The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NC_022353	Campylobacter jejuni subsp. jejuni 00-2544, complete sequence	1719532	123072	179828	1719532	tail,transposase,capsid,terminase,tRNA,plate,integrase	Campylobacter_phage(57.58%)	76	140364:140383	188675:188694
WP_002851719.1|123072_123828_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	32.5	3.1e-28
WP_002785057.1|123832_124354_+	cysteine hydrolase family protein	NA	NA	NA	NA	NA
WP_002851895.1|124353_124968_+	recombination protein RecO	NA	NA	NA	NA	NA
WP_002851664.1|124964_125372_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002851870.1|125495_126185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002851926.1|126209_127136_-|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_002851806.1|127132_128119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002851949.1|128108_128471_-	molecular chaperone DnaK suppressor DksA	NA	NA	NA	NA	NA
WP_002851666.1|128482_128932_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_002851791.1|128933_129776_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_002851687.1|129784_130507_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_002851708.1|130506_132726_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_002851653.1|132802_133630_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002858680.1|133709_135083_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002851689.1|135082_135967_+	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_002851789.1|136005_136407_+|tRNA	tRNA threonylcarbamoyladenosine biosynthesis protein TsaB	tRNA	NA	NA	NA	NA
WP_002851909.1|136415_137294_+	homoserine kinase	NA	NA	NA	NA	NA
WP_002859353.1|137318_137576_+	YlxR family protein	NA	NA	NA	NA	NA
WP_002908209.1|137562_140178_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	28.1	1.7e-28
WP_002778650.1|140174_140537_+	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
140364:140383	attL	AAAATTTTATCTTCTTTAAA	NA	NA	NA	NA
WP_002858729.1|140526_140970_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_002804146.1|141819_142518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002804144.1|142517_143192_-	LexA family transcriptional regulator	NA	X2KRC9	Campylobacter_phage	32.1	9.8e-26
WP_002804142.1|143341_143542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876259.1|143538_145614_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002806833.1|145684_146608_+	AAA family ATPase	NA	A0A2H4JAW1	uncultured_Caudovirales_phage	24.5	3.9e-09
WP_002795448.1|146610_146802_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_002824157.1|146798_146984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791419.1|147042_147384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002922653.1|147490_147976_+	host-nuclease inhibitor Gam family protein	NA	A0A2K9VGT9	Faecalibacterium_phage	33.3	8.4e-19
WP_002876317.1|148034_148997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784531.1|148993_149263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876316.1|149262_149955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876315.1|149951_150401_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_002873721.1|150447_150723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876312.1|150714_151386_-	endonuclease	NA	NA	NA	NA	NA
WP_002784523.1|151479_151764_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_002872705.1|151885_152092_+	CJH_07325 family protein	NA	J9SI91	Campylobacter_phage	100.0	2.8e-32
