737394_1737955_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1737957_1738668_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1738775_1739081_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041685.1|1739279_1741706_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	2.7e-214
>prophage 5
NC_022364	Escherichia coli LY180, complete sequence	4835601	2241313	2279128	4835601	capsid,plate,integrase,terminase,lysis,head,tail,holin,portal,tRNA	Escherichia_phage(46.67%)	50	2246371:2246398	2277321:2277348
WP_000675150.1|2241313_2242717_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137869.1|2242713_2243436_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000929408.1|2243626_2243959_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2244167_2244464_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2244465_2244762_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2244864_2246226_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
2246371:2246398	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|2246498_2246717_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882938.1|2246797_2247961_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	4.8e-206
WP_000978889.1|2247960_2248440_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069967.1|2248454_2250902_-|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.8	0.0e+00
WP_000785970.1|2250894_2251014_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|2251046_2251322_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|2251378_2251897_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286686.1|2251909_2253100_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_000905100.1|2253159_2253753_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	98.0	1.2e-104
WP_000049773.1|2254198_2254639_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	61.9	2.7e-48
WP_000805553.1|2254610_2255204_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	63.0	1.3e-58
WP_000216987.1|2255203_2256487_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	64.6	6.6e-156
WP_001285343.1|2256483_2257095_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_001121496.1|2257087_2257996_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	2.8e-161
WP_000127163.1|2258000_2258348_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093712.1|2258344_2258980_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	6.5e-112
WP_001001780.1|2259046_2259499_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917179.1|2259491_2259959_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
WP_001119512.1|2259921_2260080_-	hypothetical protein	NA	M1RZ27	Escherichia_phage	100.0	2.6e-22
WP_000040682.1|2260066_2260492_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	100.0	7.7e-69
WP_000736570.1|2260479_2260905_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
WP_001144178.1|2260919_2261417_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000123123.1|2261416_2261698_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|2261701_2261905_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_001350080.1|2261904_2262414_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
WP_000203430.1|2262513_2263257_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.0	2.3e-121
WP_001248584.1|2263260_2264334_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	7.4e-201
WP_001085948.1|2264392_2265247_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156872.1|2265420_2267193_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_000038162.1|2267192_2268221_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_001350078.1|2268279_2268852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000744812.1|2268844_2270278_-	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_000268602.1|2271442_2273719_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.9	0.0e+00
WP_000027664.1|2273708_2273984_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113270.1|2273980_2274205_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277968.1|2274207_2274507_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	4.2e-45
WP_071842580.1|2274506_2274689_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.3	7.2e-24
WP_000217680.1|2274737_2275238_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	99.4	1.7e-91
WP_001005162.1|2275234_2275405_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_001081582.1|2275415_2275691_-	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|2275812_2276112_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985260.1|2276227_2277241_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_001352710.1|2277505_2277823_-	hypothetical protein	NA	NA	NA	NA	NA
2277321:2277348	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|2278228_2279128_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 6
NC_022364	Escherichia coli LY180, complete sequence	4835601	2317101	2326542	4835601		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001349937.1|2317101_2318238_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_001349936.1|2318234_2320235_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001295429.1|2320359_2320821_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2320860_2321331_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2321377_2322097_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2322093_2323779_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2324000_2324732_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2324791_2324899_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2324879_2325611_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569367.1|2325615_2326542_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	9.7e-24
>prophage 7
NC_022364	Escherichia coli LY180, complete sequence	4835601	2829867	2837631	4835601	transposase,integrase	Escherichia_phage(66.67%)	6	2827655:2827668	2834768:2834781
2827655:2827668	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|2829867_2830350_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|2831092_2832322_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|2832360_2832777_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|2832848_2834597_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000577254.1|2834598_2836317_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
2834768:2834781	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_085947771.1|2836468_2837631_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 8
NC_022364	Escherichia coli LY180, complete sequence	4835601	2912302	2919442	4835601		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2912302_2914864_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|2914969_2915626_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|2915676_2916444_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2916639_2917548_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2917544_2918807_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2918803_2919442_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 9
NC_022364	Escherichia coli LY180, complete sequence	4835601	4220616	4312226	4835601	protease,capsid,plate,holin,transposase,integrase,lysis,head,tail,terminase,portal,tRNA	Escherichia_virus(38.78%)	98	4251278:4251324	4283957:4284003