WP_002872706.1|152078_152870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002872707.1|152834_153812_-|tail	tail protein	tail	A0A219Y9Y2	Aeromonas_phage	25.7	6.2e-13
WP_002784520.1|153805_153997_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_002876309.1|153989_154364_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002909482.1|154489_155728_-	hypothetical protein	NA	M4M9M5	Vibrio_phage	29.8	1.9e-19
WP_002872709.1|155729_157100_-	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.6	4.5e-17
WP_002875116.1|157109_158780_-|terminase	phage terminase large subunit	terminase	H1ZZE1	Pseudomonas_virus	41.4	3.0e-92
WP_002803360.1|158779_159379_-	DUF1804 family protein	NA	NA	NA	NA	NA
WP_002855185.1|159371_159830_-	DUF1320 family protein	NA	NA	NA	NA	NA
WP_002876307.1|159945_160923_-|capsid	major capsid protein	capsid	R9TRN2	Rhizobium_phage	23.4	5.6e-06
WP_002875114.1|160925_161453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002876306.1|161455_162271_-	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
WP_002784501.1|162272_162707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021034186.1|162855_163245_+	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	46.7	1.7e-22
WP_002854893.1|163255_163597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021036343.1|163593_163842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784492.1|163953_164268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002876443.1|164267_164900_+|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	34.6	1.7e-08
WP_002784486.1|164908_165100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002795239.1|165096_165387_+	GPW/gp25 family protein	NA	Q8H9N4	Vibrio_phage	40.8	2.7e-09
WP_002876444.1|165383_166550_+|plate	baseplate J/gp47 family protein	plate	Q8H9N3	Vibrio_phage	24.6	3.0e-14
WP_002855112.1|166546_167167_+|tail	phage tail protein I	tail	A7YH02	Campylobacter_phage	100.0	8.7e-61
WP_002875274.1|167166_168198_+|tail	phage tail protein	tail	A7YGA7	Campylobacter_phage	100.0	2.5e-190
WP_002875277.1|168222_168729_+	DUF4376 domain-containing protein	NA	A7YGA6	Campylobacter_phage	100.0	2.0e-87
WP_002922150.1|168725_169097_+	DUF1353 domain-containing protein	NA	A7YGA5	Campylobacter_phage	100.0	8.8e-69
WP_021034188.1|169196_170210_+	hypothetical protein	NA	A7YGA4	Campylobacter_phage	100.0	2.7e-192
WP_002922156.1|170220_171414_+|tail	tail sheath protein	tail	A7YGA3	Campylobacter_phage	100.0	5.0e-198
WP_002865376.1|171440_171950_+|tail	phage major tail tube protein	tail	A7YG76	Campylobacter_phage	100.0	3.3e-90
WP_002843342.1|172102_172342_+|tail	phage tail assembly protein	tail	A7YGZ3	Campylobacter_phage	62.5	3.2e-11
WP_002784655.1|172453_172759_-	hypothetical protein	NA	A7YG98	Campylobacter_phage	100.0	4.7e-36
WP_002875579.1|172800_175023_+|tail	phage tail tape measure protein	tail	A7YG97	Campylobacter_phage	100.0	0.0e+00
WP_002875578.1|175026_175515_+	phage virion morphogenesis protein	NA	A7YG96	Campylobacter_phage	100.0	1.6e-89
WP_002922158.1|175619_176435_+	DNA adenine methylase	NA	A7YG95	Campylobacter_phage	100.0	6.3e-152
WP_019109140.1|176462_176750_-	hypothetical protein	NA	A7YG94	Campylobacter_phage	100.0	1.9e-47
WP_002875224.1|176829_177024_-	hypothetical protein	NA	A7YG72	Campylobacter_phage	98.4	5.1e-28
WP_002865000.1|177033_177354_-	hypothetical protein	NA	A7YGI4	Campylobacter_phage	100.0	1.3e-52
WP_019108975.1|177434_178064_-	S24 family peptidase	NA	A7YGK7	Campylobacter_phage	100.0	2.6e-60
WP_002908983.1|178130_179828_-	AAA family ATPase	NA	X2KLG0	Campylobacter_phage	38.3	1.9e-89