WP_000560983.1|4220616_4221054_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|4221098_4222040_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001162704.1|4222103_4223012_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|4223240_4223552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|4223552_4223843_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|4224447_4224666_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001086388.1|4224884_4225127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027702.1|4225456_4226386_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|4226382_4227018_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|4227014_4227917_-	formate dehydrogenase O subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|4227929_4230980_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753583.1|4231173_4232007_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001317404.1|4232159_4233200_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931314.1|4233249_4234998_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001019466.1|4234997_4236068_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446010.1|4236057_4237509_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729595.1|4237519_4237966_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|4238266_4238581_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|4238590_4239415_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000211486.1|4239656_4240916_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144046.1|4240912_4242382_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217162.1|4242669_4243506_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001350036.1|4243489_4244428_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063504.1|4244424_4245459_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|4245743_4246364_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166050.1|4246623_4247607_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|4247755_4248430_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4248535_4249909_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4249905_4250604_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|4250753_4251254_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4251278:4251324	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000023383.1|4251439_4252420_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7Y4C5	Escherichia_virus	100.0	1.0e-185
WP_001192857.1|4252489_4252783_-	helix-turn-helix domain-containing protein	NA	Q1JS45	Enterobacteria_phage	100.0	1.0e-48
WP_000453534.1|4252935_4253208_+	hypothetical protein	NA	Q1JS44	Enterobacteria_phage	100.0	1.5e-46
WP_001350035.1|4253183_4253381_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	96.9	8.0e-29
WP_000217679.1|4253377_4253878_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557702.1|4253941_4254166_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	100.0	6.1e-33
WP_001277905.1|4254165_4254468_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	100.0	3.5e-47
WP_001113263.1|4254467_4254692_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	100.0	2.2e-35
WP_000027664.1|4254688_4254964_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268589.1|4254953_4257239_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	99.9	0.0e+00
WP_014640573.1|4257238_4257691_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	96.7	6.1e-80
WP_001143634.1|4258139_4259078_+	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	100.0	3.1e-187
WP_001350076.1|4259074_4260100_-	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	100.0	3.3e-198
WP_000368931.1|4260104_4261178_-	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	100.0	1.2e-203
WP_000038147.1|4261593_4262628_-|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	100.0	2.4e-201
WP_000156872.1|4262627_4264400_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085948.1|4264573_4265428_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000203430.1|4266564_4267308_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	96.0	2.3e-121
WP_001350080.1|4267407_4267917_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	2.1e-89
WP_000846399.1|4267916_4268120_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123123.1|4268123_4268405_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144178.1|4268404_4268902_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	3.4e-92
WP_000736570.1|4268916_4269342_+	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	2.9e-60
WP_000040682.1|4269329_4269755_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	100.0	7.7e-69
WP_001119512.1|4269741_4269900_+	hypothetical protein	NA	M1RZ27	Escherichia_phage	100.0	2.6e-22
WP_000917179.1|4269862_4270330_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	100.0	3.0e-82
WP_001001780.1|4270322_4270775_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001093706.1|4270841_4271477_+|plate	phage baseplate assembly protein V	plate	Q7Y4D8	Escherichia_virus	100.0	2.4e-106
WP_000127163.1|4271473_4271821_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121482.1|4271825_4272734_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_001285313.1|4272726_4273257_+|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	99.4	1.3e-102
WP_000104720.1|4273267_4275277_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	99.6	0.0e+00
WP_001164149.1|4275280_4275808_+|tail	tail fiber assembly protein	tail	Q7Y4D3	Escherichia_virus	98.3	5.6e-93
WP_000014362.1|4276023_4276923_+	hypothetical protein	NA	Q7Y4D2	Escherichia_virus	100.0	6.2e-169
WP_001286683.1|4277242_4278433_+|tail	phage tail sheath protein	tail	Q7Y4D1	Escherichia_virus	99.7	8.1e-225
WP_001251408.1|4278445_4278964_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4279020_4279296_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4279328_4279448_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001283070.1|4279440_4281888_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	100.0	0.0e+00
WP_000978900.1|4281902_4282382_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	100.0	5.1e-85
WP_000882968.1|4282381_4283545_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	98.4	1.3e-206
WP_000468308.1|4283626_4283845_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076742.1|4284081_4284984_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
4283957:4284003	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|4285164_4286127_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|4286446_4287436_+	sulfate/thiosulfate ABC transporter substrate-binding protein Sbp	NA	NA	NA	NA	NA
WP_000708994.1|4287542_4288298_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4288352_4289120_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|4289227_4289827_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155254.1|4289927_4290368_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4290579_4290879_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|4290905_4291334_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|4291338_4292085_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4292181_4293192_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|4293327_4294836_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4294858_4295704_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4296128_4296374_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4296458_4296944_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4297036_4297963_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|4298029_4299361_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4299370_4299901_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068834.1|4299993_4300953_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|4301044_4302070_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001350069.1|4302225_4304424_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|4304626_4304839_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000015021.1|4304998_4309171_+	rhs element protein RhsC	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.6e-25
WP_001323627.1|4309172_4309496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000797341.1|4310402_4311011_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000399648.1|4311245_4312226_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