188675:188694	attR	AAAATTTTATCTTCTTTAAA	NA	NA	NA	NA
>prophage 2
NC_022353	Campylobacter jejuni subsp. jejuni 00-2544, complete sequence	1719532	1246717	1294715	1719532	tail,capsid,protease,head,portal,terminase,tRNA,integrase	Campylobacter_phage(94.64%)	64	1256344:1256361	1271443:1271460
WP_002858315.1|1246717_1247923_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A1S6UA79	Serratia_phage	29.9	4.9e-28
WP_002858057.1|1247934_1250130_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	44.0	1.4e-07
WP_002853464.1|1250113_1250338_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_002858454.1|1250348_1251068_-	UMP kinase	NA	NA	NA	NA	NA
WP_002853860.1|1251119_1252313_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_002853622.1|1252309_1253116_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_002853534.1|1253102_1253768_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.8	2.8e-17
WP_002858203.1|1253837_1255016_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_014516824.1|1255015_1256251_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_002858282.1|1256195_1257164_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
1256344:1256361	attL	ATAAAATACAAAAAATAA	NA	NA	NA	NA
WP_002853654.1|1257241_1258342_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_002787311.1|1258680_1259856_+|integrase	site-specific integrase	integrase	X2KXI6	Campylobacter_phage	100.0	1.7e-222
WP_002787309.1|1259852_1260059_-	helix-turn-helix domain-containing protein	NA	X2KXB9	Campylobacter_phage	100.0	4.8e-32
WP_002787307.1|1260060_1260414_-	hypothetical protein	NA	X2KRB4	Campylobacter_phage	100.0	2.1e-56
WP_002787306.1|1260431_1261187_-	site-specific DNA-methyltransferase	NA	X2KR14	Campylobacter_phage	100.0	9.6e-147
WP_002787304.1|1261164_1261431_-	hypothetical protein	NA	X2KLR9	Campylobacter_phage	100.0	4.7e-40
WP_002858334.1|1261414_1261786_-	hypothetical protein	NA	X2KQ09	Campylobacter_phage	100.0	1.2e-60
WP_011049924.1|1261786_1262011_-	hypothetical protein	NA	X2KXC3	Campylobacter_phage	100.0	4.1e-37
WP_002869676.1|1262019_1262781_-	hypothetical protein	NA	X2KQ45	Campylobacter_phage	99.5	4.0e-124
WP_002787295.1|1262717_1263032_-	hypothetical protein	NA	X2KR17	Campylobacter_phage	100.0	1.6e-50
WP_002787293.1|1263110_1263431_-	hypothetical protein	NA	X2KLS2	Campylobacter_phage	100.0	1.4e-51
WP_002787289.1|1263818_1264055_-	hypothetical protein	NA	X2KXC5	Campylobacter_phage	100.0	8.1e-36
WP_002787287.1|1264068_1264836_-	hypothetical protein	NA	X2KRC2	Campylobacter_phage	100.0	3.7e-138
WP_002787283.1|1264973_1265204_-	hypothetical protein	NA	X2KLS5	Campylobacter_phage	100.0	5.0e-38
WP_002787281.1|1265169_1265433_-	hypothetical protein	NA	X2KQ17	Campylobacter_phage	100.0	4.1e-44
WP_002787279.1|1265489_1265777_-	hypothetical protein	NA	X2KXC8	Campylobacter_phage	100.0	2.4e-50
WP_011049928.1|1265829_1266561_-	phage antirepressor KilAC domain-containing protein	NA	X2KRC4	Campylobacter_phage	100.0	2.8e-127
WP_002912332.1|1266991_1267276_-	hypothetical protein	NA	X2KLS8	Campylobacter_phage	100.0	4.5e-41
WP_002870299.1|1267272_1267476_-	hypothetical protein	NA	X2KQ19	Campylobacter_phage	100.0	4.8e-29
WP_002870336.1|1267680_1268334_+	hypothetical protein	NA	X2KXC9	Campylobacter_phage	100.0	1.2e-113
WP_002870274.1|1268568_1269231_+	S24/S26 family peptidase	NA	X2KRC9	Campylobacter_phage	100.0	4.2e-122
WP_011049930.1|1269236_1269890_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	100.0	9.3e-122
WP_002870263.1|1269906_1270188_+	PLDc N-terminal domain-containing protein	NA	X2KLT3	Campylobacter_phage	100.0	9.3e-47
WP_002913413.1|1270201_1270399_-	hypothetical protein	NA	X2KQ22	Campylobacter_phage	100.0	4.4e-27
WP_002870261.1|1270316_1270736_-	hypothetical protein	NA	X2KXD3	Campylobacter_phage	100.0	2.9e-52
WP_002870260.1|1270964_1271426_-	hypothetical protein	NA	X2KRD2	Campylobacter_phage	100.0	1.4e-84
WP_002788854.1|1271474_1272758_-	hypothetical protein	NA	X2KLT6	Campylobacter_phage	100.0	1.6e-239
1271443:1271460	attR	TTATTTTTTGTATTTTAT	NA	NA	NA	NA
WP_019108750.1|1272754_1273129_-	DUF1353 domain-containing protein	NA	X2KQ25	Campylobacter_phage	100.0	1.2e-68
WP_002869963.1|1273121_1273505_-	hypothetical protein	NA	X2KXD5	Campylobacter_phage	100.0	2.4e-61
WP_002789149.1|1273501_1274137_-	DUF4376 domain-containing protein	NA	X2KRD7	Campylobacter_phage	100.0	1.3e-96
WP_002798141.1|1274149_1274599_-	hypothetical protein	NA	X2KR34	Campylobacter_phage	100.0	4.6e-80
WP_011049933.1|1274600_1276166_-	hypothetical protein	NA	X2KLU0	Campylobacter_phage	100.0	3.3e-210
WP_002869967.1|1276158_1276791_-	hypothetical protein	NA	X2KQ29	Campylobacter_phage	100.0	6.0e-110
WP_002788295.1|1276787_1277105_-|head,tail	head-tail adaptor protein	head,tail	X2KXD7	Campylobacter_phage	100.0	9.2e-51
WP_002788293.1|1277117_1277555_-|head,tail	phage gp6-like head-tail connector protein	head,tail	X2KR38	Campylobacter_phage	100.0	1.8e-76
WP_002788291.1|1277551_1277803_-	hypothetical protein	NA	X2KLU2	Campylobacter_phage	100.0	3.7e-18
WP_002788288.1|1277813_1278980_-|capsid	phage major capsid protein	capsid	X2KQ31	Campylobacter_phage	100.0	2.8e-214
WP_002788287.1|1278996_1279554_-|head,protease	HK97 family phage prohead protease	head,protease	X2KXE1	Campylobacter_phage	100.0	1.1e-96
WP_002788286.1|1279639_1280509_-	hypothetical protein	NA	X2KRE5	Campylobacter_phage	100.0	3.9e-168
WP_019108749.1|1280521_1286221_-	hypothetical protein	NA	X2KR41	Campylobacter_phage	100.0	0.0e+00
WP_002788283.1|1286280_1286619_+	hypothetical protein	NA	X2KLU6	Campylobacter_phage	100.0	1.6e-56
WP_002788282.1|1286610_1286826_-	hypothetical protein	NA	X2KXE3	Campylobacter_phage	100.0	2.2e-32
WP_002788281.1|1286906_1287263_-	hypothetical protein	NA	X2KRE9	Campylobacter_phage	100.0	1.8e-58
WP_002788279.1|1287259_1288240_-	hypothetical protein	NA	X2KR44	Campylobacter_phage	100.0	3.9e-180
WP_002869970.1|1288386_1288611_+	hypothetical protein	NA	X2KLV0	Campylobacter_phage	100.0	5.7e-31
WP_002869971.1|1288607_1288871_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	X2KQ37	Campylobacter_phage	100.0	2.9e-34
WP_002788276.1|1288858_1289209_-	hypothetical protein	NA	X2KXE7	Campylobacter_phage	100.0	7.3e-57
WP_002800770.1|1289209_1289752_-	HK97 gp10 family phage protein	NA	X2KRF4	Campylobacter_phage	100.0	5.7e-93
WP_002788272.1|1289748_1290921_-|portal	phage portal protein	portal	X2KR48	Campylobacter_phage	100.0	3.1e-216
WP_002913302.1|1291080_1291515_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	X2KLV2	Campylobacter_phage	100.0	2.4e-78
WP_002913304.1|1291569_1293195_-|terminase	terminase large subunit	terminase	X2KQ40	Campylobacter_phage	100.0	0.0e+00
WP_002913306.1|1293198_1293837_-|terminase	P27 family phage terminase small subunit	terminase	X2KXE9	Campylobacter_phage	100.0	1.9e-111
WP_002869973.1|1294087_1294438_-	HNH endonuclease	NA	X2KRF8	Campylobacter_phage	100.0	1.9e-65
WP_002788257.1|1294424_1294715_-	hypothetical protein	NA	X2KM44	Campylobacter_phage	97.4	2.6e-15
>prophage 3
NC_022353	Campylobacter jejuni subsp. jejuni 00-2544, complete sequence	1719532	1436096	1442732	1719532		Tupanvirus(16.67%)	8	NA	NA
WP_002857908.1|1436096_1436762_-	D-glycero-D-manno-heptose 1-phosphate guanosyltransferase	NA	A0A2K9L821	Tupanvirus	26.6	4.1e-08
WP_002857991.1|1436749_1437355_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	35.0	2.2e-16
WP_002858413.1|1437342_1438362_-	D-glycero-D-manno-heptose 7-phosphate kinase	NA	A0A222YW25	Synechococcus_phage	40.7	2.7e-59
WP_002857889.1|1438381_1439233_-	FkbM family methyltransferase	NA	NA	NA	NA	NA
WP_002858299.1|1439251_1440193_-	NAD-dependent epimerase/dehydratase	NA	A0A0F7LC08	uncultured_marine_virus	46.1	1.0e-73
WP_002864205.1|1440216_1441257_-	GDP-L-fucose synthase	NA	M1HWW2	Paramecium_bursaria_Chlorella_virus	44.4	1.7e-69
WP_002864204.1|1441256_1442183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002858190.1|1442186_1442732_-	dTDP-4-dehydrorhamnose 3,5-epimerase family protein	NA	A0A1D8EQH2	Escherichia_phage	32.4	6.1e-18
>prophage 1
NC_022354	Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence	46902	0	1781	46902		Campylobacter_phage(100.0%)	3	NA	NA
WP_002804244.1|626_893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002790730.1|895_1456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002779704.1|1514_1781_-	hypothetical protein	NA	A0A2R3ZY63	Campylobacter_phage	90.4	6.8e-39
>prophage 2
NC_022354	Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence	46902	4984	14703	46902	transposase	Streptococcus_phage(66.67%)	8	NA	NA
WP_001096887.1|4984_5779_-	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_002817934.1|5862_7146_-|transposase	transposase	transposase	A0A1S5RFS3	Helicobacter_phage	62.9	4.5e-144
WP_002782963.1|7132_7771_-|transposase	IS607-like element ISChh1 family transposase	transposase	A0A1S5RGS9	Helicobacter_phage	86.8	1.6e-97
WP_002779755.1|8282_8456_-	cysteine-rich KTR domain-containing protein	NA	D0R0F6	Streptococcus_phage	100.0	4.6e-28
WP_002779752.1|8507_10427_-	tetracycline resistance ribosomal protection protein Tet(O)	NA	A0A1B0RXH7	Streptococcus_phage	98.3	0.0e+00
WP_002779751.1|10785_10965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002790581.1|10983_12405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002779644.1|12510_14703_-	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	23.3	3.8e-18
>prophage 3
NC_022354	Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence	46902	26065	27627	46902		Yersinia_phage(50.0%)	3	NA	NA
WP_002779629.1|26065_26488_-	single-stranded DNA-binding protein	NA	A9DEQ4	Yersinia_phage	37.3	1.7e-12
WP_002779628.1|26521_27073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002779627.1|27069_27627_-	Rha family transcriptional regulator	NA	X2KM03	Campylobacter_phage	50.8	7.4e-19
>prophage 4
NC_022354	Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence	46902	31569	32184	46902		Bacteroides_phage(100.0%)	1	NA	NA
WP_002803413.1|31569_32184_+	recombinase family protein	NA	H2A0H0	Bacteroides_phage	33.0	5.4e-15
>prophage 5
NC_022354	Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence	46902	35781	37008	46902		Escherichia_phage(100.0%)	1	NA	NA
WP_002823310.1|35781_37008_-	toprim domain-containing protein	NA	A0A1W6JT61	Escherichia_phage	31.1	2.3e-20
>prophage 6
NC_022354	Campylobacter jejuni subsp. jejuni 00-2544 plasmid unnamed, complete sequence	46902	40818	41430	46902		Burkholderia_virus(100.0%)	1	NA	NA
WP_031263757.1|40818_41430_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	43.3	6.2e-27
